ID: 1142481162

View in Genome Browser
Species Human (GRCh38)
Location 17:219033-219055
Sequence CACAGCAGGGTGAGGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 778}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142481162_1142481170 19 Left 1142481162 17:219033-219055 CCTGCCCTCCTCACCCTGCTGTG 0: 1
1: 0
2: 7
3: 87
4: 778
Right 1142481170 17:219075-219097 GAGCCTGTTGTCCCATCCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 265
1142481162_1142481168 -3 Left 1142481162 17:219033-219055 CCTGCCCTCCTCACCCTGCTGTG 0: 1
1: 0
2: 7
3: 87
4: 778
Right 1142481168 17:219053-219075 GTGTGTACAGAAGAGCCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142481162 Original CRISPR CACAGCAGGGTGAGGAGGGC AGG (reversed) Intronic
900118420 1:1038444-1038466 CTCACCAGGGTGAGCGGGGCTGG - Intronic
900206086 1:1432456-1432478 GAGAGCAGGGTGGGGTGGGCAGG - Intergenic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900726836 1:4222142-4222164 CACAGTGGGGAAAGGAGGGCGGG - Intergenic
901223027 1:7594645-7594667 CAGAGCAGGGTGGGGAGAGGAGG + Intronic
901228637 1:7629782-7629804 CCCAGCCTGGAGAGGAGGGCAGG - Intronic
901462171 1:9398334-9398356 CAGAGCTGGGCGAGGAGAGCTGG + Intergenic
901559227 1:10056919-10056941 CTCAGGAGGCTGAGGTGGGCTGG - Intronic
902290510 1:15431840-15431862 GAAAGCAGGTTGAGGAGGGAAGG + Intergenic
902410890 1:16210964-16210986 GACAGCAGGGTGAAGGGAGCAGG - Intronic
902664161 1:17925865-17925887 CACAGAGGGGGGAGGGGGGCAGG + Intergenic
902682893 1:18056204-18056226 CAAAGCTGGGTGAGAGGGGCTGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903010248 1:20324707-20324729 CTCAGCAAGGAGAGGAGGGTTGG + Intronic
903044542 1:20554871-20554893 CCCAGCAGGATGAGGAAGGAGGG + Exonic
903708014 1:25301275-25301297 CAGAGCAGGTTCAGGAGGCCTGG + Intronic
903719097 1:25391138-25391160 CAGAGCAGGTTCAGGAGGCCTGG - Intronic
903941949 1:26938092-26938114 CCAACCAGGGTGGGGAGGGCTGG - Intronic
904131769 1:28280888-28280910 CACTGCAGCGTGGGGAGGGTGGG - Exonic
904296619 1:29523520-29523542 CACAGCAGGAAGAGGTGGGCTGG - Intergenic
904300256 1:29549522-29549544 GACAGCAGGGAGGGGAGGGAGGG - Intergenic
904364481 1:30001743-30001765 CACAGGAGGGAGAGAGGGGCAGG - Intergenic
904376546 1:30085649-30085671 CAGGGCAGGGTGGGGAGGGTGGG + Intergenic
904409714 1:30318185-30318207 CACAGCAGGAAGGGGCGGGCTGG + Intergenic
904457979 1:30658593-30658615 GACAGCAGGGAGGGGAGGGAGGG + Intergenic
904463515 1:30694290-30694312 CACAGCAGGAAGGGGTGGGCTGG + Intergenic
904500837 1:30911936-30911958 GAAAGCAGGGTGGGGAGTGCAGG - Intergenic
904696446 1:32334437-32334459 CACAGGAGGGAGAGGAGGAAAGG + Exonic
904867857 1:33596178-33596200 CCAAGTAGGGTGAGGAGGGAGGG - Intronic
904928856 1:34070379-34070401 CACAGGAGCCTGTGGAGGGCGGG - Intronic
905136518 1:35804684-35804706 CACAGCAGGAAGTGGAGGGAGGG + Intergenic
905395766 1:37665468-37665490 CACGGCAGGGTGAGGAGGATGGG - Intergenic
905474009 1:38213247-38213269 CAGAGCAGGGTGAGGATGTTGGG - Intergenic
905665658 1:39761580-39761602 GACACCAGGGTGGGCAGGGCCGG - Intronic
905861228 1:41353337-41353359 CTCAGAAGGCTGAGGTGGGCCGG - Intergenic
906560014 1:46749431-46749453 TATGGCAGGGTGAGGAGGGTGGG - Intergenic
906668908 1:47640809-47640831 CACATCAGGGTGGGGCGGGGTGG + Intergenic
906727582 1:48055188-48055210 CTGAGCAGGGTGAGTAGGCCTGG + Intergenic
907165128 1:52403960-52403982 AGCATCAGGGTGCGGAGGGCAGG + Intronic
907305234 1:53509470-53509492 CCCTGCAGGGAGGGGAGGGCAGG + Intronic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
907668071 1:56450545-56450567 CACAGCAGGGTGGGGAAGGGAGG + Intergenic
907920869 1:58910600-58910622 CAGAGCAGGGTGTGGGGGGATGG - Intergenic
908540120 1:65114205-65114227 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
908797015 1:67840276-67840298 TACAGCATGATGAGGGGGGCAGG - Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
909499522 1:76318562-76318584 CACAGCAGGGAGGCGAGGGCAGG - Intronic
911603592 1:99874526-99874548 CACAGCAGGATGAGAAGGGGAGG + Intronic
912941514 1:114049286-114049308 CTGAGCAGGGTGAGGAGAGATGG - Intergenic
913353733 1:117894233-117894255 CACAGGAGGCTGAGGAGCCCAGG - Intronic
914719978 1:150281880-150281902 CCCTGCTGGGTGAGGAGGGTGGG - Intergenic
915323479 1:155068896-155068918 CACATCAGGGTGGCGAGGGGGGG + Intronic
915462247 1:156077054-156077076 CACGCCTGGGTGAGCAGGGCGGG - Exonic
915797849 1:158755615-158755637 CACAGCAAGGTGAGCAGCACAGG - Exonic
916689325 1:167175513-167175535 CACAGTAGGGTGAGCAAGCCTGG + Intergenic
917730105 1:177866645-177866667 CACAGCAGGGTGAGTAGAACTGG + Intergenic
919570513 1:199242788-199242810 CACAGCTAGGTGGGCAGGGCAGG - Intergenic
919767734 1:201138171-201138193 CAGAGCAGTGGAAGGAGGGCAGG - Intronic
919981199 1:202643760-202643782 TACAGAAGTTTGAGGAGGGCGGG + Intronic
920032663 1:203046559-203046581 CCCTGCAGGGTGATGAGGACAGG - Intronic
920054908 1:203184641-203184663 CACAGGGAGGTGGGGAGGGCAGG + Intronic
920293557 1:204941553-204941575 CACAGCAGGGGCAGCAGGGATGG - Intronic
920300193 1:204983721-204983743 CGGAGCAGGGTGAGGAAGGGTGG + Intronic
920419333 1:205820470-205820492 CTAAGCAGGGAGAGGAGGGGAGG - Intergenic
920442335 1:205989411-205989433 CCTGGCAAGGTGAGGAGGGCGGG - Intronic
920624479 1:207583181-207583203 CACAGGAGGGTGAGGTGCCCTGG + Intronic
920668380 1:207983406-207983428 CAGAGCAGGGTGGGGAAGGGAGG + Intergenic
921049868 1:211503643-211503665 CAGAGCCCAGTGAGGAGGGCAGG + Intergenic
921221481 1:212977014-212977036 CGCAACAAGGTGAGGAGGGGTGG + Intronic
922741261 1:228015582-228015604 AACAGCAGGGGCAGGAAGGCTGG - Intronic
922750299 1:228067104-228067126 CCCAGCTGGGTCTGGAGGGCAGG - Intergenic
922894670 1:229090738-229090760 AACAGCAGGATAAGGAGTGCAGG - Intergenic
923019232 1:230150054-230150076 GACCCCAGGGTGAGGATGGCTGG + Intronic
923097722 1:230788732-230788754 CAGAGCATGGTGAGGGGGGAAGG + Intronic
923097909 1:230790005-230790027 CACAGCAGGGTCCTGAAGGCTGG + Intronic
923630599 1:235647595-235647617 CACAGCTGTCTCAGGAGGGCAGG - Intronic
924021295 1:239786682-239786704 CACCGCAGGGTGCCGAGGGCAGG + Intronic
924159216 1:241212851-241212873 CACAGCAGTGGGAGGAGGTGTGG - Intronic
1062780129 10:195950-195972 CACAGAAGGGTAAGGACAGCGGG + Intronic
1062849095 10:729214-729236 CACGGCAGCATGGGGAGGGCTGG - Intergenic
1062856040 10:779918-779940 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856067 10:780056-780078 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856140 10:780370-780392 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856165 10:780508-780530 CACTGCAGGGTAATGAGGACAGG + Intergenic
1063281379 10:4633044-4633066 CTCTGAAGGGTGAGAAGGGCAGG - Intergenic
1064117112 10:12587625-12587647 CACAGCTGGAAGAAGAGGGCAGG + Intronic
1064520838 10:16199004-16199026 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1064563017 10:16611189-16611211 CACAGCTGAGTGAGGAAGTCTGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065145384 10:22763035-22763057 CTCAGGAGGCTGAGGAGGGGAGG + Intergenic
1065978098 10:30861408-30861430 CAGAACAGGATGTGGAGGGCTGG + Intronic
1067338938 10:45385417-45385439 CACAGCAGGATGAGAAAGCCTGG - Intronic
1067343237 10:45420719-45420741 CAAAGCCTGCTGAGGAGGGCTGG - Intronic
1067526571 10:47042934-47042956 CAGAGCAGGGAGAGAAGGGAAGG + Intergenic
1068474496 10:57507657-57507679 CACAACATGGTGAGCAGGGGTGG - Intergenic
1068956010 10:62818924-62818946 GCCAGCAGGGCGCGGAGGGCAGG + Intronic
1069246912 10:66218135-66218157 CATTGCAGGGTGAGTAGGACAGG - Intronic
1069910737 10:71757667-71757689 CACAGCAGGGTGGGATGGGAGGG + Intronic
1070570794 10:77638200-77638222 CGCAGCCGGGGGAGGAGGGCTGG - Intronic
1070577519 10:77690527-77690549 GGCAGCAGGCTGGGGAGGGCAGG + Intergenic
