ID: 1142482421

View in Genome Browser
Species Human (GRCh38)
Location 17:227215-227237
Sequence CCCAGAGAAGTGGGCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142482421_1142482429 14 Left 1142482421 17:227215-227237 CCAGCCGTGCCCACTTCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1142482429 17:227252-227274 TCTTTCCCCCTGCTCACTCTTGG 0: 1
1: 0
2: 5
3: 43
4: 327
1142482421_1142482430 18 Left 1142482421 17:227215-227237 CCAGCCGTGCCCACTTCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1142482430 17:227256-227278 TCCCCCTGCTCACTCTTGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 206
1142482421_1142482432 19 Left 1142482421 17:227215-227237 CCAGCCGTGCCCACTTCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1142482432 17:227257-227279 CCCCCTGCTCACTCTTGGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142482421 Original CRISPR CCCAGAGAAGTGGGCACGGC TGG (reversed) Intronic
900322810 1:2093471-2093493 TCCAGAGAAGTGGACACTGGGGG - Intronic
900934211 1:5755219-5755241 CCCAGGGAAGTGGGGATGGCTGG + Intergenic
900995672 1:6122024-6122046 CCCCGGGAGGTGGGCACAGCCGG + Intronic
901241303 1:7695306-7695328 CAGAGAGAAGAGGGCGCGGCAGG + Intronic
903515983 1:23911377-23911399 GCCAGGGAAGTGGGCAAGGCTGG + Intronic
904213075 1:28898446-28898468 CTCAGTGAAGTGGGAACAGCAGG + Intronic
904420514 1:30387985-30388007 CCCAGGGAAGTAGGCAAGGCTGG + Intergenic
904586625 1:31584386-31584408 CACAGAGAAGTGGCCAGGCCAGG - Intronic
905300821 1:36985260-36985282 GCCAGAGGAGGGGGCAAGGCAGG - Intronic
905923976 1:41736895-41736917 CCCAGAGAAGCTGACACGGTTGG + Intronic
906123198 1:43408919-43408941 CCGAGAGAAGTGGGCATGTGGGG + Intronic
906214653 1:44031599-44031621 GCCTGAGAAGTCGGCACGGGAGG - Intergenic
908110524 1:60893058-60893080 CCCAGAGAAATGGGCATGAGAGG - Intronic
908477638 1:64505545-64505567 CCCAGAGGAGGGGGCGGGGCGGG - Intronic
908843642 1:68302916-68302938 CTCAGAGAAGTGGGCTAAGCTGG + Intergenic
909606722 1:77515566-77515588 CCCAGAGAAGCTTGCAGGGCCGG + Intronic
910248794 1:85171906-85171928 CACAGAGAAGAGGGGAGGGCGGG + Intronic
910431105 1:87160507-87160529 CTCAGAGAAATGGGCATGGCAGG + Intronic
911092778 1:94030901-94030923 CCCAGTGAAGTGGGAAGGTCAGG + Intronic
914713407 1:150235173-150235195 CCCGGAGGAGTGGGCGCCGCCGG + Intronic
914921894 1:151852941-151852963 CCCACAGCAGTGGGCAGAGCTGG - Intronic
915001824 1:152600982-152601004 CCCAGAGCCATGGCCACGGCAGG - Exonic
916561327 1:165936166-165936188 CTCAGAGAAGTGGGCAAGCTGGG + Intergenic
919925043 1:202187787-202187809 CCCAGAGTTGTGGGCTGGGCAGG + Intergenic
