ID: 1142480766

View in Genome Browser
Species Human (GRCh38)
Location 17:216871-216893
Sequence GGGGTGGTGGTACGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142480763_1142480766 -5 Left 1142480763 17:216853-216875 CCATGGTCACAGGAGAGGGGGGT 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1142480766 17:216871-216893 GGGGTGGTGGTACGTGTGTCAGG 0: 1
1: 0
2: 0
3: 24
4: 276
1142480756_1142480766 9 Left 1142480756 17:216839-216861 CCTAGTAATGTCTGCCATGGTCA 0: 1
1: 1
2: 2
3: 8
4: 124
Right 1142480766 17:216871-216893 GGGGTGGTGGTACGTGTGTCAGG 0: 1
1: 0
2: 0
3: 24
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142480766 Original CRISPR GGGGTGGTGGTACGTGTGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900356979 1:2269773-2269795 TGGCTGGTGGTACCTGTGGCTGG + Intronic
900381903 1:2388637-2388659 GGTGTGGTGGTACGTGTTTGTGG + Intronic
902231311 1:15029501-15029523 GGGGTGTGTGTACGTGTGCCTGG - Intronic
903285316 1:22273350-22273372 GGGGAGGGGGGCCGTGTGTCAGG - Intergenic
907311079 1:53539478-53539500 GGGGGTGTGGTACGTGTGTGTGG - Intronic
908801367 1:67884237-67884259 GGGGTGGTGGCACGTGCCTGTGG - Intergenic
909627017 1:77729037-77729059 GGTGTGGTGGCACGTGCATCTGG - Intronic
910826111 1:91408861-91408883 GGTGTGGTGGTATGTATGTGTGG - Intergenic
910968190 1:92828889-92828911 GGCGTGGTGGTACGTGCCTGTGG - Intergenic
912284620 1:108355885-108355907 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
912854475 1:113154827-113154849 GGGGAGGTTGTCCGTGTGTGGGG - Intergenic
912954473 1:114144916-114144938 GGGGTGGTGGTAGGTGGCTCAGG - Intronic
913129878 1:115829522-115829544 GGGCTGGTTCTGCGTGTGTCTGG - Intergenic
914202586 1:145499334-145499356 GGGGTGGTGGTGTGTGTCTGTGG - Intergenic
914236516 1:145817262-145817284 GGGGTGGTGGTGTGTGTCTGTGG - Intronic
914481709 1:148072485-148072507 GGGGTGGTGGTGTGTGTCTGTGG - Intergenic
915721266 1:157987604-157987626 GGGGAGTGGGTACGTGTGTGGGG - Intergenic
915953781 1:160206804-160206826 GGGAAAGTGGTACGTGTGTCTGG + Intronic
917292900 1:173489736-173489758 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
920343588 1:205291711-205291733 GGGGTGGTGGCACGTGCCTGTGG + Intergenic
921252468 1:213310835-213310857 GGGCTGGTGGCACGTGTTTCTGG + Intergenic
921279508 1:213551620-213551642 GGGGAGGTAGTGCCTGTGTCGGG - Intergenic
921312356 1:213856801-213856823 GGGCTGGTAGTCAGTGTGTCTGG + Intergenic
923019096 1:230149018-230149040 GGCGTGGTGGTACGTGCCTGTGG - Intronic
923125329 1:231029350-231029372 GGTGTGGTGGTACGTGCCTGTGG + Intronic
923622024 1:235587411-235587433 GGGGTGGGGGTGTGTGTGTGAGG + Intronic
1062974033 10:1670572-1670594 GGGCTGCTGGTATGTGTGGCAGG - Intronic
1064700573 10:18015959-18015981 GGGGTGGTTGTGCATGTGTGGGG - Intronic