1070604890 10:77891769-77891791 CACAGCAGGTGGCTGAGGGCTGG + Intronic
1070659203 10:78292905-78292927 GACAAGAGGGTGAGGAGGGCAGG - Intergenic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1073050652 10:100664954-100664976 CAGAGCAGGGTAAGGAGGACAGG - Intergenic
1073054133 10:100688343-100688365 CAAAGCCAGGCGAGGAGGGCAGG + Intergenic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073322892 10:102626293-102626315 CCCAGCAGATTGAGGAAGGCCGG + Intronic
1073324335 10:102633825-102633847 CCCAGACAGGTGAGGAGGGCAGG + Intergenic
1073457682 10:103647412-103647434 GAGACCAGGGTGTGGAGGGCAGG + Intronic
1073594796 10:104789036-104789058 TTCAGCAGGGTGAGGGGGGCAGG + Intronic
1074051295 10:109883308-109883330 AATGGCAGGGTGAGGAGGGGCGG - Intronic
1074206118 10:111284363-111284385 CTGAGCAGGCTGAGGAAGGCTGG - Intergenic
1074686428 10:115966259-115966281 CAGAGGAGGGTGGGGATGGCTGG + Intergenic
1074820625 10:117175531-117175553 CACAGCACGGGCAGGCGGGCAGG - Intergenic
1075263512 10:120981979-120982001 CTCAGCAGGGAAAGGAGAGCAGG - Intergenic
1075344000 10:121668933-121668955 CACAGGAGGCTGAGCAGGGGAGG + Intergenic
1075454135 10:122574041-122574063 CACAGCTGGGTGAGGAACACAGG - Intronic
1075726013 10:124611298-124611320 CACAGCAGGGAGAGCAGAGCTGG - Intronic
1075821501 10:125316780-125316802 CACAGCAGCGTGAGCAGGAGAGG + Intergenic
1075874875 10:125797953-125797975 CACACAAGGGAGAGCAGGGCTGG - Intronic
1075944941 10:126424633-126424655 TACAGCAGCGGGAGGAGGGAAGG + Intergenic
1076271150 10:129153192-129153214 ACCAGCAAGGAGAGGAGGGCTGG + Intergenic
1076329887 10:129656385-129656407 TCCTGCAGGGTGAGGAGGGGTGG + Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076644659 10:131944662-131944684 GACAGCAGAGGGAGGACGGCAGG - Intronic
1076659116 10:132043699-132043721 CACAGCATGACGAGGAGGGCTGG + Intergenic
1076732773 10:132446711-132446733 GACAGGAGGGTGGGGTGGGCAGG + Intronic
1076744206 10:132504679-132504701 AACAGCAGGGTGTGTAGGGCAGG - Intergenic
1076755860 10:132571311-132571333 CCCAGCAGTGTGATGAGGGATGG - Intronic
1076841632 10:133048819-133048841 AACAGCAGGCAGAGGAGGGGAGG + Intergenic
1076843314 10:133057121-133057143 CAGAGGCAGGTGAGGAGGGCGGG + Intergenic
1077311776 11:1891980-1892002 CGGAGCTGGGTGGGGAGGGCGGG - Exonic
1077333328 11:1992924-1992946 AACCTCAGGGTGAGGCGGGCAGG - Intergenic
1077341181 11:2027099-2027121 CACAGCTGGGTGGGCTGGGCAGG - Intergenic
1077396816 11:2328209-2328231 CAGTGCAGGCCGAGGAGGGCAGG - Intergenic
1077419606 11:2444375-2444397 CACAGCGGGGGCAGGAGGGGCGG - Intergenic
1077606962 11:3618707-3618729 GACAGGAGGATGAGGAGGCCAGG + Intergenic
1077869485 11:6250097-6250119 TACAGCTGTGAGAGGAGGGCAGG + Intergenic
1078163403 11:8862022-8862044 CACAGAAGGGGGAGGAAGGGAGG + Intronic
1078456838 11:11482245-11482267 CACAGCTGGGGGAGGATGGCAGG - Intronic
1078508624 11:11969295-11969317 TACAGCAGGGGAAGGAGGGCAGG + Intronic
1079336322 11:19573817-19573839 CACAGGCAGGTGAGGAGGGATGG - Intronic
1079884079 11:25964206-25964228 ATCTGAAGGGTGAGGAGGGCAGG - Intergenic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG + Intergenic
1080886964 11:36376499-36376521 CAGAGCTGGGGGAGGAGGGAGGG + Intronic
1081922368 11:46790752-46790774 CACAGTAGGCTGAGGTGGGAAGG - Intronic
1082938069 11:58675003-58675025 CTCTGCAGGGTGAGAAGGACAGG - Intronic
1082987428 11:59180628-59180650 CAGGGCAGGGTGGGGAGGTCGGG - Intronic
1083321704 11:61851639-61851661 CACAGCAGGGCCAGGTGGGGCGG + Intronic
1083877332 11:65531202-65531224 CTCCCCAAGGTGAGGAGGGCAGG - Intronic
1084287677 11:68142486-68142508 CATGGCAGGGTGAGGGGAGCAGG + Intergenic
1084302618 11:68261395-68261417 CACCTCAGGGTGGGGCGGGCAGG - Exonic
1084884266 11:72193227-72193249 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1085283085 11:75343435-75343457 CACAGCTGGGTTAGGGAGGCAGG + Intronic
1085319164 11:75563695-75563717 AACAGAAGAGTGAAGAGGGCGGG - Exonic
1085351861 11:75802811-75802833 CAGAGCAGTGGGAGGAGTGCTGG + Intergenic
1085444049 11:76589087-76589109 CACAGCAGCGTGGAGAGGGCTGG + Intergenic
1085461387 11:76695982-76696004 CACAGCAGAGTGTGGATGGAGGG + Intergenic
1086362526 11:86073694-86073716 CACAGAAAGGTGAGGGGGGAAGG - Intergenic
1088706351 11:112467764-112467786 CACAGCAGGGAAGGCAGGGCAGG + Intergenic
1088804846 11:113342869-113342891 TACAGGAGGGCGAGGAAGGCAGG + Intronic
1088810534 11:113388572-113388594 CAGTGCAGGCTGAGGAGGTCAGG + Intronic
1089618958 11:119711600-119711622 CACAGAAGGGGAAGGGGGGCTGG + Intronic
1089632775 11:119793940-119793962 CTCAGCTGGGGGAAGAGGGCTGG + Intergenic
1089752575 11:120661802-120661824 CAGAGCAGTGTGTCGAGGGCAGG - Intronic
1090481736 11:127074949-127074971 CACAACAAGCTGAAGAGGGCAGG - Intergenic
1091216052 11:133902897-133902919 ACCACCAGCGTGAGGAGGGCTGG + Intergenic
1091218246 11:133916633-133916655 CACAGCAGTGAAAGGAGAGCGGG + Intronic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1202816308 11_KI270721v1_random:48105-48127 AACCTCAGGGTGAGGCGGGCAGG - Intergenic
1202824166 11_KI270721v1_random:82288-82310 CACAGCTGGGTGGGCTGGGCAGG - Intergenic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091559914 12:1604194-1604216 TGCAGCAGGGAGGGGAGGGCAGG + Intronic
1091588966 12:1831750-1831772 CAGAGCAGGGAGGGGAGGGTGGG - Intronic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1091798179 12:3309064-3309086 CCCAGCAGGGAAAGGAGGGTGGG + Intergenic
1092061907 12:5557939-5557961 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1092071051 12:5631721-5631743 CACAGCAGCATGAGCAAGGCCGG + Intronic
1092166973 12:6348320-6348342 GACAGCTTGGTGAGGAGGGAAGG - Intronic
1092734485 12:11567407-11567429 CTCAGAAGGGTGAGGAGGAAGGG - Intergenic
1093529769 12:20147083-20147105 CAGATGAGAGTGAGGAGGGCAGG + Intergenic
1094098062 12:26730324-26730346 AGAAGCAGGATGAGGAGGGCAGG - Intronic
1094172633 12:27509736-27509758 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1094492496 12:30969796-30969818 CAAGGCAGGGTGAGAAGGGGAGG + Intronic
1094679773 12:32657925-32657947 CAGAGCAGGATAAGGGGGGCTGG - Intergenic
1095411869 12:41933395-41933417 GGCAGCAGGGTGAGGAGGCCAGG - Intergenic
1095415137 12:41968331-41968353 CACAGCGGGGTGGGGTGGGAGGG - Intergenic
1095943514 12:47740882-47740904 CAGAGCTGGGGGAGGAGAGCAGG - Intronic
1096235468 12:49923305-49923327 CTCAGCAGGATGGGCAGGGCTGG + Intergenic
1097142751 12:56916495-56916517 CTCAGGAGGCTGAGGTGGGCGGG - Intergenic
1098488406 12:71047657-71047679 CACAGGAGGGAGGGCAGGGCAGG + Exonic
1099760515 12:86914299-86914321 CAGAGCAAGGTGAGAATGGCTGG + Intergenic
1100101173 12:91107554-91107576 CACAGCAGGATGAGTTGGCCCGG + Intronic
1100613197 12:96209070-96209092 CACGGCAGGGTCAGGAAGGATGG - Intronic
1101438065 12:104680823-104680845 CACAGCAGGAACAGGGGGGCGGG - Intronic
1101592341 12:106136021-106136043 CTCAGCAGGGGGAGGACGGGGGG + Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102505956 12:113384780-113384802 CACTGCAGGGTGGGGAAAGCTGG + Intronic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103522965 12:121548704-121548726 CACAGCTGGGACAGGAGGGACGG - Intronic
1105409589 13:20160876-20160898 CAGAGCGGGGTAAGGCGGGCCGG - Exonic
1106209742 13:27630867-27630889 GACAGCAGGGTGGGGGAGGCGGG - Intronic
1106230467 13:27817318-27817340 GACAGCTGGGTGGAGAGGGCCGG + Intergenic
1106388597 13:29313138-29313160 AACAGCAGGCTGAGGAGTGAAGG + Intronic
1106431542 13:29685355-29685377 CACAGCAGGGTAGGGGGTGCTGG - Intergenic
1106486833 13:30179754-30179776 CACAGCAGTGTTAGGAAGGTGGG + Intergenic
1106844965 13:33728609-33728631 CACAGCAGGGGCAGGAAGGAAGG - Intergenic
1107224186 13:38027191-38027213 CTCAGAAGGCTGAGGAGGGAGGG - Intergenic
1107661377 13:42643078-42643100 CCCTGCCTGGTGAGGAGGGCTGG + Intergenic