920370019 1:205473012-205473034 GCCAGAGGAGAGGGCACAGCGGG + Intergenic
922009550 1:221568126-221568148 AGCAGAGAAATGGGCACTGCAGG - Intergenic
922686883 1:227646582-227646604 TCCAGAGGAGTGGGCATGCCTGG + Exonic
1062918891 10:1265209-1265231 CCCCGATAAGTGGGGAAGGCAGG - Intronic
1064034243 10:11902374-11902396 CCCAGCGATGTGGTCACTGCAGG - Intergenic
1065751860 10:28895106-28895128 CCCAGAGAACGGGGCAGGGGAGG - Intergenic
1067833572 10:49624101-49624123 GCCAGAGAGGTGGGCAGGCCAGG - Intronic
1069048130 10:63764506-63764528 TCCAGAGAAGAGGCCACGGTTGG - Intergenic
1069789753 10:71012080-71012102 CCCAGAGAAGAAGGCAAAGCAGG - Intergenic
1070161197 10:73867664-73867686 CCCAGAGAGGTGGGTACAGACGG + Intronic
1070866870 10:79712212-79712234 CCCAGAAAAGTGGGGACCCCAGG + Exonic
1070880660 10:79850333-79850355 CCCAGAAAAGTGGGGACCCCAGG + Exonic
1071633782 10:87234435-87234457 CCCAGAAAAGTGGGGACCCCAGG + Exonic
1071647230 10:87366651-87366673 CCCAGAAAAGTGGGGACCCCAGG + Exonic
1074098170 10:110331738-110331760 CCCACAGCAGGGGGCAGGGCAGG - Intergenic
1075721401 10:124589738-124589760 CCCAGAGATGCGGGAAAGGCGGG - Intronic
1076408050 10:130226489-130226511 CCCACAGAAGTGCTCACTGCTGG + Intergenic
1076849074 10:133084130-133084152 CGCAGAGCAGTGGGAAGGGCTGG + Intronic
1076859487 10:133133907-133133929 CCCAGAGGAGCCAGCACGGCGGG - Intergenic
1077198212 11:1291916-1291938 TCCAGAGATGTGGGCACAGGAGG - Intronic
1078064780 11:8071286-8071308 CCCAGGGAAGTGGGAGCGGGAGG + Intronic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1081298803 11:41425280-41425302 CCCAGAGAGGTGTGAAGGGCAGG + Intronic
1083196624 11:61092210-61092232 CCCAGTGAAGAGGGCACACCTGG + Intergenic
1083241696 11:61393196-61393218 CACAGAGAAGTGGGATGGGCCGG - Intronic
1083665168 11:64270163-64270185 CCCAGGGCAGTGGGAACGGGTGG + Exonic
1083853570 11:65381087-65381109 CCCAGAGGACTGGGGACAGCTGG + Intronic
1084169781 11:67395564-67395586 CCCAGAGAAGGTGGCAGGGAGGG - Intronic
1084863555 11:72038507-72038529 CCCAGAGAAGAGGGAATGGCTGG - Intronic
1085288587 11:75380895-75380917 CCCAGAGAACAGGGCAGGTCGGG + Intergenic
1085414744 11:76312530-76312552 GCCGGAGAGGTGGGCACAGCTGG + Intergenic
1085819695 11:79779454-79779476 CCCAGAGAAGTTGGGGAGGCAGG + Intergenic
1086925807 11:92639548-92639570 CCCAGCAAAGTGGGCAGGCCAGG - Intronic
1088383513 11:109222928-109222950 CCTGGAGAAGTGGCCATGGCAGG + Intergenic
1088752272 11:112854206-112854228 CCCAGAGCAGTGCCCACCGCAGG + Intergenic
1089208869 11:116787729-116787751 CCCAGCCAGGTGGGCCCGGCCGG - Intronic
1089367216 11:117928279-117928301 CCCAGAGCAGAGGGCAAGGGAGG + Intronic