1068562413 10:58530194-58530216 GGGGTGGAGGTACGTGACCCAGG - Intronic
1070223810 10:74479136-74479158 GGTGTGGTGGTACGTGCCTGTGG - Intronic
1072336768 10:94404000-94404022 GGGGAGGCGGTATGTGTGTACGG + Intronic
1075580932 10:123617875-123617897 GAGGGGGTGGTATGTGTGTTTGG - Intergenic
1075726628 10:124613877-124613899 GGGGTGGTGGGCAGTGTGCCTGG - Exonic
1077496441 11:2888945-2888967 GGTGTGGTGGCACGTGTCTGTGG + Intronic
1078325522 11:10377741-10377763 GGTGTGGTGGCACGTGTCTGTGG + Intronic
1079104824 11:17563818-17563840 GGTGTGGTGGCACGTGTCTGTGG - Intronic
1079126803 11:17723099-17723121 GGGGAGGTGGTAAGTGAGTGGGG - Intergenic
1079783726 11:24643285-24643307 GGCGTGGTGGTGCATCTGTCTGG + Intronic
1081664011 11:44905934-44905956 GGGTTGGTGGGAAGTTTGTCAGG + Intronic
1082786336 11:57319232-57319254 GGGGTGGGGCTGCGTGTGTCAGG - Intronic
1083173472 11:60936008-60936030 GGGGTGGTGGTGAGTGGGGCAGG + Exonic
1083551714 11:63594890-63594912 GGGGTGGGGGTACATGGGTAAGG + Intronic
1084156260 11:67314427-67314449 GGGGTGGTGGTGAGAGTGTCGGG + Intergenic
1084318283 11:68358532-68358554 GTGGGGGTGGTGCGTGTGACAGG - Intronic
1084318546 11:68360149-68360171 GGCGTGGTGGTACGTGCCTGTGG - Intronic
1084678181 11:70649101-70649123 GGGGAGATGGCACGTGTGCCAGG - Intronic
1084754951 11:71232228-71232250 GGGGTGGAAGGAAGTGTGTCAGG + Intronic
1084944793 11:72632773-72632795 GGGGTGGTGGGAGGTGTGAGGGG - Intronic
1084964755 11:72738799-72738821 GGTGGGGTGGTAGGTGTGTGTGG - Intronic
1085018732 11:73191899-73191921 GGGGTGGGGGTACATGGGTCGGG - Intergenic
1085758095 11:79218241-79218263 GGGGTGGGGTTGTGTGTGTCGGG - Intronic
1087702910 11:101456644-101456666 GGGGTGGTGGGAGCTGTGACTGG - Intronic
1089584423 11:119501386-119501408 GGTGTGGTGGTGCGTGTCTGTGG + Intergenic
1091097350 11:132836818-132836840 GGGGTGGTGCTGTGAGTGTCGGG + Intronic
1091496090 12:973923-973945 GGTGTGGTGGTACGTGCCTGTGG - Intronic
1093720573 12:22437468-22437490 GGGGTGGGGCTAGGTGTGTCTGG - Intergenic
1093892787 12:24543546-24543568 GGCATGGTGGTACGCGTGTGTGG + Intergenic
1094022414 12:25928191-25928213 GGCGTGGTGGTACCTGTCTGTGG + Intergenic
1095207165 12:39451442-39451464 GTGGTGGTGGTGTGTGTGTTGGG - Intergenic
1096008420 12:48191497-48191519 GGGGTGGGGGAAAGTCTGTCTGG + Intergenic
1096838065 12:54363751-54363773 GGGGTGGTGGTGGCTGTGACAGG - Exonic
1101156222 12:101930078-101930100 GGGGTTGTCGTCCGTCTGTCTGG + Intronic
1102256678 12:111419161-111419183 GGTGTGGTGGTACGTGCCTGTGG + Intronic
1103293653 12:119867688-119867710 GGGGTGGTGGTGTGTGAGTTTGG - Intronic
1103447874 12:121006074-121006096 GGGGTGGTGGTGTGTGTCTGTGG + Intronic
1103607070 12:122094975-122094997 GGTGTGGGGGTATGTGTGTGCGG + Intronic
1104980186 12:132570164-132570186 GGGATGCAGGCACGTGTGTCGGG - Exonic