1108322674 13:49303179-49303201 CACAGGAGGGTGAGGTTGCCTGG + Intergenic
1112030790 13:95454532-95454554 CACAGCAGGGTGGGGAGAGAGGG - Intronic
1113604881 13:111598016-111598038 AACAGAAGGGAGAGGAGGGCGGG - Intronic
1113655109 13:112063088-112063110 CACCGCAGCGAGAGGAGGGCGGG - Intergenic
1113885929 13:113658369-113658391 AGCAGCAGGGTGAGGAAAGCGGG - Intergenic
1114390091 14:22298314-22298336 CAAAGCAGGGTGTGGAAGGATGG - Intergenic
1114485342 14:23058305-23058327 CCCAGCAGGGCTAGGAGGGTGGG - Intergenic
1114616465 14:24071399-24071421 CAGAACCGGGGGAGGAGGGCAGG - Intronic
1114635129 14:24182962-24182984 CAGAGGAAGGTGAGCAGGGCAGG - Exonic
1114635221 14:24183354-24183376 CACTGCAGGATGAGGAGGGGCGG + Exonic
1114896428 14:26996195-26996217 CACAGCATGGTGAGGGGGAAGGG + Intergenic
1115571424 14:34670418-34670440 CAGAGCAAGGTGAGGAAGGGTGG - Intergenic
1115651054 14:35403461-35403483 GACAGGGGGGTGGGGAGGGCTGG + Intronic
1116169571 14:41382642-41382664 CTCAGGAGGCTGAGGAGTGCAGG + Intergenic
1117430804 14:55658136-55658158 CACAGCTGGGGCAGGCGGGCTGG + Intronic
1117542241 14:56759498-56759520 CACAGCTTGGAGATGAGGGCTGG + Intergenic
1118549926 14:66939425-66939447 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1118578137 14:67265446-67265468 CACAGGAGGCTGAGGTGGGAGGG + Intronic
1119049245 14:71350001-71350023 TAGAGTAGGGTGGGGAGGGCAGG + Intronic
1119275397 14:73350637-73350659 CACAGGAGGCTGAGGTGGGAAGG - Intronic
1119320357 14:73726715-73726737 CACAGGAGCATGAGGAGGGAGGG + Intronic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1119651640 14:76388110-76388132 AACATCGGGGTGAGGAGTGCAGG - Intronic
1120692022 14:87603302-87603324 CACAAAAGGCTGAGGAAGGCAGG + Intergenic
1120811559 14:88808767-88808789 CACTGTAGGGTGAGTAGGGCAGG + Intergenic
1120855682 14:89210293-89210315 CATAGGAGGGTGAGAGGGGCGGG - Intronic
1120886023 14:89452385-89452407 CCCAGCACGCTGGGGAGGGCCGG + Intronic
1120969773 14:90197701-90197723 AACAGCCTGCTGAGGAGGGCTGG + Intergenic
1121051328 14:90820675-90820697 TACAGCAGGGTGAGGGGGTAAGG - Intergenic
1121243012 14:92443315-92443337 CACTGCGGGGGGAGGAGGCCTGG + Intronic
1121890653 14:97587424-97587446 CATTGCAGTGTGAGGAGGGGAGG - Intergenic
1122295469 14:100703356-100703378 CACTCCATGGTGAGGAGTGCTGG - Intergenic
1122339419 14:101018669-101018691 CACAGCATGGTGAGGAAGGAAGG - Intergenic
1122470767 14:101964561-101964583 CACCGCAGACTGAGGAGAGCGGG - Exonic
1122552834 14:102559296-102559318 CACTGCAGGGTCCTGAGGGCTGG + Intergenic
1122661899 14:103301675-103301697 CACAGCCGGGTGCTCAGGGCGGG + Intergenic
1123114755 14:105889679-105889701 CAGATCAGGGTGAGGACTGCAGG + Intergenic
1123539109 15:21269863-21269885 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1124341864 15:28894902-28894924 CACAGGAGGGTGGCGGGGGCAGG + Intronic
1124496892 15:30192490-30192512 TACAGAAGTTTGAGGAGGGCGGG + Intergenic
1124746684 15:32346157-32346179 TACAGAAGTTTGAGGAGGGCGGG - Intergenic
1124809211 15:32917449-32917471 CACCACAGGGTGAGGACAGCAGG + Intronic
1125138750 15:36377498-36377520 CACAGCAGGGTGACTAGAGTCGG - Intergenic
1125686831 15:41568486-41568508 CAGAGGAGGGTGAGGAGGAAAGG - Intronic
1126034871 15:44536892-44536914 CACAGGGGGCTGAGGAGTGCTGG - Intergenic
1127383860 15:58451810-58451832 CACAGCTGTGTGAGCAGGGCAGG - Intronic
1127769732 15:62221549-62221571 CACTTCAGGGAGAGGAGGGGTGG + Intergenic
1127770574 15:62226934-62226956 CACAGCAGGGGAAGGAGGAGAGG - Intergenic
1127861411 15:62997206-62997228 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1128155964 15:65392120-65392142 CCCAGCTAGGTGAGGAGGGCTGG - Exonic
1128186083 15:65644545-65644567 GACAGCAGGGAGAGGGGGGCAGG - Intronic
1128489192 15:68129168-68129190 CTCAGGAGGGTGAGGTGGGAAGG - Intronic
1128678898 15:69632140-69632162 CACAGGAGGCTGAGGAGAGAGGG - Intergenic
1128735889 15:70053694-70053716 CTCAGGAAGGTGAGGAAGGCAGG + Intronic
1129062869 15:72874180-72874202 CCCAGCAGAGTCAGGAGGGCTGG + Intergenic
1129178139 15:73854861-73854883 CTGGGCAGGGTGAGCAGGGCAGG - Intergenic
1129252471 15:74316476-74316498 CACAGCAGGCAGGGGAGGACAGG + Intronic
1129602436 15:77008071-77008093 CAGAGCTGGGGGTGGAGGGCGGG + Intronic
1129674387 15:77624696-77624718 CACAGCAGGGTGGGGTGCACTGG - Intronic
1130851952 15:87803515-87803537 CACTGAAGGGAGATGAGGGCAGG - Intergenic
1130983492 15:88829033-88829055 GGCAGCAGGGTGGGGAGTGCTGG - Intronic
1131141325 15:89978914-89978936 CACAGGAGGGAGGGGAGAGCAGG + Intergenic
1131157810 15:90085540-90085562 CACAGGAGGGTGAAGAGACCTGG - Intronic
1132136356 15:99344008-99344030 CACAGCCTGGTGGGGAGGCCAGG - Intronic
1132235360 15:100216027-100216049 CTGAGCGGGGTGAGAAGGGCAGG + Intronic
1132281343 15:100618594-100618616 CACAGCAGGGTGAGAAGGTGAGG - Intronic
1132551575 16:555915-555937 CAGAGAAGGGAGGGGAGGGCTGG - Intergenic
1132590557 16:724573-724595 CCCAGCAGGCTGAGCAGTGCCGG + Intronic
1132632720 16:927616-927638 TAAAGCAGGGACAGGAGGGCGGG + Intronic
1132802105 16:1759543-1759565 CACGGCAGGGCCAGCAGGGCTGG - Intronic
1133058326 16:3158552-3158574 CCCAGCACCGAGAGGAGGGCCGG - Intergenic
1133061117 16:3175142-3175164 CCCACCAGGGGGAGGTGGGCTGG - Intergenic
1133209959 16:4258024-4258046 CCCAGAAGGGAGAGGAGGGCTGG + Exonic
1133403231 16:5503984-5504006 CTCATCATGGTGAGGAGAGCTGG + Intergenic
1133413109 16:5584668-5584690 CACAGATGGGAGAGGAGGGCTGG + Intergenic
1133521305 16:6560313-6560335 CAGAAAAGGATGAGGAGGGCAGG + Intronic
1133729437 16:8567202-8567224 CAAAACAGGGTGATGAGGCCGGG - Intergenic
1133772391 16:8874792-8874814 GTCAGCAGGGTGAGCAGGGTGGG - Intergenic
1134056520 16:11173711-11173733 CAGGACAGTGTGAGGAGGGCAGG - Intronic
1134273265 16:12753693-12753715 CACATTAGGGGCAGGAGGGCGGG - Intronic
1135107328 16:19661677-19661699 CACTGCACCGTGAGGATGGCGGG - Intronic
1135113831 16:19709876-19709898 CAGAGCGGGGTGAGCATGGCAGG - Intronic
1135149664 16:19994710-19994732 CACAGAACGGTGACCAGGGCAGG - Intergenic
1135297998 16:21300224-21300246 CACAGAAGGGTGAGGTGAGAAGG - Intronic
1135507716 16:23053137-23053159 CACTGCTGGGGGTGGAGGGCGGG - Intergenic
1135588772 16:23690821-23690843 CACAGGGAGGTGAGGTGGGCTGG - Exonic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136228186 16:28872697-28872719 GACAGCAGGGTGAGCAGAGCAGG + Exonic
1137484909 16:48882722-48882744 CACAGCAGGATGGGGAGGGAGGG - Intergenic
1137797417 16:51233751-51233773 GACTGCATTGTGAGGAGGGCTGG + Intergenic
1137876018 16:51997507-51997529 CCCAGCAGGGTGGGGAGAGATGG - Intergenic
1138022492 16:53497259-53497281 CCAAGCAGGGTGCGGAGTGCTGG - Intronic
1138434166 16:56988059-56988081 AACAGCCCTGTGAGGAGGGCAGG - Intergenic
1138549356 16:57739128-57739150 CACGGCAGCCTCAGGAGGGCTGG - Intronic
1138553590 16:57759877-57759899 CACAGCAGGGTGGGGAGCCAGGG - Intronic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139391645 16:66609369-66609391 CACAGCATGGGGAGGAGGCCTGG - Intronic
1139406839 16:66725736-66725758 CACTGCAGGGTCTGCAGGGCAGG + Intronic
1139638679 16:68275182-68275204 CACAGCTGGGGAAGGACGGCTGG - Exonic
1139640321 16:68287083-68287105 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
1139779357 16:69338182-69338204 CACAGGAGGTTGAGGTGGGGGGG - Intronic
1140304775 16:73792859-73792881 CACAGCAGAGAGGGGAGGGGGGG - Intergenic
1140427329 16:74871840-74871862 CTCAGTAGCGTGAGCAGGGCGGG - Exonic
1141149426 16:81553630-81553652 CACAGCCTGGAGAGGAAGGCTGG + Intronic
1141698983 16:85633836-85633858 CAGAGCAGGGTCGGCAGGGCCGG - Intronic
1142044724 16:87918378-87918400 CAAAGCGGGGGGAGGAGGGAAGG - Intronic
1142116406 16:88358294-88358316 CACACCCGGGGGAGGGGGGCTGG + Intergenic
1142214657 16:88824661-88824683 CACAGGAGGGTGAGACAGGCAGG - Intronic
