ID: 1142479746

View in Genome Browser
Species Human (GRCh38)
Location 17:211747-211769
Sequence CCCCAAGGGTAGCCAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142479746_1142479756 15 Left 1142479746 17:211747-211769 CCAGCCTTTGGCTACCCTTGGGG No data
Right 1142479756 17:211785-211807 CTTTTCAGATCACCATTGGCCGG No data
1142479746_1142479755 11 Left 1142479746 17:211747-211769 CCAGCCTTTGGCTACCCTTGGGG No data
Right 1142479755 17:211781-211803 GAATCTTTTCAGATCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142479746 Original CRISPR CCCCAAGGGTAGCCAAAGGC TGG (reversed) Intergenic
No off target data available for this crispr