1106519400 13:30483751-30483773 GGTGTGGTGGTGCGTGTCTGTGG - Intronic
1108293415 13:48986533-48986555 GGTGTGGTGGCACGTGCTTCTGG - Intronic
1108617042 13:52143393-52143415 GGGGAGGTGGTATGTGTGTGGGG - Intronic
1110557554 13:76877612-76877634 GGGGTGGTGGGGAGTGGGTCAGG - Intergenic
1111222947 13:85228497-85228519 GGGGTGGTGGGGGGTGTGTATGG - Intergenic
1111981923 13:95025391-95025413 GTGGTGGGGGTATGTGTGTGGGG - Intronic
1113479458 13:110609987-110610009 GGGGGGGTGCTACCTGTGCCAGG - Intergenic
1115628201 14:35216446-35216468 GGTGTGGTGGCACGTGCCTCTGG - Intronic
1115722959 14:36183029-36183051 GGGGTGGTGGCACGTGCCTGTGG + Intergenic
1119717059 14:76866928-76866950 GGGGGGGTGGTAGGTGTGTGGGG + Intronic
1120250789 14:82060141-82060163 GGGCTGCTGGTACATGAGTCTGG + Intergenic
1120400522 14:84025190-84025212 GGGGTGGTGGTAAATGTGTGAGG - Intergenic
1121076911 14:91076646-91076668 GGGATGGTGATACTTGGGTCAGG + Intronic
1121111900 14:91318274-91318296 GGCGTGGTGGTACGTGCCTGTGG + Intronic
1122149774 14:99718598-99718620 GGGGAGGTGGTATTTGAGTCGGG + Intronic
1122210070 14:100167985-100168007 GGGGTGGGGGTGTGTGTGTTGGG - Intergenic
1122210118 14:100168159-100168181 GGGGTGGGGGTGTGTGTGTTGGG - Intergenic
1122347937 14:101072025-101072047 GGTGTGGTGGTATCTGTGGCTGG + Intergenic
1122979821 14:105186444-105186466 GGTGTGGGGGTATGTGTGTGGGG + Intergenic
1122979861 14:105186580-105186602 GGTGTGGGGGTATGTGTGTGGGG + Intergenic
1123037866 14:105478705-105478727 CGGGTGGGGGTACGTGGGGCGGG - Intronic
1124368908 15:29092210-29092232 GGGGAGATGGTACGTGTTTTAGG - Intronic
1125476432 15:40050913-40050935 GGGGGTGTGGTGTGTGTGTCTGG + Intergenic
1126618492 15:50612228-50612250 GGTGTGGTGGTACTTGTCTGTGG - Intronic
1127548136 15:60009180-60009202 GGGGTGGAGGCATGTGTGTTTGG - Intronic
1129055228 15:72814598-72814620 GTGGTGGTGGTAGGAGTATCTGG + Intergenic
1129934493 15:79437932-79437954 GGGGTGGTAGTGAGTGTGTGGGG + Intronic
1130178288 15:81597768-81597790 GGGGAGGTTGTGCGTGTGTGTGG - Intergenic
1131723443 15:95196726-95196748 GGGGTGGGGGTAGGGGTGCCTGG - Intergenic
1131984816 15:98032543-98032565 GGGGTGGGGGGATGTCTGTCTGG - Intergenic
1133166602 16:3952476-3952498 GGGGTGGTGGTGCGTGCCTGTGG - Intergenic
1134095748 16:11417362-11417384 GGTGTGGTGGTGCATGTGTGTGG - Intronic
1135103137 16:19624253-19624275 GGTGTGGTGGTACGTGCCTGTGG - Intronic
1135130587 16:19850875-19850897 GGCATGGTGGTGCGTGTGTGTGG + Intronic
1135719402 16:24802407-24802429 GGGGTGGTGGTACATACCTCTGG + Intronic
1136400217 16:30012864-30012886 GGCGTGGTGGTATGTGTCTTGGG + Intronic
1136686647 16:31998792-31998814 GGTGTGGTGGTGCGTGTCTGTGG + Intergenic
1136787259 16:32942329-32942351 GGTGTGGTGGTGCGTGTCTGTGG + Intergenic
1136882517 16:33911455-33911477 GGTGTGGTGGTGCGTGTCTGTGG - Intergenic