1142247439 16:88976460-88976482 CACAGCTGGGGCAGGTGGGCTGG - Intronic
1142395890 16:89831301-89831323 CCAATCAGGGTGAAGAGGGCAGG - Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142631956 17:1230866-1230888 CTCAGCCAGGTGCGGAGGGCAGG - Intergenic
1142669714 17:1482601-1482623 CAAGGCGGGGTGGGGAGGGCAGG - Intronic
1142744013 17:1946111-1946133 CAGGGCAGGGTGACCAGGGCAGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142774877 17:2129216-2129238 CTCAGGAGGGTGAGGTGGGAGGG + Intronic
1142780914 17:2180510-2180532 CACTGCAGAGTGATGAGGGCAGG - Intronic
1143106779 17:4534161-4534183 CCCAGCGGGGGGAGGAGGGCGGG - Intronic
1143539662 17:7561658-7561680 CACAGGAGAGCCAGGAGGGCGGG - Intergenic
1143681342 17:8478152-8478174 CACAGGAGGGCGGGGAGAGCAGG - Intronic
1143717698 17:8786536-8786558 TTCTGCAGGGTGAGAAGGGCTGG + Intergenic
1143863993 17:9910880-9910902 CATACCGGGGTGAGGAGTGCTGG + Intronic
1144007775 17:11116675-11116697 CCCAGGAGGCTGAGGTGGGCAGG - Intergenic
1144710138 17:17396117-17396139 CACTGCTGGGCCAGGAGGGCTGG - Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1144782900 17:17816790-17816812 CACAGCAGGCTCTGGAGGGGTGG + Intronic
1144816878 17:18040633-18040655 CAGAGCAGGGGCAGGAGGCCTGG - Intronic
1146263646 17:31437417-31437439 CACAGCAGGGCGCAGAGAGCCGG - Intronic
1146298818 17:31672341-31672363 CTGAGCAGGCAGAGGAGGGCTGG - Intergenic
1146479766 17:33195818-33195840 CCCAGGAGGGTGAGGAGGGGAGG - Intronic
1146494940 17:33313216-33313238 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1146942857 17:36855720-36855742 CACACAGGGGTGAGGAAGGCTGG + Intergenic
1147042215 17:37727736-37727758 CACAGCATGGTAAGCATGGCTGG + Intronic
1147164120 17:38584418-38584440 AAGGGCAGGGTGAGGAAGGCGGG + Intronic
1147252442 17:39161131-39161153 ACCAGCAGCATGAGGAGGGCTGG - Intronic
1147329418 17:39688167-39688189 CACAGCAGGGGGACGAGGGGCGG - Intronic
1147393091 17:40122147-40122169 CTCAGGAGGGGGTGGAGGGCTGG - Intergenic
1147538458 17:41335719-41335741 CACAGCAGGGAGGGGTGGGCAGG + Intergenic
1147722256 17:42546609-42546631 CAGAACAGGGTGGGGAGAGCGGG + Intergenic
1147723442 17:42552779-42552801 CAGAACAGGGTGGGGAGAGCGGG + Exonic
1148143089 17:45342150-45342172 CATAGCATGGTGAGCAGAGCAGG - Intergenic
1148186780 17:45650128-45650150 CACTGCATGGTTAGAAGGGCAGG + Intergenic
1148614265 17:48987625-48987647 CTCAGGAGGCTGAGGAGGGAGGG - Intergenic
1148823230 17:50373090-50373112 CAGAGCGGGGTGAGGCGGGGAGG - Intronic
1148847957 17:50540291-50540313 CAGAGCAGTGTGTGGAGGGCGGG - Exonic
1149511075 17:57242330-57242352 CACAGCAGAGTGTGGAAGGAGGG - Intergenic
1149992337 17:61390093-61390115 GACAGCAGGGCCAGGCGGGCGGG - Intronic
1150220481 17:63493293-63493315 CACAGCACTGTGGGGAGGGAGGG - Intronic
1150250553 17:63702059-63702081 TAAAGCAGGGGGAGGAGGGCCGG + Intergenic
1150631590 17:66884243-66884265 CACAGCAGGGTGAGAACCACCGG + Intronic
1150833607 17:68544262-68544284 CACAGCCGGATCATGAGGGCTGG + Intronic
1151122393 17:71807779-71807801 CACAGCAGAGTCAGGAGAACCGG + Intergenic
1151405735 17:73884980-73885002 CAGAGCAGGGTGGGAAGGACAGG + Intergenic
1151450735 17:74196875-74196897 TGCAGGAGGGAGAGGAGGGCGGG - Intergenic
1151715995 17:75831331-75831353 CAGAGCAGGGTCAGGAGGCTGGG + Exonic
1151827046 17:76529440-76529462 TAGGGCAGGGTGGGGAGGGCAGG + Intronic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152260869 17:79266382-79266404 CACAGCTGGATGAGATGGGCGGG - Intronic
1152470060 17:80486128-80486150 CAAAGCTGGGTGGGGAGAGCTGG + Intergenic
1152526420 17:80890527-80890549 CCCAGCAGGGTGGGAGGGGCGGG + Intronic
1152703037 17:81828911-81828933 CACAGCTGAGGGGGGAGGGCAGG + Intronic
1152794774 17:82301567-82301589 CTCATCAGGGTGTTGAGGGCAGG + Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152896511 17:82914391-82914413 CACGGCAGGGTGTGGATTGCTGG + Intronic
1152908076 17:82980926-82980948 TACCGCAGGATGAGGGGGGCTGG - Intronic
1153628265 18:7042497-7042519 GACAGCAGCGCGAGGGGGGCTGG - Intronic
1153797219 18:8634752-8634774 CGCAGCCAGGTGAGGAGTGCCGG - Intronic
1153851030 18:9094541-9094563 TACAGCAGGGTGTGAAAGGCTGG - Intergenic
1154424948 18:14264973-14264995 TACAGGCGGGTGAGGAGGGTTGG + Intergenic
1155268441 18:24116433-24116455 CTCAGCAGGCTGAGGCGGGCGGG + Intronic
1156351012 18:36300846-36300868 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1156360827 18:36383125-36383147 CACAGCAGGGCTGGAAGGGCTGG - Intronic
1156447385 18:37247905-37247927 CACAGAAAGCTGAGGAGGGAGGG - Intronic
1156450363 18:37263147-37263169 CACAGCAAAGTGAGGAGAGTGGG - Intronic
1157096143 18:44687103-44687125 CAGAGAAGGCTGAGGAGGCCGGG + Intronic
1157103749 18:44753772-44753794 GACAGCAGGGTGAGGGAGGAAGG + Intronic
1157664062 18:49470339-49470361 AACAGCAGGGTGAGGCTTGCGGG - Intergenic
1157777814 18:50410016-50410038 CATTGAAGGGTGAGTAGGGCAGG + Intergenic
1157813772 18:50716722-50716744 GACAGCATGGTTAGGAGGACAGG - Intronic
1158619140 18:59015750-59015772 CAGAGCAGGGTGAACAGTGCAGG + Intergenic
1158890379 18:61866655-61866677 CACAGCAGGGAGAGGAGACATGG - Intronic
1158940741 18:62404327-62404349 CACAGGAAGGCGGGGAGGGCGGG + Intergenic
1158965202 18:62616568-62616590 CACAGCAGAGTGACGCAGGCCGG + Intergenic
1159310195 18:66698104-66698126 CACAGGAGGCTGAGGAAGGAGGG + Intergenic
1159587907 18:70299447-70299469 CACACAAGGGTGAGCTGGGCAGG - Intronic
1159646176 18:70921099-70921121 CCCAGCCTGGTGAGGAGGGATGG - Intergenic
1159913893 18:74172056-74172078 GACAGCAGAGAGAGGAGGGAGGG - Intergenic
1159923559 18:74247275-74247297 CACATCAGGGTGGGGAGCACTGG - Intergenic
1159986005 18:74841457-74841479 CAGAGCAGGGTGAGGAGGTTTGG - Intronic
1160166952 18:76522245-76522267 TGCAGCAGGGCGAGGAGGCCCGG - Intergenic
1160197071 18:76764500-76764522 CACAGCTGAGAGAGGAGGCCGGG - Intergenic
1160318484 18:77869110-77869132 CACAGCAGGGGCAGCAGGGATGG + Intergenic
1160342108 18:78098061-78098083 CTCAGCATGGAGAGCAGGGCAGG + Intergenic
1160503250 18:79412538-79412560 GCCTGCAGGGTGAGGAAGGCAGG + Intronic
1160505819 18:79426444-79426466 CACCGCAGCGTGAGGACAGCAGG + Intronic
1160781670 19:880219-880241 CTCTGCAGGGTGTGGAGAGCCGG + Intronic
1160860935 19:1237022-1237044 CGCAGCCGGGTGGGGAGGCCCGG + Intronic
1161439926 19:4285149-4285171 CACAGCCAGGAGAGGAGAGCAGG - Intronic
1161714467 19:5867484-5867506 CACAGCAGGATCAGTAGGGTGGG + Exonic
1161731690 19:5964704-5964726 GGCAGCAGAGTGAGGAGTGCTGG + Intronic
1161804559 19:6435114-6435136 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1162017606 19:7853820-7853842 GACACCAGGGTGTGTAGGGCAGG + Intronic
1162143074 19:8596270-8596292 CACAAGAGGGGGAGGAGGGGAGG - Intronic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162185149 19:8898881-8898903 CAGGGCAGAGTGAGGAGGGCAGG + Intronic
1162187293 19:8915484-8915506 CAGGGCAGAGTGTGGAGGGCAGG + Intronic
1162413275 19:10518866-10518888 AACAGCGGGGGCAGGAGGGCTGG - Intergenic
1162965125 19:14151879-14151901 CTCAGCAGTGTGAGGAGGCCTGG + Intronic
1163018125 19:14469327-14469349 CACATCAGGCTGGGGAGGGGTGG - Exonic
1163091985 19:15026637-15026659 GACAGCAAGGTGAGGGTGGCAGG - Intergenic
1163167511 19:15508248-15508270 CCCAGCAGTGGCAGGAGGGCGGG + Intergenic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163653398 19:18531923-18531945 CCCAGCGGGGTAAGGAGGGTGGG + Exonic
1163737459 19:18990256-18990278 CTGACCAGGGTGAGGAGGGGAGG - Intergenic
1163845801 19:19637574-19637596 GACAGCAGGTTGGGGAGGGGCGG + Intronic
1164669052 19:30062741-30062763 CAGAGCAGGGCATGGAGGGCAGG + Intergenic
1164733711 19:30525238-30525260 GATTGCAGGGTGAGGAGGCCTGG - Intronic
1164761029 19:30728390-30728412 CACTGCAGGGTGAGGCTCGCTGG + Intergenic