1089391231 11:118103274-118103296 ACAAGAGAAGTGGGCCCAGCAGG + Intronic
1091982503 12:4877686-4877708 CCAAGAGAATTGGGCACACCAGG - Intergenic
1095987021 12:48005394-48005416 CCCCGGGGAGTGGGCACTGCCGG + Intergenic
1098425887 12:70365907-70365929 CCCCGGGAAGCGGGCACGGGTGG - Intergenic
1102422293 12:112813534-112813556 CCCAGGGAAGTGAACACAGCTGG + Intronic
1102960855 12:117092473-117092495 CCCAGAGAGGAGGGCAGGGGAGG + Intronic
1103719319 12:122965094-122965116 CCCAGGGAAGTGGGGAGGCCTGG - Intronic
1104730227 12:131101260-131101282 CCCAGGGCAGTGGGCCAGGCAGG + Intronic
1104763865 12:131313993-131314015 CCCAGAGAAGGCGGCAGGGAAGG + Intergenic
1104815630 12:131644063-131644085 CCCAGAGAAGGCGGCAGGGAGGG - Intergenic
1107464336 13:40635790-40635812 TCCCCAGAAGTGGGCAGGGCAGG - Intronic
1110549006 13:76790996-76791018 CCCAGAGCACTGGGAAGGGCTGG + Intergenic
1110612912 13:77508691-77508713 CCCAGAAAAGTTGGCACTGTGGG - Intergenic
1111624668 13:90769362-90769384 CTCAGAGGAGGGGGCACGTCAGG + Intergenic
1111996810 13:95173560-95173582 CCCAAAGAAGTGTGCATGGCTGG + Intronic
1113444740 13:110356544-110356566 CCCAGAGAGGTGGGCAGGAGTGG - Intronic
1115488355 14:33934692-33934714 AGCAGAGAAGTGGTAACGGCAGG - Intronic
1115953666 14:38750832-38750854 CCTGGAGAAGTGGGAACTGCAGG + Intergenic
1118381354 14:65220118-65220140 CCCACAGAACTGGGCGCAGCTGG - Intergenic
1122069457 14:99196208-99196230 CCCTGAGAAGAGGGCTTGGCTGG - Intronic
1122254117 14:100464139-100464161 GCTAGAGAAGTGAGCAAGGCTGG - Intronic
1122429417 14:101630438-101630460 CCCAGGGATGGGGGCACGGCTGG - Intergenic
1124636326 15:31367133-31367155 CCCAGAGAAGGGAGAACGGGTGG - Intronic
1125605210 15:40936381-40936403 GCCAGAGAAGCCGGCAGGGCAGG - Exonic
1127907246 15:63384894-63384916 CCAAGAGAAGAGGGCATGACAGG - Intergenic
1127974605 15:63987895-63987917 CCCTGGGAAGTGGGCAGGGCAGG - Intronic
1128587356 15:68861163-68861185 GCAAGAGAAGTGGGGACGGAAGG + Intronic
1132611013 16:816355-816377 CCCAGAGAAGAGGTCACGTAGGG + Intergenic
1132841787 16:1981571-1981593 TCCAGAGAGGTGGGCAGGACAGG - Exonic
1133018037 16:2953935-2953957 CCCAGAGGAATGGGCCCAGCTGG + Intergenic
1133050854 16:3116465-3116487 CCGGGAGGAGTGGGGACGGCTGG + Exonic
1133645316 16:7758876-7758898 CCCAGCAAAGTGGGCACGCCAGG - Intergenic
1134100284 16:11447110-11447132 GCCAGAGAAGTGGGCATGGCTGG + Intronic
1135597265 16:23754419-23754441 CCCAGAGTCACGGGCACGGCTGG + Intergenic
1136403350 16:30030225-30030247 CCCAGAACAGTGAGCAAGGCAGG + Intronic
1136514951 16:30762437-30762459 AGCAGAGATGTGGGAACGGCTGG - Exonic