1137574938 16:49593293-49593315 GGGGTGGTGGCACGTGCCTGTGG + Intronic
1138006665 16:53343633-53343655 GGTGTGGTGGTGCGTGTCTATGG - Intergenic
1138571297 16:57875160-57875182 GGCGTGGTGGCACGCGTGTGTGG - Intergenic
1138703716 16:58892705-58892727 GTGGTGGTGGTAGCTGTGTGGGG - Intergenic
1138752360 16:59439188-59439210 GGGGTGGAGGGAAGTGTTTCAGG - Intergenic
1141533907 16:84665848-84665870 GGGGTGGTGGGGGGTGTGGCAGG - Intronic
1142385626 16:89762452-89762474 GGTGTGGTGGCACATGTGTGTGG + Intronic
1203089493 16_KI270728v1_random:1204001-1204023 GGTGTGGTGGTGCGTGTCTGTGG + Intergenic
1142480766 17:216871-216893 GGGGTGGTGGTACGTGTGTCAGG + Intronic
1142774625 17:2126997-2127019 GGTGTGGTGGTACGTGCTTGTGG + Intronic
1143084685 17:4406802-4406824 GGCGTGGTGGTGCATGTGTGTGG - Intergenic
1143658765 17:8312310-8312332 GGGGTGCTGGAAGGTGAGTCTGG - Exonic
1143772244 17:9176077-9176099 GGGGAGGTGGTGGGGGTGTCTGG - Intronic
1143855171 17:9843014-9843036 GGGGTGGTGGGTGGTGGGTCGGG - Intronic
1146938364 17:36826434-36826456 GGGGTGGGGGTACTGGCGTCTGG - Intergenic
1147147609 17:38494447-38494469 GGTGTGGTGGTGCGTGTCTGTGG + Intronic
1147325546 17:39667913-39667935 TGGGTGCTGGGACGGGTGTCCGG + Intergenic
1147649907 17:42055912-42055934 GGGGTAGTGGTAAGAGTGGCAGG - Intronic
1147690150 17:42309854-42309876 GGGGTGGTTGTTCTTGAGTCTGG + Intronic
1148054801 17:44787622-44787644 GGGGTGGTGGTTTGTGTTTAAGG - Intergenic
1148094312 17:45041796-45041818 GTGGTGGTGGTAAGTGGGTAAGG + Intronic
1148445471 17:47734454-47734476 GTGGTGGTGGTGTGTGTGTACGG + Intronic
1151540157 17:74760645-74760667 GGGGTGGGGGTGTGTGTGCCAGG - Intronic
1152306278 17:79522564-79522586 GGAGAGGTGGTGTGTGTGTCGGG - Intergenic
1152762706 17:82117496-82117518 GGTGTGGTGGTACGTGCCTGTGG + Intronic
1152855739 17:82663901-82663923 GAGGTGGTGGTCCGGTTGTCTGG - Intronic
1154167203 18:12024845-12024867 GGGGAGGCTGTACGTGTGTGGGG - Intronic
1154290945 18:13106285-13106307 GTGGTGGTGGTAGTTGTGTGGGG - Intronic
1154291002 18:13106574-13106596 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1154291018 18:13106654-13106676 GTGGTGGTGGTACCTGTGTGGGG - Intronic
1154291031 18:13106737-13106759 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1154345680 18:13541934-13541956 GGTGTGGTGGTACATGTCTATGG + Intronic
1157342994 18:46796104-46796126 GGTGTGGTGGTGCGTGTCTGTGG + Intergenic
1157907583 18:51583476-51583498 GGGGTGGTGGGTTGTGTTTCTGG - Intergenic
1158754763 18:60308759-60308781 GGGGTGGTGGTCTGGGGGTCTGG + Intergenic
1159880876 18:73857440-73857462 GTGGAGGTGGTAAGTGTGTGAGG - Intergenic
1160504322 18:79418463-79418485 GGGGTGGGGGCACGTGTCACGGG + Intronic
1160746399 19:713135-713157 GGGTTTTTGGTACCTGTGTCTGG + Intronic