1164830672 19:31317635-31317657 AACAGCAGGGTCTGGAGAGCAGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165136275 19:33671700-33671722 CACAGTAGGGGGAGGAGGACTGG - Intronic
1165913547 19:39244361-39244383 CAGAGCCAGGTGAGCAGGGCTGG + Intronic
1165927205 19:39334373-39334395 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1165976240 19:39679259-39679281 CTCAGCAGCGTGAGTAGGGGTGG - Intergenic
1166046181 19:40232466-40232488 CATGGCAGGGTGGGGAGGGGTGG - Exonic
1166097335 19:40549133-40549155 CACAGCAGGATCAGGAGGGCGGG + Intronic
1166159609 19:40942035-40942057 CACAGTAGGGAGGGGAGGGCAGG - Intergenic
1166394791 19:42431274-42431296 CAGACCAGTGAGAGGAGGGCAGG - Intronic
1167158163 19:47751620-47751642 GATGGGAGGGTGAGGAGGGCCGG + Intronic
1167482967 19:49744520-49744542 CAGAGCAGAGAGGGGAGGGCAGG - Intronic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
1167701181 19:51046988-51047010 CCCAGAAGGGGGAGGAGGGAGGG + Intergenic
1167822024 19:51936995-51937017 AACAGCAGGGTTTGGAGAGCTGG + Intronic
1168115924 19:54221343-54221365 CCCTGCAGGGTCAGGAGGGAGGG + Exonic
1168118907 19:54241091-54241113 CCCTGCAGGGTCAGGAGGGAGGG + Exonic
1168133850 19:54337660-54337682 CCCTGCAGGGTCAGGAGGGAGGG + Exonic
1168187536 19:54709569-54709591 CCCTGCAGGGTCAGGAGGGAGGG - Intergenic
1168557329 19:57354115-57354137 CTCAGGAGGGTGAGGTGGGGGGG - Intronic
1168681060 19:58316190-58316212 TAGAGCAGGCTGAGGAAGGCAGG - Intergenic
925214773 2:2084976-2084998 AATTGGAGGGTGAGGAGGGCTGG - Intronic
925376288 2:3388360-3388382 CACAGCGAGGGGAGGCGGGCTGG - Exonic
925528898 2:4837865-4837887 CAAAGCAGGGGGAGGAAGGTGGG - Intergenic
925952992 2:8933457-8933479 CACAGCTACTTGAGGAGGGCAGG - Intronic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926215104 2:10901448-10901470 AAGAGCAGGGGGAGGAGAGCGGG - Intergenic
926370276 2:12171894-12171916 CACAGCTTGATGAGGAGGACCGG - Intergenic
927141850 2:20136262-20136284 CCCTGCAGGCTGAGGCGGGCAGG + Intergenic
927561695 2:24077808-24077830 CTGAGGAGGATGAGGAGGGCAGG - Intronic
928124583 2:28606777-28606799 TGCAGCAGGGAGAGGAGGCCTGG + Intronic
928177829 2:29046997-29047019 CACAGCTGGGCTAGGAGGGGAGG - Intronic
928205050 2:29278069-29278091 TACACCAGGGTGGGGAGAGCAGG + Intronic
929145316 2:38702423-38702445 CACAGCAGGGTGGGGTGTGAGGG - Intronic
929893185 2:45936185-45936207 CACAGCAGGCAGGGGTGGGCAGG - Intronic
930019054 2:46990095-46990117 AGCAGCAGGCTGAAGAGGGCTGG - Intronic
931135425 2:59394489-59394511 GATAGCAGGGTGAAGAGGGCTGG - Intergenic
931789836 2:65654831-65654853 CCCAGAAGAGTTAGGAGGGCAGG + Intergenic
932306401 2:70706570-70706592 CAGAGCCTGGGGAGGAGGGCAGG + Intronic
932413937 2:71562672-71562694 CCCAGGAGTGTGAGAAGGGCAGG + Intronic
933398821 2:81765599-81765621 CAGAGCAGTCTGAGGAGAGCTGG + Intergenic
933750754 2:85601071-85601093 CTCAGCAGGGTCAGGAGGGCAGG + Exonic
933993939 2:87654129-87654151 GAAAGCAGGGTGAGAGGGGCAGG - Intergenic
934614306 2:95761783-95761805 CCCAGCAGAGTGAGCAGAGCTGG + Intergenic
934646595 2:96062704-96062726 CCCAGCAGAGTGAGCAGAGCTGG - Intergenic
934756274 2:96827009-96827031 CACAGAACGGTGAGGAGAGCAGG - Intronic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
934932401 2:98437118-98437140 CACTGAAGGGTGAGTAGAGCAGG - Intergenic
935101236 2:99997964-99997986 CAGAGCAGGGGAAAGAGGGCTGG - Intronic
935193366 2:100795818-100795840 GACAGTGGGGCGAGGAGGGCCGG - Intergenic
935347132 2:102118694-102118716 CACAGAAGTGTGTGGAGTGCAGG + Intronic
935673686 2:105576292-105576314 GTGAGCAGGGGGAGGAGGGCTGG + Intergenic
935856647 2:107281963-107281985 GACAGCAGTGTGAGGAATGCAGG - Intergenic
935954160 2:108358652-108358674 CACAGAAGTGTGTGGAGCGCAGG - Intergenic
936299926 2:111296785-111296807 GAAAGCAGGGTGAGAGGGGCAGG + Intergenic
936428040 2:112435931-112435953 CAGAGCAGGATGTGGAGGGAGGG + Intergenic
936574768 2:113643900-113643922 CTCAGAAGAGTGAGGGGGGCAGG + Intergenic
936582628 2:113716726-113716748 GAAAGCAGGATGAGCAGGGCAGG + Intronic
937279903 2:120710640-120710662 CACAGCAGGGTCAGGCGTGGTGG + Intergenic
938143407 2:128813792-128813814 CACAGCCGGGTCAGGAAGACAGG - Intergenic
938305089 2:130247829-130247851 CACAGATTGGAGAGGAGGGCTGG + Intergenic
938448925 2:131399378-131399400 CACAGATTGGAGAGGAGGGCTGG - Intergenic
939466377 2:142562083-142562105 GACAGCATGTTGAGGATGGCAGG + Intergenic
939960258 2:148559925-148559947 CACTTCAGGGGGAGGAGGGCAGG - Intergenic
940001239 2:148967949-148967971 GACAGGAGGATGGGGAGGGCGGG + Intronic
940909410 2:159196785-159196807 CACAGCTCGGTGAGTGGGGCAGG + Exonic
941255985 2:163231565-163231587 CAGAGTAGGGTGAGTATGGCTGG - Intergenic
941651162 2:168094084-168094106 CACAGCATGCTGGGGAGGGCTGG - Intronic
941918626 2:170828402-170828424 GACAGCAGAGGGAGGAGGGTGGG - Intronic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
943662989 2:190578747-190578769 TACAGCAGGGTGTGGAGTGCAGG + Intergenic
945219770 2:207471786-207471808 CACAGTTGTGGGAGGAGGGCAGG - Intergenic
945438979 2:209855295-209855317 GTCAGCAGGGTTAGGGGGGCAGG + Intronic
945577763 2:211553415-211553437 CATACCAGGCTGAGGAGAGCAGG - Intronic
945869208 2:215208237-215208259 CACCCAAGGGTGAGGAGTGCGGG + Intergenic
945968929 2:216217613-216217635 GACAGGAGGATCAGGAGGGCTGG - Intergenic
946130405 2:217602131-217602153 CTGAGCAGGTTGAGGAGGGAGGG - Intronic
946882583 2:224191391-224191413 CACAGTAGGGTGAGGGTGGAAGG - Intergenic
948231385 2:236351771-236351793 CAGGGCAGGATGGGGAGGGCAGG + Intronic
948329131 2:237151266-237151288 CAGAGCAGGGTGGACAGGGCAGG + Intergenic
948532223 2:238616592-238616614 CACAGCAAGGGGAGGTTGGCGGG - Intergenic
948694628 2:239727004-239727026 CACTGCAGGATGGGGAGGCCAGG - Intergenic
948720434 2:239896246-239896268 CACAGCAGGGGCAGGAGCACAGG - Intronic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
949010715 2:241676844-241676866 CACAGGAGCGTGGGCAGGGCAGG - Intronic
949013486 2:241695886-241695908 CAAAGCAGGGTGAGTAAAGCAGG + Intergenic
949055300 2:241924926-241924948 CACAGCAGGGTCAGGATGCCTGG - Intergenic
1169142814 20:3235780-3235802 CAGGGCAGGGGGAGCAGGGCTGG - Intronic
1170398140 20:15950364-15950386 CATAGCAGGATGAGGAAGGAGGG + Intronic
1170811971 20:19681155-19681177 CCCAGCAGGCTGAGGTGGGAAGG - Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1172124469 20:32617087-32617109 TACTGCAGGGAGAGGAGGGATGG + Intergenic
1172161957 20:32875137-32875159 CACAGCAGTGTGGGGAGGGGAGG - Intronic
1172241013 20:33412481-33412503 CAGGGCAGGGTGAGGTGGCCAGG + Intronic
1172270910 20:33655289-33655311 CACTGCAGGGCGAGGCAGGCAGG + Intergenic
1172382787 20:34510568-34510590 CACAGCCTGGTCAGGAGGGAAGG + Exonic
1172588647 20:36102421-36102443 CAGAGCTGGGTGGAGAGGGCTGG + Intronic
1173188415 20:40858543-40858565 CCCAGCTGGGTGAGGAGTGCAGG - Intergenic
1173363814 20:42367618-42367640 CAGAGCAGGGTGGGGAGGATAGG + Intronic
1173548696 20:43917159-43917181 TAGAGCAGGGTGAGGCGGGAGGG + Intronic
1173585263 20:44177309-44177331 CTCATGAGGGTGTGGAGGGCAGG + Intronic
1173617114 20:44410489-44410511 CCCAGCAGGCTGAGGAGGGGTGG - Intronic
1173827451 20:46056961-46056983 CACAACAGAGTGAGGAGGGTAGG - Intronic
1174385762 20:50187753-50187775 CCCAGCAGGGGGTGGAGGGTGGG + Intergenic
1174442812 20:50569438-50569460 TCCAACAGAGTGAGGAGGGCAGG - Intronic
1174554058 20:51381508-51381530 CCCAGCAGGGTGCAGAGGGAGGG - Intergenic
1175070113 20:56325858-56325880 CTTGGCAGTGTGAGGAGGGCTGG - Intergenic
1175319716 20:58076608-58076630 CACAGCTGGGTGGGGTGAGCTGG + Intergenic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175734873 20:61378144-61378166 CTCAGCAGGCTGAGGTGGGAGGG + Intronic
1175855464 20:62118669-62118691 GACAGTAAGGTGAGGAGGGAGGG - Intergenic
1175864659 20:62168850-62168872 CACAGCAGGATGAGTGGGACAGG + Intronic