1137009878 16:35311498-35311520 GCCTGAGAAGTGTGCAAGGCTGG - Intergenic
1139653919 16:68376223-68376245 CTCAGAGAGGTGGCCAAGGCAGG + Intronic
1141468192 16:84220985-84221007 CACAGAGACATGGGCAGGGCTGG - Exonic
1141887063 16:86899387-86899409 TGCAGAGAAGTGGGCATGACCGG + Intergenic
1142033392 16:87849587-87849609 CTCCCAGAAGTGGGCACGGAAGG - Intronic
1142482421 17:227215-227237 CCCAGAGAAGTGGGCACGGCTGG - Intronic
1142584571 17:963476-963498 CCCTGAGTAGTGGGAACTGCAGG - Intronic
1142961329 17:3554089-3554111 CCCTGGGAACTGGGCAGGGCTGG - Intronic
1143090891 17:4448626-4448648 CCCGGAGAAGGGGGCAAGGCTGG - Intronic
1143303721 17:5929687-5929709 CCAAGAGAAGTGAGCAGGGGAGG + Intronic
1143503595 17:7352203-7352225 CCCAGGGAAGGCGGCGCGGCCGG + Exonic
1143510046 17:7390309-7390331 CCCAGAGGAGGGGCCAGGGCAGG + Exonic
1143702906 17:8674821-8674843 CCCTGAGAAGTGGTCTCCGCTGG - Intergenic
1144707700 17:17380445-17380467 CCCAGAGGAGGGGGAAGGGCTGG - Intergenic
1145835647 17:27952481-27952503 CCCAGAGAAGTGTGCAGTGGGGG - Intergenic
1146271163 17:31486934-31486956 GGCAGAGAAGTGGGCAAAGCTGG + Intronic
1147134801 17:38428562-38428584 GCCAGGGAAGTGGGCGGGGCCGG + Intronic
1147567877 17:41548692-41548714 CCCGGTGAGGTGGGCAGGGCAGG - Intergenic
1148741048 17:49892884-49892906 CACAGGGAAGGGGGCAGGGCTGG + Intergenic
1151704121 17:75757822-75757844 CCCAGAAGAATGGGCAAGGCAGG - Intronic
1152148660 17:78585040-78585062 CCCAGGAGAGTGGGCAAGGCAGG - Intergenic
1152262391 17:79274127-79274149 CCCAGACAGGTGGACACTGCTGG - Intronic
1152468309 17:80477542-80477564 GCCTGAGAAGTGGGCGCGGCTGG - Intronic
1152468945 17:80480380-80480402 CCCAGAGTAGTTGGGACTGCAGG - Intergenic
1152632070 17:81414823-81414845 ATCAGGGGAGTGGGCACGGCTGG - Intronic
1152896493 17:82914334-82914356 CCCAGAGCAGAGGGCAGGGTGGG - Intronic
1154317790 18:13319248-13319270 CCCTCTGAAGTGGCCACGGCGGG + Intronic
1156016934 18:32557036-32557058 CTGAGAAAAGTGGGCACGGTTGG + Intergenic
1157422794 18:47560318-47560340 TCCAGAGAAGTGGGGATGCCAGG + Intergenic
1158392277 18:57053216-57053238 CTGAGAGAAGTGGGGATGGCTGG - Intergenic
1160063104 18:75550039-75550061 CCCAGAGAGGTGTGCAAGGGAGG + Intergenic
1160447155 18:78936717-78936739 GCCAGGGAGGTGGGCAGGGCAGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160597674 18:79988440-79988462 CCCAGCGAGGTGGGCTCAGCCGG + Exonic
1160984808 19:1833654-1833676 CCCAGTGAAGTGGGCCGGGAGGG - Intronic
1161119592 19:2518106-2518128 CCCAGCGCAGTGGGCATGGGGGG - Intronic
1161188528 19:2939347-2939369 CCCAGAAGAGTGGGCATTGCTGG - Exonic