1160799928 19:963057-963079 AGGGTGGTGGGAGGTGTTTCTGG + Intronic
1160813480 19:1024454-1024476 GGCGTGGTGGTGCGTGTCTACGG + Intergenic
1161308815 19:3582418-3582440 AAGGTGGTGGTACCTGTGCCAGG - Intergenic
1161490038 19:4556644-4556666 GGGGTGGTGGTAGGACTGACAGG + Intronic
1161495480 19:4583908-4583930 GGGGTGGGGGTAGGGGTGTGCGG + Intergenic
1162476088 19:10900170-10900192 GGGGTGGTGGCATGTGCGTGAGG + Intronic
1163021108 19:14481244-14481266 GGTGTGGTGGCACGTGTCTGTGG - Intronic
1163260166 19:16184814-16184836 GGGGTGGTGGGGCGTGGCTCAGG + Intergenic
1163513448 19:17749110-17749132 TGGGTGATGGTATGTGGGTCAGG - Intronic
1165189714 19:34052577-34052599 GGGGTATTGCTACGTGTCTCAGG - Intergenic
1165237234 19:34431629-34431651 TGTTTGGTGGTACGTGGGTCAGG + Intronic
1165305734 19:35001378-35001400 GGAGTGTTTGTACATGTGTCTGG + Intronic
1165691287 19:37865718-37865740 GGCGTGGTGGTACATGTTTGTGG - Intergenic
1165905826 19:39194042-39194064 GTGGTGGTGGTGGGAGTGTCTGG + Intergenic
1166317071 19:41994982-41995004 GGGGTGGTGTTGTGTGTGTGAGG - Intronic
925090874 2:1155254-1155276 GGGGTGTGGGTATGTGTGTGTGG - Intronic
925889991 2:8425912-8425934 GGGGTGGTGGGACAGGTGTTGGG - Intergenic
928517484 2:32057650-32057672 GTGGTTGTGGTACGTGTCTGTGG - Intergenic
929795584 2:45056032-45056054 GGGGTGGGGGCAGGTGGGTCAGG + Intergenic
930237187 2:48899669-48899691 GGGGTGGGGGTATGTGTGAGAGG + Intergenic
930761568 2:55044054-55044076 GGCGTGGTGGTACGTGCCTGTGG + Intronic
931799115 2:65741379-65741401 TGGGGCATGGTACGTGTGTCTGG + Intergenic
932189584 2:69729520-69729542 GGGGTGGTGCTACAGGTGTCTGG + Intronic
933374922 2:81467241-81467263 TGGGTGGCGGCAGGTGTGTCGGG - Intergenic
933639349 2:84742463-84742485 GGGGTGGTGCTACTGGCGTCTGG + Intronic
933640154 2:84750320-84750342 GGCGTGGTGGTACATGTCTGTGG - Intronic
934916285 2:98303265-98303287 GGGGTGGAGGTGGGTGTGGCAGG + Intronic
935728880 2:106048333-106048355 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
936053157 2:109240834-109240856 GGGGTGGGGGTGGGGGTGTCAGG - Intronic
936941906 2:117892100-117892122 GGGGAGGTTGTATGTGTGTGGGG - Intergenic
939135151 2:138284894-138284916 GGCGTGGTGGTACGTGCCTGTGG + Intergenic
940198118 2:151118921-151118943 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
942432275 2:175925145-175925167 GGTGTGGATGTGCGTGTGTCAGG - Exonic
942455427 2:176135306-176135328 GGGGTGGTGTTACCTCTTTCAGG + Intergenic
942714070 2:178870968-178870990 GGGGTGATGGTACGTGCCTGGGG + Intronic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946377803 2:219324211-219324233 GGGGTGATGTTACGAGGGTCAGG + Intergenic
946853865 2:223933822-223933844 GGAGTGGTGGTACATGTCTGTGG + Intronic
946928288 2:224647472-224647494 GGGGTGGTGGCATGTGTCTGTGG - Intergenic