1175880158 20:62253264-62253286 CACAGCAGTGTGTGTAGGGAAGG + Intronic
1176100235 20:63361373-63361395 CCCAGCCGGCTGAGGCGGGCAGG - Exonic
1176109039 20:63402841-63402863 CACAGCCGTCTGAGCAGGGCAGG - Intergenic
1176374216 21:6079281-6079303 CAGAGCAGGATGTGGAGGGAGGG - Intergenic
1176375981 21:6087107-6087129 CACAGCATGCTGAGGAGCTCGGG - Intergenic
1176419994 21:6506365-6506387 CAAAGCAGGTGGAGGAGGGTGGG + Intergenic
1176907523 21:14520907-14520929 CATTGTAGGGTGAGTAGGGCAGG - Intronic
1177041330 21:16114789-16114811 CTCAGGAGGCTGAGGAGGGAGGG + Intergenic
1177838553 21:26212242-26212264 CATTGTAGGGTGAGTAGGGCAGG + Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1178282320 21:31294078-31294100 CACAGCATGGTGAGGGTGGGGGG + Intronic
1178489787 21:33042150-33042172 CACACCAGGCTGAGGAAGGGAGG + Intergenic
1179022924 21:37656378-37656400 CCCAGCAGGGAGAGGAGAGCTGG - Intronic
1179032442 21:37732250-37732272 CACAGCAGGGTGTGTGGGGCTGG + Intronic
1179422622 21:41248713-41248735 CACGCCCTGGTGAGGAGGGCAGG + Intronic
1179540757 21:42082116-42082138 CAGGGCTGGGTGAGGAGAGCGGG + Intronic
1179548241 21:42126282-42126304 CACAGCAGGGCGTGGGGGGCCGG + Intronic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179627773 21:42658263-42658285 CCCAGCAGGGTGCAGAGGCCTGG - Intronic
1179681003 21:43021423-43021445 CACATCGGGGTAAGGACGGCTGG + Exonic
1179695485 21:43114685-43114707 CAAAGCAGGTGGAGGAGGGTGGG + Intergenic
1179747494 21:43451137-43451159 CACAGCATGCTGAGGAGCTCGGG + Intergenic
1179749260 21:43458964-43458986 CAGAGCAGGATGTGGAGGGAGGG + Intergenic
1179837723 21:44048325-44048347 CACCAGAGGGTGGGGAGGGCAGG - Intronic
1179932554 21:44579855-44579877 CACAGCAGGAGGAGATGGGCAGG + Exonic
1179981160 21:44896680-44896702 CACAGCAGGCTCAGCAGGACAGG - Intronic
1180048969 21:45322797-45322819 CGGAGCAGGGGGAGGAGGGGCGG - Intergenic
1180100288 21:45580793-45580815 GACCGCAGGATGAGAAGGGCAGG + Intergenic
1180140995 21:45893285-45893307 CACAGCAGGGGCTGGAGGGTGGG + Intronic
1180181251 21:46119584-46119606 CGCAGCAGAGGGACGAGGGCTGG + Intronic
1180210851 21:46294988-46295010 CCCAGCAGGGTGTGCATGGCGGG - Intronic
1180998306 22:19976375-19976397 CCCATGAGGGTGAGCAGGGCAGG - Intronic
1181082596 22:20424846-20424868 CCCAGCCTGGGGAGGAGGGCTGG - Exonic
1181274137 22:21677865-21677887 CACAGCAGGGGGAGGGGAGAGGG + Intronic
1181525739 22:23484925-23484947 CACAGCTGAGTGCTGAGGGCAGG + Intergenic
1181572193 22:23773662-23773684 GACAGCAGAGTGAGGAGAGGAGG + Intronic
1181811395 22:25405551-25405573 CAGGGCAGGGCGAGGAGCGCGGG - Intergenic
1181844974 22:25699610-25699632 CACAGCTGTGGGAGGAGGGAGGG - Intronic
1181861905 22:25825461-25825483 CAAAGCAGAGTGAGGAGTGTAGG - Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182336764 22:29588791-29588813 CTCTGCAGGGAGAGGAGGGGTGG - Intergenic
1182352639 22:29707329-29707351 CACACCAGGGTCAGCAGGGTAGG + Intergenic
1182678851 22:32062532-32062554 CATTGGAGGGTGAGGAGGGTTGG + Intronic
1183066976 22:35370107-35370129 AACAGCAGAATGAGGAGGACAGG + Intergenic
1183347600 22:37316554-37316576 CAGAGCAGGCAGTGGAGGGCTGG + Intergenic
1183409514 22:37646767-37646789 CACAGAGGGGTGGGCAGGGCAGG - Intronic
1183465766 22:37979746-37979768 TGCCCCAGGGTGAGGAGGGCAGG + Intronic
1183472505 22:38017055-38017077 CACAGCTGCCTCAGGAGGGCTGG - Intronic
1183547665 22:38463507-38463529 AACCGCAGGGAGAGGAAGGCTGG + Intergenic
1183671843 22:39277799-39277821 AACAGCAGGGTGAGACTGGCTGG + Intergenic
1184037485 22:41925654-41925676 CAATGCAGGGTGGGGAGGGGTGG + Intronic
1184187535 22:42874778-42874800 CCCAGCAAGGTGAGGAGTCCAGG + Intronic
1184332568 22:43835416-43835438 CCCAGCTGGATGAGGAGCGCTGG + Intronic
1184646496 22:45898061-45898083 CACACCAGGCAGAGGAGGACGGG + Intergenic
1184681274 22:46073577-46073599 CTCAGTAGGGTGGGGAGGGCAGG - Intronic
1184688731 22:46107996-46108018 CACAGCAGGGTTGGGTGTGCAGG + Intronic
1184697701 22:46149475-46149497 CACAGCTGGCAGCGGAGGGCAGG + Intergenic
1184772729 22:46607435-46607457 CACACCAGCCTGTGGAGGGCTGG - Intronic
1184784139 22:46663657-46663679 CACAGCAGGGTGCGCCGGGATGG - Intronic
1184794701 22:46725171-46725193 CACACCGAGGTGAGGAGAGCAGG - Intronic
1184965903 22:47972135-47972157 CACAAAAGGGTGCTGAGGGCTGG - Intergenic
1184992703 22:48181672-48181694 CAAAGCACAGGGAGGAGGGCAGG + Intergenic
1185027342 22:48423041-48423063 CACAGCAGGGCCAGGCTGGCTGG + Intergenic
1185092690 22:48784906-48784928 CATAGCAGGCTGCAGAGGGCAGG - Intronic
1185329437 22:50245602-50245624 CACAGATCGGTGGGGAGGGCAGG - Intronic
1185339118 22:50283760-50283782 CAGAGCCGGGTGAGCAGGGAGGG + Intronic
1185425405 22:50766976-50766998 CTCAGAAGAGTGAGGGGGGCAGG - Intergenic
949220901 3:1632806-1632828 CACAGCACTGTGGGGAGGGCTGG - Intergenic
949868874 3:8570185-8570207 CAGAGCATGGTGAGGAGGGTGGG + Intergenic
950064384 3:10100078-10100100 CACAGGAGGCTGAGGTGGGAGGG + Intronic
950094228 3:10319383-10319405 CACAGGAAGGCGGGGAGGGCAGG + Intronic
950667878 3:14508219-14508241 CACAGTAGGGCGTGAAGGGCTGG + Intronic
950943128 3:16914835-16914857 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
951528620 3:23678259-23678281 CCCAGGAAGGTGAGCAGGGCTGG - Intergenic
951566747 3:24019261-24019283 CACAGCATGGTGAGCGGGGTTGG + Intergenic
951940905 3:28077807-28077829 AACAGCAGGGGGCGAAGGGCTGG + Intergenic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952367503 3:32687747-32687769 CACATTAGAGTGAGGACGGCAGG - Intronic
952763980 3:36939401-36939423 CACAGCAGTGTTAACAGGGCTGG + Intronic
952968021 3:38632995-38633017 CACAGAAGGGTAGGCAGGGCTGG + Intronic
953235408 3:41102201-41102223 CACAGCAGAGTAAGGGAGGCAGG - Intergenic
953351352 3:42218815-42218837 CACAGCAGTGTGAGCAGGACAGG - Intronic
954129051 3:48550472-48550494 CACATCAGGATGAAAAGGGCTGG - Intronic
954239927 3:49285536-49285558 CTCAGGAGGGTGAGGTGGGAAGG + Intronic
954583318 3:51715255-51715277 CACTGCAGCGAGAGGCGGGCAGG - Exonic
954677726 3:52324956-52324978 CGCAGCAGGGTCTGGAGGCCAGG + Intronic
954682461 3:52353082-52353104 TACTGCAGGGACAGGAGGGCAGG - Exonic
954708141 3:52491994-52492016 TACAGCAGGATGCTGAGGGCTGG - Exonic
955343966 3:58147454-58147476 CACAGCAAGGTGAGGAGCATGGG - Intronic
955393330 3:58536806-58536828 GAGAGCAGAGTGAGGAGGACAGG - Intronic
955534084 3:59904704-59904726 CATTGAAGGGTGAGGAGGGCAGG + Intronic
956873871 3:73443223-73443245 CACAGCAGCTTCAGGAGGGTAGG - Intronic
960093426 3:113665178-113665200 GACAGCAGGATCAGAAGGGCAGG + Intronic
961064875 3:123866856-123866878 CATTGAAGGGTGAGGAGGGAGGG - Intronic
961142543 3:124567388-124567410 CACAGAAGGCAGAGGAGGGAAGG - Intronic
961393717 3:126571477-126571499 CAAAGCAGGTGGAGGAGGGCTGG + Intergenic
961492617 3:127265804-127265826 CACAGCAGGGTAAGGAGCCGGGG + Intergenic
961524003 3:127484962-127484984 CACCCCAGGGCAAGGAGGGCTGG - Intergenic
961759263 3:129153539-129153561 TACGGGAGGGTGAGGTGGGCAGG + Intronic
962005873 3:131349164-131349186 AAAAGCAGGGTGAGGCGGACAGG - Intronic
962068066 3:132004057-132004079 GACAGAAGGGTGTGGAGAGCAGG - Intronic
962505196 3:136039657-136039679 CACAGCAGGAGGTGAAGGGCAGG - Intronic
962629757 3:137263998-137264020 CACAGCAGGGGTGGGAGGGAGGG + Intergenic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
964770347 3:160218305-160218327 CTCAGCAGGCTGAGGTGGGAGGG + Intergenic
967231209 3:187338979-187339001 CACAGCAGCCTGAGAAGGGATGG + Intergenic
968509217 4:987996-988018 CACAGATGGGAGGGGAGGGCTGG + Exonic
969426486 4:7127404-7127426 CCCCACAGGGTGAGGAGAGCTGG + Intergenic
969496552 4:7529634-7529656 CTCAGCAGGGTGGGGAAGGAAGG + Intronic
969598166 4:8160412-8160434 CACAGCCTGGTGAGGACGGCAGG + Intergenic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