1161377997 19:3950083-3950105 CCCAGGGGAGCGGGCAGGGCAGG - Intergenic
1163183766 19:15622193-15622215 GCCAGAGAAGGGAGCAGGGCTGG - Intronic
1163229749 19:15993217-15993239 GCCAGAGAAGGGGACACAGCTGG + Intergenic
1163279571 19:16307258-16307280 CCCAGGGAACTCGGGACGGCGGG - Intergenic
1165388495 19:35525423-35525445 AGCAGAGGAGCGGGCACGGCAGG - Intronic
1165704558 19:37966523-37966545 CAGAGGGAGGTGGGCACGGCAGG - Intronic
1165906833 19:39199388-39199410 GCCAGGGAGGTGGGCAGGGCAGG - Intronic
1166385157 19:42376551-42376573 CCCACAGAAGATGGCATGGCTGG + Exonic
1167063454 19:47166260-47166282 GGAAGAGAAGTGGGCACGGATGG + Intronic
1167377084 19:49118108-49118130 CCCAGAGGAGGGGCCAGGGCTGG - Intronic
1167455374 19:49594924-49594946 CCCAGTGAAGAGGGCACCGTGGG - Exonic
1167683381 19:50940155-50940177 TCCATAGCAGTGGGCAGGGCAGG - Intergenic
1167895701 19:52579040-52579062 CTGAAAGAAATGGGCACGGCGGG - Intronic
1168287233 19:55340847-55340869 CGCACAGCGGTGGGCACGGCAGG - Intronic
1168667674 19:58216968-58216990 CCCAGAGTTGTGGGCTCGGCTGG - Intergenic
926048223 2:9725789-9725811 CCCAGGCAAGTGGGGACAGCAGG - Intergenic
927482811 2:23467913-23467935 GCCAAAGAAGTGGGCACGGAGGG - Intronic
927812504 2:26187796-26187818 CCCAGAGCAGTGGGGACACCTGG + Exonic
927853311 2:26513320-26513342 CCCAGAGAAGCAGGCCAGGCAGG + Intronic
929591806 2:43152730-43152752 CCCTCAGAAGTGGGCCAGGCAGG - Intergenic
929735928 2:44549247-44549269 CCCAAAGAAGTGGACAGAGCTGG - Intronic
930574332 2:53127536-53127558 GCCAGAGAAGTGGGGAAAGCTGG + Intergenic
931878971 2:66546359-66546381 ATCTGAGAAGTGGGCAAGGCTGG + Intronic
934563589 2:95325550-95325572 CCCAGAGCAGGGGGCAGGTCAGG + Intronic
935782125 2:106517587-106517609 CCCAGAGAACTGGGGAAGGGAGG - Intergenic
936111222 2:109666871-109666893 ACCATAGAAATGGGCACGGTTGG + Intergenic
936576824 2:113664167-113664189 GCCAGAACAGTGGGCGCGGCAGG - Intergenic
936950544 2:117973691-117973713 TACAGAAAAGTGGGCACTGCAGG + Intronic
938116669 2:128607064-128607086 CCAAGAGAAGTGGGAGCTGCTGG - Intergenic
938603364 2:132865958-132865980 GCTAGAGAAGTGGACACGGATGG + Intronic
941905183 2:170713059-170713081 CCCAGGGAGGCGGGCAGGGCCGG - Exonic
943748804 2:191490081-191490103 ACCAGAGAAGTGGGCAGGTTTGG - Intergenic
944412043 2:199455935-199455957 CCCAGTGAAGGTGGCCCGGCTGG - Exonic
948081413 2:235208105-235208127 CCCAGAGGAGTGGCCAGGGTGGG - Intergenic
948147202 2:235716686-235716708 CCCAGAGAAGGCGGCATGGGGGG + Intronic
948296284 2:236863051-236863073 CCCTGAGAAGAAGGCAGGGCAGG - Intergenic
948609170 2:239155884-239155906 CCCAGAGAATTGGTGAGGGCAGG - Intronic