947495289 2:230631674-230631696 GGGGAGGTTGTACATGTGTGAGG + Intergenic
947743617 2:232496605-232496627 GGGGTGGTCGTGCGTGTCTGTGG + Intergenic
949077786 2:242072165-242072187 GGGGAGGTGGTACGGGAGTCGGG - Intergenic
1169109386 20:3022231-3022253 GGGGTGGGGGTACAAGGGTCAGG - Intronic
1171255345 20:23685857-23685879 TGGGTGGTGGTCGGTGTGACTGG + Exonic
1172082550 20:32353717-32353739 GGGGTGGTGGGATGTGTCTGTGG + Intergenic
1172453483 20:35046809-35046831 GGGGTGGTGGGACCTGTTTTGGG - Intronic
1173255032 20:41388136-41388158 GGGGTGGTGGCATGTGTCTGTGG + Intergenic
1174009862 20:47440955-47440977 GGTGTGGTGGCACGTGTCTCTGG - Intergenic
1174440059 20:50544288-50544310 GGTGTGGTGGTACATGTCTGTGG - Intronic
1174837278 20:53869417-53869439 GGGGTGGTGGTATGTGCCTGTGG + Intergenic
1175063658 20:56266854-56266876 GGTGTGGTGGTACGTGCCTGCGG - Intergenic
1175702075 20:61146905-61146927 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
1176275062 20:64260831-64260853 GGGGTGGTGGTGCGTGCCTGTGG - Intronic
1178469245 21:32876932-32876954 GGGGTGGGGGTAGTGGTGTCGGG + Intergenic
1179285344 21:39973157-39973179 GGAGAGGTGATACATGTGTCTGG - Intergenic
1181794050 22:25291016-25291038 GGCATGGTGGTACGTGTCTGTGG - Intergenic
1181813750 22:25421322-25421344 GGGCAGGTGGTACGTGGGTTCGG - Intergenic
1181834049 22:25587566-25587588 GGCATGGTGGTACGTGTCTGTGG - Intronic
1182096846 22:27631168-27631190 GGGGTGGTGGGAGGTGGGTGGGG - Intergenic
1182624954 22:31638759-31638781 GGGGTGGTGGTGTGTGCCTCTGG - Intronic
1183554064 22:38511437-38511459 GGTGTGGTGGTGTGTGTGTGTGG + Intergenic
1184956121 22:47887483-47887505 GGGGAGGTGGACCGTGTGACAGG + Intergenic
1185080674 22:48707878-48707900 GGGGAGGGGGTATGTGTGTGCGG + Intronic
1185146489 22:49139851-49139873 AGGGTGGAGGTCCCTGTGTCAGG - Intergenic
949193399 3:1276962-1276984 GGTGTGGTGGTAGGTGGATCAGG + Intronic
950777895 3:15366016-15366038 GGTGTGGTGGCACGTGTCTGTGG + Intergenic
952793878 3:37222044-37222066 GGTGTGGTGGTACGTGTCTGTGG - Intergenic
954186413 3:48920117-48920139 GGTGTGGTGGTACGTGCCTGTGG - Intronic
954336435 3:49921014-49921036 GGCGTGGTGGCACGTGTCTGTGG + Intronic
956108227 3:65844083-65844105 GTGGAGTTGGTAGGTGTGTCTGG + Intronic
956851768 3:73234723-73234745 GGGGTGGTGATCAGTGTTTCAGG - Intergenic
957883554 3:86254012-86254034 GGCGTGGTGGTGCATGTCTCAGG - Intergenic
960077640 3:113505764-113505786 GGGGTGGTGGTGCATGCCTCTGG + Intronic
960108479 3:113822521-113822543 GGTGTGGTGGTACGTGCCTGTGG - Intergenic
962510758 3:136098174-136098196 GGTGTGGTGGTACATGCCTCTGG + Intronic
964346261 3:155757471-155757493 GGTGTGGTGGTACGTGCCTGAGG + Intergenic
965890772 3:173511313-173511335 GGGGAGGTGGTGAGTGTGTGGGG - Intronic
965899844 3:173625346-173625368 GTAGTGGTGGTACGTGTGCTGGG - Intronic