971261092 4:25057541-25057563 GACAAGAGGGTGAGGAGGGGAGG + Intergenic
971288499 4:25312906-25312928 CACAGCGGGGCGGGGACGGCAGG - Exonic
972418472 4:38865517-38865539 CACAGCAGGGAAGGGAAGGCAGG + Intergenic
972445139 4:39136567-39136589 CCAAGCAGGGTGAAGAGGGTGGG + Intergenic
972869376 4:43277931-43277953 TACAGCAGCTTGAGGATGGCTGG - Intergenic
975537077 4:75462083-75462105 AACAGCAGGCTGATGAGGACAGG + Intergenic
975760463 4:77614757-77614779 CAGGGCAGGGTGAGGAGAGAGGG - Intergenic
977324740 4:95561005-95561027 GACTGCAGGGAGAGGAGGACTGG + Intergenic
979276052 4:118815437-118815459 CGCAGCAGGGTAAGGCGGACAGG - Exonic
979846702 4:125522738-125522760 CACAGCATAGTGAGTAGGGCAGG - Intergenic
979920620 4:126491302-126491324 CACAGCAGGATGAGGATAGATGG + Intergenic
980613272 4:135185230-135185252 CACTGAAGGGTGAGTAGAGCAGG + Intergenic
981532412 4:145765201-145765223 GGCAGCGGGGAGAGGAGGGCAGG + Intronic
982007121 4:151074318-151074340 CATAGCAGGAAGAGGAGGGAAGG + Intergenic
982358287 4:154491966-154491988 CACGGCAGGGAGGGGAAGGCAGG - Intergenic
982497552 4:156109852-156109874 TTCAGCAGGCTGAGTAGGGCGGG + Intergenic
983929042 4:173433497-173433519 CACAGCAGAGTGTACAGGGCGGG - Intergenic
984769600 4:183425938-183425960 CACAGGAGGGGGAGGGGGGGAGG - Intergenic
984770171 4:183430551-183430573 CAGAGCAGGCAGAGCAGGGCTGG + Intergenic
985415351 4:189731043-189731065 CGCACCAGGGTGAGGACAGCAGG + Intergenic
985721788 5:1493340-1493362 CACAGCTGGGATAGGAAGGCTGG - Intronic
985885099 5:2671249-2671271 CACACCAGGGTGCGGCGGGGAGG + Intergenic
985945211 5:3177102-3177124 CACAGGAAGGTGGGGAGGGTTGG + Intergenic
986452982 5:7884670-7884692 TCCAGCAGGGTGTGGAGGGTAGG - Intronic
986661784 5:10065775-10065797 CACGGCAGGGCGTGGGGGGCGGG - Intergenic
987683897 5:21171802-21171824 AAAAACAGGGAGAGGAGGGCAGG + Intergenic
988975899 5:36515562-36515584 CACAGCAGGGATAGGATGGTGGG + Intergenic
993799344 5:92312359-92312381 CTCAGCAGGATGAGTAAGGCTGG + Intergenic
994979611 5:106856843-106856865 CATTGTAGGGTGAGTAGGGCAGG + Intergenic
995514232 5:112938446-112938468 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
995856811 5:116601164-116601186 CAGAGGAGGGAGAGGAGGGAGGG - Intergenic
996591468 5:125152795-125152817 AACAGTAGGGTGAGGAGCCCTGG + Intergenic
997610334 5:135211450-135211472 GACAGCAGGGTGTGGTGGGAAGG + Intronic
997692375 5:135835375-135835397 CACAGCAGGGAGCGGAGCGCCGG + Intronic
997994604 5:138575572-138575594 CGCAGCCGGGACAGGAGGGCAGG - Intergenic
998133188 5:139661216-139661238 CAGAGCAGGGTGAGCTGGGCGGG + Intronic
999197603 5:149793120-149793142 CACCCCAGGGTGGGGAAGGCAGG - Intronic
999437098 5:151571388-151571410 CACAGCAGGGCAGGCAGGGCTGG - Intergenic
1000658811 5:163914990-163915012 TTCAGCAGGGTGTGGAGGGATGG - Intergenic
1001512977 5:172336685-172336707 CAGGGCAGGGTGGGGAGGGGCGG + Exonic
1001816916 5:174677148-174677170 CAGAGCAGGGTGGGGTGGGTAGG - Intergenic
1001966643 5:175914353-175914375 CACAGCAGAGGGAGGAGGGAGGG + Intergenic
1002250304 5:177924851-177924873 CACAGCAGAGGGAGGAGGGAGGG - Intergenic
1003014912 6:2460542-2460564 CAGAGCAGGGAGAGGAGGCTGGG + Intergenic
1004188991 6:13447885-13447907 CACAGAGGGCTGAGGAGGGCTGG + Intronic
1005292476 6:24393401-24393423 CAAAGGAGATTGAGGAGGGCAGG - Intergenic
1006026735 6:31151644-31151666 CAGAGTAGGGTGGGGAGGGACGG - Intronic
1006747852 6:36357444-36357466 CAGAGCAGGATGAAGAGGGGTGG + Intronic
1006751302 6:36379441-36379463 CTCAGAAGGCTGAGGAGGGAGGG + Intronic
1006797485 6:36741064-36741086 CACAGCAGGGGCAGGAGCTCGGG + Exonic
1006955107 6:37862574-37862596 CTCAGGAGGTTGAGGTGGGCGGG + Intronic
1007178057 6:39909810-39909832 AAGTGCAGGGTGGGGAGGGCTGG - Intronic
1007290546 6:40782905-40782927 ATCAGCAGGGAGAGGAGGGGAGG - Intergenic
1007590942 6:43020750-43020772 GACAGCAGGCTCAGGAGGGGAGG - Exonic
1007835108 6:44668051-44668073 CAGAGCAGGCTTAGCAGGGCAGG - Intergenic
1011597434 6:89029593-89029615 CACAGCAGGGGCAGGAGGGCTGG - Intergenic
1011981301 6:93382436-93382458 CACAGCAGGATGTGCGGGGCAGG - Intronic
1013220254 6:108071841-108071863 CACATCAGGGTGAGTTGAGCTGG + Intronic
1015831025 6:137369154-137369176 CACAGCAGAGGGCAGAGGGCTGG + Intergenic
1016617998 6:146075471-146075493 CAGAGCAGGGTGAGGATGATGGG + Intronic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1017106784 6:150895310-150895332 CACGGAAGGGAGAGGTGGGCAGG + Intronic
1017107516 6:150901652-150901674 CAGAGCAGGGTCTGGAGGGCAGG - Intronic
1017381120 6:153831488-153831510 CACAGCAGAGTGTTGAAGGCGGG - Intergenic
1017421572 6:154278312-154278334 CACAGCAGTGTCAGGAGACCTGG - Intronic
1017731095 6:157316766-157316788 CACAGGAGGCTGAGGTGGGAAGG + Intronic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018690532 6:166340662-166340684 CAGAGCAGGTTGAGGAGGTTGGG - Intronic
1018905262 6:168072205-168072227 CCCAGCAGGGGGTGCAGGGCAGG - Intronic
1018906623 6:168079548-168079570 CAGGGCAGGACGAGGAGGGCGGG + Intronic
1018907466 6:168083798-168083820 GACAGCAGAGCCAGGAGGGCAGG + Intergenic
1019109799 6:169700827-169700849 CACAGCAGGGAGAGGAGGTAGGG - Intronic
1019596124 7:1859184-1859206 CACACCAGGGGGAGGCAGGCTGG - Intronic
1019637410 7:2083456-2083478 CACAGCACGGAGAGGAGGTGCGG + Intronic
1019657425 7:2203320-2203342 CACAGTACAGTGAGGAGAGCAGG - Intronic
1019930663 7:4220890-4220912 CTCAGGAGGGTGAGGCGGGGTGG - Intronic
1019996669 7:4729165-4729187 CACAGCATGGTGGGGAGCGGAGG + Intronic
1020660456 7:10974661-10974683 AGAAGCAGGGTGGGGAGGGCTGG - Intronic
1021647664 7:22802265-22802287 CATTGAAGGCTGAGGAGGGCTGG - Intergenic
1022044095 7:26609684-26609706 CACAGCAGGATCCGGAGGACAGG + Intergenic
1022214084 7:28240791-28240813 CACAGCAGAGTGAGAGGGACAGG - Intergenic
1022678890 7:32525931-32525953 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1024257058 7:47547144-47547166 CCCTCCAGGGTGAGGAGGGAGGG + Intronic
1024270591 7:47638571-47638593 CACAGCAGGGTGAGGTAGCAGGG - Intergenic
1024897766 7:54280200-54280222 CACCGTAGGGTGAATAGGGCAGG - Intergenic
1026206093 7:68258807-68258829 GAAGGCAGGGAGAGGAGGGCAGG - Intergenic
1026352744 7:69531770-69531792 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
1026627012 7:72003449-72003471 CACAGCAGAGGGAGAACGGCAGG + Intronic
1026800732 7:73398218-73398240 CATAGCAGGGTGAGGCAGGGAGG - Intergenic
1027129097 7:75578221-75578243 CACAGCAGCGGGAGGCAGGCAGG + Intronic
1027187198 7:75979652-75979674 CTCAGCAGGGGGAGGCCGGCAGG + Intronic
1027867112 7:83662308-83662330 CTCAGCAGGCTGAGGTGGGAGGG - Intergenic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1029279900 7:99428880-99428902 CAAAGCAGGGTGGGAGGGGCGGG + Intronic
1029446382 7:100615148-100615170 AACACCATGGTGAGGAGGCCTGG - Exonic
1029652827 7:101905528-101905550 TACAGCATGGTGTGGAGGGAAGG - Intronic
1029880068 7:103798867-103798889 CACAGAAGCGGGAGGAAGGCTGG - Intronic
1030058803 7:105606963-105606985 CACAGCAGGGTGAGCTAGGAGGG - Exonic
1030078154 7:105754566-105754588 CTCAGCAGGCTGAGGTGGGAGGG - Intronic
1031964375 7:128017157-128017179 CACTGCAGGATGAGGAAAGCAGG - Intronic
1032097409 7:128946475-128946497 CACAGCAGGGAGAGAAAAGCAGG - Intronic
1032106592 7:129036322-129036344 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1032695287 7:134330642-134330664 CACAGCAGTGTAAGGAAAGCAGG - Intergenic
1033236332 7:139640755-139640777 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
1034190633 7:149210727-149210749 CACACCAGGGAGGGGAGGGGAGG + Intronic
1034233460 7:149550649-149550671 GACTTCAGGCTGAGGAGGGCTGG - Intergenic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1034938224 7:155213465-155213487 CACTGCAGGGGGAGGATGCCTGG - Intergenic