1169072206 20:2739478-2739500 GACAGAGTGGTGGGCACGGCAGG - Intronic
1169250532 20:4057496-4057518 GCCAGAGAGGTTGGCACAGCTGG - Intergenic
1169997149 20:11571231-11571253 CCCAGACAAGTGAGAACAGCAGG - Intergenic
1170805270 20:19624329-19624351 CCCAGATAAGTGGGCATCTCAGG - Intronic
1173901727 20:46595463-46595485 CCCAGTGGAGTGGGCTCTGCTGG - Intronic
1173911646 20:46675071-46675093 CCCTGAGATGTGCGCAAGGCTGG + Intronic
1176080047 20:63267903-63267925 CCCAGACAACGGGGCAGGGCAGG + Intronic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1177028644 21:15954327-15954349 CCCATGGAAGTGGGCCCTGCAGG + Intergenic
1178282829 21:31298166-31298188 CGGAGTGAAGTGGGCACTGCAGG - Intronic
1179503427 21:41824020-41824042 CACAGAGCAGTGGACAAGGCTGG + Intronic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1180096937 21:45560166-45560188 CCCTGAGAGGTGGGGACGCCAGG + Intergenic
1180742166 22:18061305-18061327 CCCAGAGGAGAGGGCAGGGTGGG + Intergenic
1180871564 22:19149862-19149884 CCCAGAGACAAGGGCACCGCCGG + Exonic
1180959350 22:19755609-19755631 CCCAGAGAAGGGCGGGCGGCTGG - Intergenic
1181116830 22:20636656-20636678 CCCTGAGAAGTGGGCCCATCTGG - Intergenic
1181465135 22:23106862-23106884 CCCAGGGGAATGGGCAGGGCTGG + Intronic
1181594626 22:23906360-23906382 CCCAGATTAGAGGGCACTGCTGG - Intergenic
1182305301 22:29363771-29363793 TCCAGAGTAGCTGGCACGGCAGG - Intronic
1182382540 22:29904254-29904276 CCTTGTGAAGTAGGCACGGCAGG + Intronic
1182430533 22:30296206-30296228 CTCAGAGAAGTGGGAACAGCTGG - Intronic
1183314083 22:37127718-37127740 CCCAGGGAAGAGGTCAGGGCAGG + Exonic
1183409514 22:37646767-37646789 CACAGAGGGGTGGGCAGGGCAGG - Intronic
1183903747 22:41024379-41024401 CTCAGAGAAGAGAGCAGGGCTGG + Intergenic
1183936840 22:41267489-41267511 CCAAGGGAAGAGGGCAGGGCTGG - Intronic
1185117292 22:48945080-48945102 GCCAGAGCAGGAGGCACGGCAGG + Intergenic
1185421252 22:50735526-50735548 GGGACAGAAGTGGGCACGGCTGG + Intergenic
950257872 3:11520869-11520891 CCCTGAGAAGTAGGCACAGTTGG + Intronic
953407673 3:42667512-42667534 CCCAGAGCATGGGGCACAGCAGG + Intergenic
953636874 3:44671516-44671538 CCCAGTGAAGCTGGCAGGGCAGG - Intergenic
953842875 3:46403844-46403866 CACTGAGGAGTGGGCACTGCAGG + Intergenic
961315309 3:126031440-126031462 TTCAGGGAAGTGGGCAGGGCTGG + Intronic
961370303 3:126424518-126424540 CCAGGAGAACTGGGCAGGGCAGG + Intronic
961384851 3:126517650-126517672 CCCAGAGAACCGGGGACGCCAGG - Exonic
961424277 3:126832766-126832788 CCCAGAGAAAGGGGGAGGGCTGG + Intronic
961649745 3:128411382-128411404 CCCAGGGGTGTGGGCAGGGCAGG + Intergenic