966914204 3:184575889-184575911 GGGGAGGTGGTACGGCTGTTGGG - Exonic
967713520 3:192737069-192737091 GTGGTGGTGGTGGGTGTTTCAGG - Intronic
968319952 3:197757633-197757655 GGCGTGGTGGTACCTCTTTCTGG + Intronic
968579465 4:1383288-1383310 GGTGGGGAGGTACGTGTGGCAGG - Intronic
970461093 4:16275672-16275694 GGGATGGATGTTCGTGTGTCGGG + Intergenic
970811405 4:20098812-20098834 GGGGTTTTGGTACGTTTGCCAGG - Intergenic
973530869 4:51835759-51835781 TGGGTGGGGGTACCTGTGTCTGG + Intergenic
977662561 4:99607869-99607891 GGGGTGATTGTGCGTGTGTAGGG + Intronic
980047354 4:128003803-128003825 GGTGTGGTGGTACGTGCCTGTGG + Intronic
983819168 4:172171696-172171718 CGGGTGGTGGCACGTGTCTGTGG + Intronic
983989810 4:174104402-174104424 GGTGTGCTGGTGCGTGTGCCAGG + Intergenic
984790925 4:183614035-183614057 GGGGTGGTGGTACAGATTTCTGG + Intergenic
988950927 5:36259441-36259463 GGTGTGGTGGTACGTGCCTGTGG + Intronic
991390522 5:66138592-66138614 GGGGTGGTGGCATGTGTCTGTGG + Intergenic
991392802 5:66166607-66166629 GGCGTGGTGGTGCGTGTCTGTGG - Intronic
992559251 5:77933978-77934000 GTGGTGGTGGTGTGTGTGTGTGG - Intergenic
992890633 5:81200954-81200976 GGGGGCGTGGTACGTGTTGCAGG + Intronic
995052978 5:107727381-107727403 GGGGAGGTTGTGCGTGTGTAGGG + Intergenic
996371948 5:122762872-122762894 TGGGTGGGGGTATGTGTGTCTGG + Intergenic
998150508 5:139754555-139754577 GGCGTGGTGGTGCGTGTCTGTGG + Intergenic
998435841 5:142108458-142108480 GGGGTTGTGGTCCCTGCGTCAGG + Intergenic
998902478 5:146870769-146870791 GGGGTGGGGGTCTGTGTGTAAGG - Intronic
999624631 5:153507287-153507309 GGGGTGGTGGAATGTTTGTGGGG - Intronic
1001091628 5:168746281-168746303 GGTGTGGTGGTATGTGGGTGTGG + Intronic
1001992800 5:176132493-176132515 GGGGTGGGGGTAGGTGTGGGGGG + Intergenic
1002028490 5:176411773-176411795 GGGCTGGTGGGAAGTGAGTCAGG - Intronic
1002361960 5:178679314-178679336 GGCGTGGTGGTACATGGCTCTGG - Intergenic
1002656306 5:180750958-180750980 GGGGTGGTGGCACATGCCTCTGG + Intergenic
1003019453 6:2497075-2497097 GGGGTGGTGGAAGCTGTGGCTGG + Intergenic
1003882455 6:10490966-10490988 GGTGTGGTGGCACGTGCCTCTGG - Intergenic
1005269533 6:24148410-24148432 GGGGTGGGGAAACGTGTGCCTGG - Intronic
1006735286 6:36268905-36268927 GGGGTGGGGGCGGGTGTGTCAGG - Intronic
1008888601 6:56459103-56459125 GGGGTGTAGGTCTGTGTGTCTGG + Exonic
1008944958 6:57087655-57087677 GGTGTGGTGGTACATGTGTGTGG - Intronic
1010196576 6:73245752-73245774 TGGGTGGTGGGGGGTGTGTCTGG - Intronic
1014487747 6:122021262-122021284 GGGGTAGTGGTATGTGGGTCAGG - Intergenic
1015545670 6:134358652-134358674 GGGGTGGTGGTTTGTGGGTAGGG + Intergenic
1016458979 6:144262228-144262250 GGGGTGGAGGTAGGTGGGACTGG + Intergenic
1018053536 6:160032059-160032081 GGGGTTGTGGACCGTGTCTCTGG + Intronic