1035738395 8:1906564-1906586 TAAGGCAAGGTGAGGAGGGCAGG - Intronic
1035748191 8:1976562-1976584 CACAGCAGGGTGGGGGGTGGGGG - Intronic
1037319589 8:17630639-17630661 CCCAGCAGGGAGGGGAGGGGAGG - Intronic
1037631069 8:20656869-20656891 ATAAGAAGGGTGAGGAGGGCAGG - Intergenic
1037827367 8:22167440-22167462 CACAGCAGGCTGAGAAGGTCTGG + Intronic
1037988050 8:23301978-23302000 CCCTGCAGGGGGAGGAGGGGAGG - Intronic
1038176265 8:25184452-25184474 ATCAGCCGGGTGGGGAGGGCGGG + Intergenic
1038236198 8:25758955-25758977 CACACGTGGGTGAGGAGGGCGGG - Intergenic
1038611263 8:29061839-29061861 CAGTGCAGGGTGGGGAGGGATGG - Intronic
1038701785 8:29855774-29855796 CATGGGAGGGTGGGGAGGGCTGG - Intergenic
1040295852 8:46148716-46148738 AACAGCCGGGTGACGTGGGCAGG - Intergenic
1040299830 8:46182170-46182192 GACAGCAGGGTGGGCTGGGCAGG - Intergenic
1040318058 8:46275418-46275440 GGCAGCAGGGTGGGGTGGGCAGG + Intergenic
1040325855 8:46341144-46341166 CACAGCAGGGTGGCATGGGCGGG + Intergenic
1040339565 8:46433596-46433618 CACAGCAGGATGACATGGGCAGG + Intergenic
1040994136 8:53384568-53384590 CATTGAAGGGTGAGGAGGGCTGG + Intergenic
1041045348 8:53881888-53881910 GAAAGCAGGGGGCGGAGGGCGGG + Intronic
1041199233 8:55434881-55434903 CACAGCAGGGAAGGGAGAGCTGG - Intronic
1041780000 8:61567851-61567873 CAAAGCAGGCTTAGGAGTGCTGG + Intronic
1042827582 8:72994150-72994172 CACAGCAGGAGGTGGACGGCAGG - Intergenic
1042890821 8:73608497-73608519 CTCAGGAGGCTGAGGAAGGCAGG + Intronic
1043648498 8:82555999-82556021 CACAGCAATGTCATGAGGGCTGG + Intergenic
1044233697 8:89806973-89806995 CACCCCAGGGTCAGGAAGGCGGG - Intergenic
1044302115 8:90596740-90596762 CACTGCAGGCTGAGGATGGAAGG + Intergenic
1044517366 8:93155026-93155048 CACTGCATGGTGGGGAGGGTTGG + Intronic
1045828726 8:106432385-106432407 CACGGCAGGAACAGGAGGGCTGG - Intronic
1045888022 8:107122917-107122939 CACAGCAGGTTGATGACGGCAGG + Intergenic
1046330092 8:112702706-112702728 GAGAGTAGGGTGAGGAGGTCAGG + Intronic
1046638146 8:116695657-116695679 CTGAGCAGGGTAAGGAAGGCAGG + Intronic
1046877048 8:119266672-119266694 GACAGCAGGGAGAGGAAGGAAGG + Intergenic
1047301617 8:123618326-123618348 CACAGCAGGAGGTGGGGGGCAGG + Intergenic
1047750575 8:127877290-127877312 AACAGCAGCGTGAAAAGGGCGGG - Intergenic
1048042582 8:130745659-130745681 CCCAGGAGGGTGTGGAGAGCAGG + Intergenic
1048209706 8:132444460-132444482 GACAGCATGGTGTGGAGGACAGG + Intronic
1049148189 8:141017369-141017391 GAAAGATGGGTGAGGAGGGCGGG - Intergenic
1049237156 8:141518168-141518190 CCCGGCAGGGCGGGGAGGGCCGG - Intronic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049273153 8:141706836-141706858 CACAGCTGAGTGAGGAGGAAGGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049393511 8:142384096-142384118 CAGAACCGGGTGAGAAGGGCTGG + Intronic
1049406898 8:142455641-142455663 CACAGCTGAGTGAGGAGTGGGGG - Intronic
1049427433 8:142543700-142543722 GACAGCAAGGTCTGGAGGGCAGG + Exonic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1049567334 8:143347944-143347966 CTGAGGAGGGTGAGGAGGGGTGG + Intronic
1049572469 8:143375705-143375727 CCCACCTGGGTGAGGGGGGCAGG + Intronic
1049574313 8:143383418-143383440 CCAAGCAGGCTGGGGAGGGCTGG - Exonic
1049748894 8:144274358-144274380 GACAGTGGGGTGAGGAGAGCAGG - Intronic
1049752500 8:144291803-144291825 CACAGCTTGGTCAGGAAGGCCGG - Exonic
1050528371 9:6565340-6565362 CACAGAACGGTGAGTATGGCAGG - Exonic
1052741576 9:32398082-32398104 CACAGCAGGAGGAGGAGCACAGG - Intronic
1055782231 9:79832409-79832431 CTCAGGAGGGTGAGGTGGGAGGG - Intergenic
1056549039 9:87636149-87636171 AAGAGCAGGGTGGGGAGTGCAGG + Intronic
1057084767 9:92199063-92199085 CATAGGAGGCTGAGGTGGGCGGG + Intergenic
1057105415 9:92410493-92410515 CCCACCAGGGTGAGGATGGCAGG - Intronic
1057183185 9:93040672-93040694 CAAGGCAGTGTGAGGAGAGCAGG - Intergenic
1057367557 9:94437344-94437366 AGCAGCAGGGTGGGGAGAGCAGG - Intronic
1057655771 9:96950709-96950731 AGCAGCAGGGTGGGGAGAGCAGG + Intronic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1058192037 9:101929801-101929823 GCCAGCTGGGTGAGGAGGGAAGG + Intergenic
1058480399 9:105387424-105387446 TACAGAAAGGTGTGGAGGGCAGG - Intronic
1058491121 9:105500595-105500617 CACAGCAGGGGGAGGAGAAAAGG - Intronic
1058857598 9:109079246-109079268 AATAGCAGGGTGAGGAAGTCAGG - Intronic
1058884388 9:109312510-109312532 CACAGCTGGGCGAGGGGGGTGGG - Intronic
1058953703 9:109926530-109926552 TACAGCATGGGGAGGATGGCAGG + Intronic
1059428649 9:114236838-114236860 CACAGCAGGGAAAGGAAGGAAGG + Intronic
1059529445 9:115022443-115022465 CACAGCAGGAGGAGCAGAGCTGG + Intronic
1060353486 9:122881189-122881211 CAAAGAAAGGTGAGGAGGCCAGG + Intronic
1060409565 9:123391060-123391082 CACAGCAGTGTGGGCAGCGCTGG - Intronic
1060806852 9:126583187-126583209 CCGAGCAGGGTGAGGTGGGGAGG - Intergenic
1060966904 9:127716630-127716652 CACAGGAGAGGGAGAAGGGCAGG + Exonic
1060976631 9:127768782-127768804 CAGAGCAAGGTGGGGAGGACAGG - Intronic
1061159256 9:128883676-128883698 CAGAGCAGGGGGTGCAGGGCCGG + Intronic
1061224639 9:129273733-129273755 CTCAGCAGGGTGTGGAGGGAGGG - Intergenic
1061789034 9:133048908-133048930 CCCAGCAACGTGAGCAGGGCAGG - Intronic
1061955174 9:133957541-133957563 CAGGGCAGGGCGAGGAGGGGAGG + Intronic
1062152739 9:135030276-135030298 TGCAGGAGGGTGAGCAGGGCAGG + Intergenic
1062185390 9:135215557-135215579 GACAGCAGCGTGAGGAGGAAGGG + Intergenic
1062385212 9:136306639-136306661 CCCAGCAGGGTCAGAAGGCCGGG + Intronic
1062397082 9:136356888-136356910 CCCTGCCGGGTGTGGAGGGCTGG - Intronic
1062561016 9:137141901-137141923 CCCAGCAGGCTAAGGGGGGCTGG - Intronic
1062562488 9:137147832-137147854 CACGGCAGGGTGGGGGCGGCAGG + Intronic
1062591134 9:137275318-137275340 CCCAGTAGGGTGAGGAGTGGAGG + Intergenic
1062725116 9:138068670-138068692 CACAGCTTGGTGGGGAGGGGTGG + Intronic
1185762375 X:2698572-2698594 CACAGAAGGCTAAGGTGGGCAGG - Intronic
1185778343 X:2824204-2824226 AACAGGCGGGTGAGGAGGGGTGG + Intergenic
1185856928 X:3544500-3544522 CGCAGCAGGGTGAGGATGGCAGG + Intergenic
1186418379 X:9403229-9403251 CAGAGCAGGGTCAGGAGGAATGG + Intergenic
1186663263 X:11691422-11691444 CAAATGAGAGTGAGGAGGGCAGG - Intergenic
1186750211 X:12614048-12614070 CTCAGCAGGCTGAGGTGGGAGGG + Intronic
1186990481 X:15061755-15061777 AAAAGCAAGGTGAGGAGGGAGGG + Intergenic
1187072393 X:15901209-15901231 CACAGCAGGGAGTGCTGGGCTGG + Intergenic
1187303468 X:18074054-18074076 CTCACCAGGGTCACGAGGGCTGG + Intergenic
1189208023 X:39258448-39258470 CACAGCAGGGACACTAGGGCAGG - Intergenic
1189238186 X:39505098-39505120 CTCAGCACGGGGTGGAGGGCTGG + Intergenic
1189249424 X:39588467-39588489 AACTGCAGCTTGAGGAGGGCTGG + Intergenic
1189321845 X:40091870-40091892 CAAAGCTGGGTGGGGAGGCCTGG - Intronic
1189353640 X:40295681-40295703 CACAGCAGCGTGGGGAGAGCCGG + Intergenic
1190119945 X:47651151-47651173 CACAGCGGAGGTAGGAGGGCAGG + Intergenic
1190525975 X:51330273-51330295 GACAGCAATGTGAGGAAGGCTGG - Intergenic
1190777643 X:53565872-53565894 ATCAGCCGGGCGAGGAGGGCAGG - Intronic
1191057210 X:56254392-56254414 CACAGCAGAGTCCGGGGGGCGGG + Intronic
1191718927 X:64213143-64213165 CACAGGAGAATGAGGAAGGCTGG + Intergenic
1194746734 X:97636459-97636481 CACAGAAGAGAGAGGAGGGGAGG + Intergenic
1195011017 X:100732104-100732126 CCCGGGAGGGTGAGAAGGGCCGG - Intronic
1195854003 X:109310933-109310955 CACAAGAGGTTGAGGATGGCAGG - Intergenic
1200005680 X:153082837-153082859 CAGGGCAGGGTGGGGAGGGACGG - Intergenic
1200092161 X:153641088-153641110 CAGAGCAGGGTGGGCAGGCCTGG + Intergenic
1200120841 X:153789831-153789853 CACGGCAGGGTCAGGGAGGCTGG + Intronic
1200807301 Y:7445958-7445980 TGCACCAGGGTGAGGATGGCAGG - Intergenic
1201705660 Y:16933920-16933942 CACAGGAGGCTGAGGTGGGAGGG - Intergenic