ID: 1142482839

View in Genome Browser
Species Human (GRCh38)
Location 17:229374-229396
Sequence CTGAAAATGCTCCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142482839 Original CRISPR CTGAAAATGCTCCCCAGGAC AGG Intronic
900530025 1:3148536-3148558 CTGACGCTGCTCCCCAGGGCTGG - Intronic
905295817 1:36953839-36953861 CTGAAGAAGCTCCCCTGGAGGGG + Intronic
905340837 1:37276197-37276219 CTGCAAATCCTCCCCATGTCTGG - Intergenic
906156299 1:43615963-43615985 CTGCACATGCTCCCCACGACTGG - Intronic
907588889 1:55646860-55646882 CTGACCATGCACCCCAGGAGGGG + Intergenic
915632737 1:157164415-157164437 CTGAAAATCCTCCCCAGGGCTGG - Intergenic
916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG + Intergenic
920442916 1:205993359-205993381 CTGAAAATCCCCCCCAAGCCCGG - Intronic
922768872 1:228171291-228171313 CTGAGAAAGCTCCCCAGGCCGGG + Intronic
922938454 1:229439050-229439072 CTAAAAAGGCTCCTCAGGAGGGG + Intergenic
922987443 1:229876975-229876997 CTGAGAGTGGTGCCCAGGACAGG + Intergenic
923006640 1:230055167-230055189 CTGCAGATTCTCCCCAAGACGGG - Intergenic
924552115 1:245088712-245088734 CGGAGAAGGCTTCCCAGGACAGG + Intronic
1066109840 10:32186083-32186105 CTGTTAATGCCCCGCAGGACTGG - Intergenic
1069011171 10:63374659-63374681 CTTATAATGCTCCCTAGAACTGG + Intronic
1069401619 10:68053584-68053606 TTTAAAATGGTCCCCAGGCCGGG - Intronic
1069848901 10:71392388-71392410 CTGAAAATACAACCCAGGTCAGG + Intergenic
1072501696 10:96024141-96024163 CAGAAAATCCTGCCCAGGAAGGG + Intronic
1072808596 10:98443008-98443030 CTGCTCATGCTGCCCAGGACAGG + Intronic
1074853656 10:117457885-117457907 CTGAATCAGCTCCCCAGGCCTGG + Intergenic
1079972083 11:27047479-27047501 TAGAAAATGCACCCCTGGACTGG + Intronic
1080353620 11:31415010-31415032 TGGAAAATGCTCCCCAGGAATGG - Intronic
1081897046 11:46595689-46595711 TTGAAAATACTGCCCAGGCCGGG + Intergenic
1085560635 11:77470451-77470473 CTGAACATCCTGCCCAGCACAGG + Intronic
1087407686 11:97750467-97750489 CTGATATTGCTCCACAGGATAGG + Intergenic
1088488988 11:110368744-110368766 TTGAATATGCTCCCCAGGGCCGG - Intergenic
1088671279 11:112144002-112144024 CTGAATATGCATCCCATGACAGG - Intronic
1088881110 11:113974129-113974151 TTGAAAATGCTTCCGAGGCCAGG + Intergenic
1090006254 11:123005220-123005242 CTGCAAATGCCCCCCAGGAAGGG + Intergenic
1092150454 12:6244699-6244721 GAGAAAATGCTCCCCATGAGTGG + Intergenic
1092293094 12:7176455-7176477 TTGAAAAGGCTCCCATGGACAGG + Intergenic
1092942166 12:13420080-13420102 CTGAAGATGCTGCCCATGGCTGG + Intergenic
1096998755 12:55858130-55858152 ATGAAAATGCTTTCCAGGCCAGG + Intergenic
1099474717 12:83094309-83094331 GTGGAAATGCTCCCCAGAGCAGG - Intronic
1099831206 12:87845000-87845022 CAGGGATTGCTCCCCAGGACAGG + Intergenic
1100615725 12:96230467-96230489 AGGAAACTGCTCCCCATGACAGG + Intronic
1101587158 12:106094977-106094999 CTAGAAATGCTCCCCAGGGATGG - Intronic
1103370869 12:120418308-120418330 CTCAAAGTGTGCCCCAGGACTGG - Intergenic
1106381211 13:29241504-29241526 CTGAAAAAGCTTCCCAGGAGAGG - Intronic
1109286367 13:60413109-60413131 GTGAAAATGCTGCCAAGGAATGG + Intronic
1110603876 13:77408874-77408896 CTAAAAATGGTACCCAGTACTGG - Intergenic
1112327758 13:98454626-98454648 CTGAAAATGCTTCAGAGGAGAGG + Intronic