961651852 3:128420845-128420867 CCCAGAGGAGGGGGCACAGTGGG - Intergenic
961930676 3:130529693-130529715 CCCAGAGAAGGGGCCCCTGCTGG + Intergenic
962390192 3:134965383-134965405 CTTAGAGAAGTGGGCAGGGTAGG - Intronic
964313037 3:155414471-155414493 CCCAGAGGAATGGGCCCGGAAGG + Intronic
967085837 3:186094208-186094230 CCAAAAGAAGTGGTCACGGATGG + Intronic
968576521 4:1368822-1368844 TCCAGGGAAGTGTGCACAGCTGG + Intronic
968909853 4:3472165-3472187 CCCGGGGAGGTGGGCACGGCTGG + Intronic
969317815 4:6392658-6392680 CTCAGAGAGGTGGGCTGGGCCGG + Intronic
974930234 4:68352686-68352708 CCCAGAGAAGTTGGGACTACAGG - Intergenic
978676529 4:111325647-111325669 ACCAGGGAAGAGGGCATGGCAGG - Intergenic
979268093 4:118726693-118726715 CACAGAGAACTGTGCAGGGCAGG + Intronic
979532968 4:121788552-121788574 CCCAGAGAAGAGGTCTGGGCTGG + Intergenic
982198048 4:152936025-152936047 CCGAGAGAAGTAGGGGCGGCAGG - Intergenic
985548903 5:523532-523554 ACCAGTAATGTGGGCACGGCAGG - Intronic
985872727 5:2570116-2570138 CTCGGAGAAGAGGCCACGGCTGG - Intergenic
991288326 5:65005490-65005512 CCCATAGCAATGGGCAGGGCAGG + Intronic
997345606 5:133189802-133189824 CCCAGAGACAGGGGCAGGGCAGG - Intergenic
998202652 5:140137504-140137526 CTCAGAGATGGGGGCAGGGCTGG + Intergenic
999237811 5:150109470-150109492 CCCAGAGGACTTGGCAAGGCAGG - Intronic
999518171 5:152321811-152321833 TCCAGAGATGTGGACATGGCTGG + Intergenic
999758115 5:154680319-154680341 CCCAGAGCTGTGGACACTGCTGG - Intergenic
1000654214 5:163856550-163856572 CCAACAGAAGTGGGCTTGGCTGG - Intergenic
1001987423 5:176086491-176086513 CCCAGAGAGATGGGCAGAGCAGG - Intronic
1002229447 5:177751651-177751673 CCCAGAGAGATGGGCAGAGCAGG + Intronic
1002265898 5:178032122-178032144 CCCAGAGAGATGGGCAGAGCAGG - Intronic
1002457997 5:179356585-179356607 CAGAGACAAGGGGGCACGGCAGG - Intergenic
1004533527 6:16477236-16477258 CACAGAGAAGTGGCCATGGAGGG + Intronic
1006410827 6:33872372-33872394 CACAGAGCAGTGGGCCCCGCAGG + Intergenic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1007285693 6:40745893-40745915 CCCAGAGATGTTGGCTCAGCTGG + Intergenic
1017744493 6:157434717-157434739 CCCAGAGAGCTTGGCACGACGGG + Intronic
1019163900 6:170086877-170086899 CCCAGAGGAGGGGGCATGGCGGG - Intergenic
1019266290 7:119232-119254 CGAAGGGAAGTGGGAACGGCGGG + Intergenic
1020181316 7:5924678-5924700 CCCCGTGCAGTGGGCAAGGCTGG - Intronic
1020301617 7:6800212-6800234 CCCCGTGCAGTGGGCAAGGCTGG + Intronic
1020887891 7:13842263-13842285 CCCAGAGAAGTGGACTGGGCAGG - Intergenic
1021996131 7:26179773-26179795 CCCAGAGAAATCAGCAGGGCAGG - Intronic
1022970509 7:35512926-35512948 CCCAGAAAAGGAGGCAGGGCTGG - Intergenic