1018469908 6:164085965-164085987 GGGGTGAGGGTGCCTGTGTCGGG + Intergenic
1019772758 7:2894019-2894041 GGTGTGGTGGTGCGTGTGTGTGG + Intergenic
1020163380 7:5789462-5789484 GGTGTGGTGGTGCGTGCCTCTGG - Intergenic
1022479787 7:30735210-30735232 GGTGTGGTGGTGCGTGTCTGTGG + Intronic
1026826716 7:73587080-73587102 CGGGTGGTGGTGCCTGTGCCAGG + Intergenic
1026870248 7:73846630-73846652 GGTGTGGTGGTACGTGCCTGTGG + Intergenic
1027160446 7:75798576-75798598 GGCGTGGTGGCACGTGTCTGTGG + Intergenic
1028759576 7:94480499-94480521 GGCGTGGTGGTGCGTGTCTGTGG - Intergenic
1028759822 7:94483486-94483508 GGCGTGGTGGTGCGTGTCTGTGG - Intergenic
1029106875 7:98184439-98184461 GGGTTGGGGGTATGTGTGTGGGG + Intronic
1029138961 7:98396207-98396229 GGTGTGGTGGTACGTGCCTGGGG - Intronic
1032222384 7:130004325-130004347 GGCGTGGTGGTACGTGCTTGTGG + Intergenic
1033065736 7:138152240-138152262 GGTGTGGTGGAACGTGCCTCAGG - Intergenic
1034132297 7:148730949-148730971 GGTGTGGTGGCACGTGTCTGTGG - Intronic
1034340986 7:150354898-150354920 GGTGTGGTGGCACGTGCCTCAGG + Intergenic
1034830540 7:154304405-154304427 GGGGCAGTGGTACCTGGGTCAGG + Intronic
1035397250 7:158543246-158543268 GGGTTGGAGGCAGGTGTGTCTGG - Intronic
1037775862 8:21835225-21835247 GGCGTGGTGGCACGTGTCTGTGG - Intergenic
1038044469 8:23754439-23754461 GGGGAGGCTGTACATGTGTCAGG - Intergenic
1046123499 8:109875010-109875032 TTGGTTGTGGTATGTGTGTCAGG + Intergenic
1046808528 8:118506809-118506831 GGTGTGGTGGAAAGTGTGACTGG + Intronic
1053496328 9:38550686-38550708 GGGTTGGAGGTACGGGTGTGGGG - Intronic
1056592830 9:87977571-87977593 GGCGTGGTGGTACGTGCCTGTGG - Intergenic
1060219520 9:121756988-121757010 GGGGTGGCAGTAGGTGTGTCAGG - Intronic
1060222851 9:121773625-121773647 GGGGTGGTGGCGCATGTGGCAGG - Intronic
1060786184 9:126453222-126453244 GGGGAGGTGGCACGTCTGTGGGG - Intronic
1061198512 9:129122240-129122262 GGTGTGGTGGTACGTGCCTGTGG - Intronic
1061726034 9:132582538-132582560 GGGGGGGTGGTGGGAGTGTCAGG - Exonic
1062369560 9:136230853-136230875 GGGGTGGTGGGACGGAGGTCAGG - Intronic
1062715195 9:138006697-138006719 TGGGTGGGGGTGCGTGTGTGTGG + Intronic
1190296420 X:49030273-49030295 GGGGTGGTGGGAGGACTGTCGGG - Exonic
1190679539 X:52813103-52813125 GGGGTGGTGGTGTGTGTGTGTGG - Intronic
1192503422 X:71667383-71667405 TGGGTGGTTGTACTTGGGTCAGG - Intergenic
1193826300 X:86231397-86231419 GGGGCGGGGCTAGGTGTGTCTGG + Intronic
1194973089 X:100365762-100365784 GGGGTGGTTGTAAGTTTCTCTGG - Intronic
1195100853 X:101552587-101552609 GGGGTGGTGGAACGTGAGGTTGG + Intronic
1196940808 X:120773887-120773909 GGAGTGGTGGTACGTGATACTGG - Intergenic
1197326197 X:125097091-125097113 GTGGTGGTGGTTGGTGAGTCTGG - Intergenic
1199612573 X:149631133-149631155 GGGGTGGGGGTAGGGGTGTTGGG + Intronic