1115271374 14:31557176-31557198 CTGGAAATGCAGACCAGGACTGG + Intronic
1117271429 14:54147413-54147435 CTGAAGACACTCCCCAGTACTGG + Intergenic
1118180080 14:63483787-63483809 CTCAAAAAGCTCCCGAGGCCAGG + Intronic
1118417753 14:65561558-65561580 CTGAAAATGCGGCCATGGACTGG + Exonic
1118753414 14:68822257-68822279 CTGAAAGTGCCACCAAGGACCGG + Intergenic
1119162404 14:72463670-72463692 TTGACAATGCTGCCCTGGACAGG - Intronic
1119855096 14:77893673-77893695 CTGAAAATGCTGCTCAGAAAAGG - Intronic
1121052700 14:90829929-90829951 CTGGACATCCTCCGCAGGACTGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121257055 14:92538914-92538936 CAGACAATGCTCCCCTGTACAGG + Intronic
1123462441 15:20485565-20485587 CAGAAAAGGCTTCCCAGAACAGG + Intergenic
1123655619 15:22514839-22514861 CAGAAAAGGCTTCCCAGAACAGG - Intergenic
1124273130 15:28301535-28301557 CAGAAAAGGCTTCCCAGAACAGG + Intronic
1124309527 15:28610034-28610056 CAGAAAAGGCTTCCCAGAACAGG - Intergenic
1126189463 15:45864693-45864715 CAGAAAATGCAGCTCAGGACTGG - Intergenic
1127264952 15:57353649-57353671 CTGAAAATGCTTCCGAGCACCGG - Intergenic
1127764374 15:62170624-62170646 CTGAAAATTCTCTCCAGTAGTGG - Intergenic
1129721817 15:77881725-77881747 CTGGGAGTGCTGCCCAGGACGGG + Intergenic
1130056866 15:80533552-80533574 CTGAAAATGCCCCTCAGAGCAGG - Intronic
1138415050 16:56866901-56866923 TTTAAAATGCTCCCTAGGCCAGG - Intronic
1138533743 16:57648892-57648914 CCAAAAATGCTCCCGAGGCCAGG - Intronic
1138580807 16:57939482-57939504 CTGAAAAGGAGCCCCAGGACTGG - Exonic
1139687605 16:68616573-68616595 CAGAAACTGTTCCCCAGGGCAGG + Intergenic
1141010709 16:80395799-80395821 CTGGAAATGCTGCTCAGGGCTGG + Intergenic
1141480498 16:84303261-84303283 ATAAAAATGCACCCCAGCACTGG - Intronic
1141921372 16:87137852-87137874 GTAAAAATGCTACCCAGGAAAGG + Intronic
1142482839 17:229374-229396 CTGAAAATGCTCCCCAGGACAGG + Intronic
1142992128 17:3738462-3738484 CTTAGAATGCCCCCCAGGCCGGG - Intronic
1144729960 17:17520538-17520560 GTGAAAATGCTCCCTGGGGCCGG + Intronic
1149672119 17:58423772-58423794 CTAAAAATGCTCCCTGGGCCGGG - Intronic
1149753293 17:59166291-59166313 CTGAAAATGATCTCAAGGCCTGG - Intronic
1150823060 17:68451087-68451109 CTGAAAGTGCTCCCTGGGAGAGG - Intronic
1151304231 17:73252783-73252805 ATGAAAAAGCTCCCTAGGAAGGG + Intronic
1152008667 17:77697560-77697582 CTGCAGTTGCTCCCCATGACGGG - Intergenic
1156242077 18:35264369-35264391 CTGAAAAGGCTGCCCAGGTGAGG + Exonic
1160739564 19:679759-679781 CTGGAATCGCTCCCCAGGCCAGG + Intronic
1161117576 19:2507203-2507225 CTGAAAATGCTGCCCAGTTCTGG + Intergenic
1161819763 19:6522599-6522621 CTGAACATGCCCCCCAGGGAAGG - Intergenic
1162233315 19:9284734-9284756 CAGAAAATGCTGCCCAGGTGTGG - Intergenic
1163256179 19:16157354-16157376 CTCAAAATGCTCCCCGAGAGAGG + Exonic
1163753789 19:19094479-19094501 CTGAACATGCCCTCCATGACTGG + Intronic
1163893804 19:20039722-20039744 ATGCAAATGTTCCCCAGGAAGGG - Intergenic
1164616009 19:29667116-29667138 CTTGAGCTGCTCCCCAGGACCGG + Intronic
1165844590 19:38810001-38810023 TTGAAATTACTCCCCAGGACAGG + Intronic
924976940 2:186368-186390 CTTAGAATTCTTCCCAGGACGGG - Intergenic
929943375 2:46352049-46352071 CTTGTTATGCTCCCCAGGACGGG + Intronic
933750812 2:85601300-85601322 CTGAAATTGGTCCCCAGGCATGG - Intronic