1024640041 7:51320998-51321020 CCCAGGGAAGTGGAGACTGCTGG + Intergenic
1024800336 7:53070099-53070121 CCGAGAGATGTGGGCCCTGCAGG + Intergenic
1029114958 7:98232035-98232057 CCCAGAGGAGGAGGCAGGGCTGG + Intronic
1032159651 7:129500951-129500973 CCCAGAGAAGTGTAAGCGGCTGG + Intergenic
1032268610 7:130384884-130384906 CACAGAGACGTGGCCAAGGCGGG - Intronic
1034934154 7:155187756-155187778 CCCAAAGCAGAGGGCACAGCAGG - Intergenic
1038446713 8:27609681-27609703 CTCTGCGAAGTGGGCACGGCGGG - Intronic
1038483123 8:27915220-27915242 CCCTGAGAAGTGGACAAGGCAGG + Intronic
1039880374 8:41621820-41621842 CCCACAAAACGGGGCACGGCAGG + Exonic
1039944735 8:42119582-42119604 CCCAGAGCAGAGGTCAGGGCAGG + Intergenic
1041919648 8:63168139-63168161 CCCAAAGCCGTGGGGACGGCTGG - Intergenic
1048452050 8:134542060-134542082 GTCAGAGAAGTGGGCAAGTCTGG - Intronic
1049049743 8:140185288-140185310 GTCAGAGAACTCGGCACGGCAGG + Intronic
1049269593 8:141687231-141687253 CCCTGAGAATTGGGGAGGGCAGG - Intergenic
1049284105 8:141765290-141765312 CACAGAGAAGAGGGCATGCCTGG - Intergenic
1049353523 8:142176776-142176798 AGCAGAGAAGAGGGCCCGGCAGG - Intergenic
1049656263 8:143799631-143799653 CCCCGAGAAGCAGGCACTGCGGG + Intronic
1051094859 9:13455157-13455179 CCCAGAGAAATCAGCACAGCTGG + Intergenic
1051171004 9:14317353-14317375 CCCAGAGAAGTGAAGACGTCTGG + Intronic
1053347338 9:37387623-37387645 CCCAGAGCAGAGGGCTCAGCGGG - Intergenic
1055483982 9:76739001-76739023 CCCTGTGAAGTGGGCAGAGCTGG + Intronic
1056186841 9:84143428-84143450 CCCAGGGAAGTGGGCCCTGGTGG - Intergenic
1057239993 9:93399789-93399811 CCCAGTGAAGTGGGTACCCCAGG - Intergenic
1058005086 9:99906234-99906256 CCCTGTGAAGTGGACAGGGCAGG - Intergenic
1058835392 9:108855253-108855275 CCCAGCGTAGTCGGCGCGGCTGG + Exonic
1060664215 9:125423333-125423355 CCCAGAGCAGTGGGGGCTGCTGG + Intergenic
1061047801 9:128176516-128176538 CCCAGAACAGTGGGCAAGGCTGG + Intronic
1061300795 9:129703889-129703911 CCCAGAGCCAGGGGCACGGCAGG + Intronic
1062216650 9:135393042-135393064 CCCAGAGCAGTGGGCAGGAGGGG - Intergenic
1062451320 9:136616953-136616975 CCCAGAGAAGTGGGTTCTCCAGG + Intergenic
1062569771 9:137179700-137179722 CCTGGAGAAGGGGGCAGGGCTGG + Intronic
1062726670 9:138078024-138078046 CCCAAAGGAGTGGGCACGCTTGG + Intronic
1186410230 X:9340383-9340405 CCCAGGGAAGTGGGCGGGGTGGG - Intergenic
1189763208 X:44343616-44343638 CCCAGAAGAGAGGGCCCGGCAGG + Exonic
1196505584 X:116437084-116437106 CCCAGAGAAGTGAGCAGGTTGGG + Intronic
1200061852 X:153487313-153487335 CCCAAAGAGGTGGGCTTGGCTGG + Intronic