933806543 2:86002472-86002494 CTGATAATGCTGCCCAGGCGTGG - Intergenic
935085208 2:99838157-99838179 CTTAAAATGCTCCCCAGAGTCGG - Intronic
936372347 2:111912675-111912697 CTGAGAATACTCCTCAGGGCAGG + Intronic
937790568 2:125956734-125956756 CTGAAAATAATCCCAATGACGGG - Intergenic
938617342 2:133012995-133013017 GTGAGAATGCTGCCCAGGGCTGG - Intronic
939125794 2:138176036-138176058 ATAAAAATGGTCCCCAGGAGAGG + Intergenic
939312000 2:140492289-140492311 CTGAAAATACACCACAGGAATGG + Intronic
942519758 2:176791085-176791107 CTGCAACTGATCCCCTGGACTGG - Intergenic
946127773 2:217579217-217579239 CTGAGAATGCTCCCCACTTCTGG + Intronic
946277785 2:218643943-218643965 CTGAATCTGCACTCCAGGACTGG - Exonic
946378692 2:219330191-219330213 CTCAAAGTGCACCCCTGGACTGG - Intronic
948525677 2:238569518-238569540 GTGAAAGTGCTCCCCAGGTGAGG + Intergenic
1174060322 20:47827841-47827863 CTTTAAATTCTCCCCAGAACGGG + Intergenic
1174071576 20:47903529-47903551 CTTTAAATTCTCCCCAGAACGGG - Intergenic
1174152473 20:48495106-48495128 CTTTAAATTCTCCCCAGAACGGG + Intergenic
1174365327 20:50053205-50053227 CTCCAAATGCTCCCCAGCCCCGG + Intergenic
1174579617 20:51562474-51562496 CTGAAAGTGCTGCCCGGGACGGG + Intronic
1175146259 20:56898525-56898547 CTGAAAATGACCAGCAGGACGGG - Intergenic
1176231344 20:64034560-64034582 CTGCAGCTGCTCCTCAGGACGGG - Intronic
1179469727 21:41602598-41602620 GTGAAAATGATCCCCGGGGCTGG + Intergenic
1179970086 21:44831553-44831575 GTGAAAATGCTCTTCAGGAAAGG + Intergenic
1181768714 22:25110840-25110862 CTGAGCCTGCTGCCCAGGACAGG + Intronic
1183186552 22:36294842-36294864 CTGCAACTGCTCTGCAGGACTGG + Intronic
1183232147 22:36589659-36589681 CTCAAAATGGTCCCATGGACAGG + Intronic
1183310044 22:37104662-37104684 TTTAAAATGCACCCCAGGGCCGG + Intronic
1184832333 22:46996665-46996687 CTGAAAATGCCCCCGACCACCGG + Intronic
1185138970 22:49089647-49089669 CTGAAAACGCACCCCAGGGGAGG - Intergenic
957714950 3:83916120-83916142 CTGAGATTCCTCCCAAGGACAGG + Intergenic
958192093 3:90196413-90196435 CAAAAAATGCTCCCCATCACTGG - Intergenic
959035774 3:101361812-101361834 CTGGAAATGTTCTCCATGACAGG + Exonic
964689644 3:159436082-159436104 CTGAAAATGCTCTACAGGTGTGG + Intronic
967823790 3:193862497-193862519 CAGAGAATGCTCCCCAGAAAAGG - Intergenic
968437692 4:602602-602624 CTGAACATGGCCCCCAGGGCTGG - Intergenic
973118771 4:46491934-46491956 TTGAAACTGTTCCCCAGGACAGG + Intergenic
974781162 4:66555363-66555385 CTAAAAATGCTCCCCTGCCCTGG - Intergenic
978435942 4:108684654-108684676 CTGAAAATGCTGACCAGGTGTGG - Intergenic
979462215 4:120996810-120996832 CAGAAAATGCTCACCATCACTGG - Intergenic
980971972 4:139575444-139575466 CTGAAAGTGCTCCCAAGGCGAGG + Intronic
982321964 4:154086303-154086325 CAGAAACTGCTCCCCAGTACAGG - Intergenic
983905611 4:173178579-173178601 CTGAAAATGCTTCCAAGGCTGGG - Intronic
985850780 5:2387704-2387726 CTGTAAATGTTCTCGAGGACAGG - Intergenic
988019143 5:25600755-25600777 AAAAAAATGCTCCCCAAGACTGG + Intergenic
988259184 5:28861676-28861698 CTGAAAATGATCCTTAGAACTGG + Intergenic
993582435 5:89678590-89678612 CTGGAAATCCTCCCCAAGAAGGG + Intergenic
994268691 5:97750442-97750464 CTGTAAATGCTGCCAAGGACAGG + Intergenic
994314828 5:98320681-98320703 CTAATACTGATCCCCAGGACTGG - Intergenic
995526198 5:113052542-113052564 CTCAAGAAGCTCCCAAGGACAGG + Intronic
998092220 5:139378233-139378255 CAGAACATGCCCCCCAGGATGGG + Exonic
1000995405 5:167953408-167953430 TTGAAAATGATCTCCAGGTCTGG + Intronic
1001816466 5:174673338-174673360 CTGATAATACTCTCCAGGCCAGG + Intergenic
1002550468 5:179986373-179986395 CTGGAAATGCTCCCAAGAAGCGG - Intronic
1003974958 6:11333665-11333687 CTGAGAATGCTCACCAGGTGTGG + Intronic
1005532253 6:26719897-26719919 CTCTATATGCCCCCCAGGACTGG - Intergenic
1005538542 6:26781768-26781790 CTCTATATGCCCCCCAGGACTGG + Intergenic
1007385553 6:41518087-41518109 CTGGAAATGCTCCCCAGCTCAGG + Intergenic
1007530233 6:42535692-42535714 CTGAACTTGCTCCTCAGCACAGG - Intergenic
1014960862 6:127682617-127682639 CTGTACATTCTCCCCAGAACAGG + Intergenic
1018034902 6:159873627-159873649 CTGAAAGTCTTCCCCAGGAAGGG + Intergenic
1019425084 7:971172-971194 CTAAAACTAATCCCCAGGACAGG + Intronic
1019560855 7:1656315-1656337 CTCATCATGCTCCCCAGGGCAGG - Intergenic
1020090114 7:5334007-5334029 ATGGCACTGCTCCCCAGGACAGG + Intronic
1020675352 7:11177716-11177738 CAGAAATTGTTCCCCAGGAAAGG - Intergenic
1021581574 7:22159811-22159833 TTTAAAATGCTCCACAGGCCGGG + Intronic
1022985509 7:35650293-35650315 CTGGAAAGGCTCCCCAGTGCAGG + Intronic
1024120375 7:46231183-46231205 CTGAAAATGCAACCAAGGAAAGG - Intergenic
1025212354 7:57027162-57027184 CTGACCATGTTCCTCAGGACTGG + Intergenic
1025234614 7:57226189-57226211 CTTTAAATTCTCCCCAGAACGGG - Intergenic
1025659602 7:63549665-63549687 CTGACCATGTTCCTCAGGACTGG - Intergenic
1028156592 7:87436680-87436702 CTGATTCTGCTCCCCAGGAGTGG - Intronic
1029162591 7:98563277-98563299 CTGCAGATGCTCCCCAAGCCAGG - Intergenic
1034434395 7:151056406-151056428 GTGAAAATGCTCACTAAGACTGG + Intronic
1037715950 8:21400475-21400497 CAAAAAATGCTCCCCAGGCCTGG + Intergenic
1040416890 8:47203275-47203297 AAGAAAATGCTCCCAAGGATGGG - Intergenic
1042686462 8:71446486-71446508 ATGAAGATACTACCCAGGACTGG - Intronic
1043074614 8:75682749-75682771 CTGCAAATGCTGCCTGGGACAGG + Intergenic
1043874032 8:85464429-85464451 GTTAAAATGATCCCCAGGTCGGG - Intronic
1044282395 8:90371292-90371314 ATGAAGATGCCTCCCAGGACAGG - Intergenic
1047042829 8:121016995-121017017 ATGAAAATTCTGCCCAGGCCTGG + Intergenic
1048629081 8:136221126-136221148 TTTAAAATGTTCCCCAGGCCGGG + Intergenic
1048666345 8:136665618-136665640 CTGAAGATGCTCCAGAGGATGGG - Intergenic
1055628013 9:78194473-78194495 CTGAAAATCCTACACAGAACAGG - Intergenic
1056104768 9:83336370-83336392 TTCCAAATGCTCCCCAGGATAGG + Intronic
1061277448 9:129577450-129577472 CTGGAAAGGCTCCCAAGGGCTGG + Intergenic
1061311111 9:129763231-129763253 CTGATAATGCTCCACAGTACAGG - Intergenic
1061905591 9:133695044-133695066 GTGAAAGTCCTCACCAGGACTGG + Intronic
1061959771 9:133982095-133982117 CAGGAAAGGCTTCCCAGGACAGG + Intronic
1062186018 9:135218965-135218987 CTGGAAAAGCTCCCCAGCCCAGG + Intergenic
1186828822 X:13369407-13369429 CTGGAAATGCTCCTGAAGACTGG - Intergenic
1186942881 X:14529867-14529889 CTGACCATGATGCCCAGGACTGG + Exonic
1190981780 X:55462955-55462977 CTGTAACTGCTCCTCAGGGCTGG - Intergenic
1190986918 X:55510225-55510247 CTGTAACTGCTCCTCAGGGCTGG + Intergenic