ID: 1142482926

View in Genome Browser
Species Human (GRCh38)
Location 17:229688-229710
Sequence GCCATGGATGAGTGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142482911_1142482926 28 Left 1142482911 17:229637-229659 CCTGGCAAAAAACAGCTGAATGG 0: 1
1: 0
2: 1
3: 29
4: 167
Right 1142482926 17:229688-229710 GCCATGGATGAGTGGGTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142482926 Original CRISPR GCCATGGATGAGTGGGTCCT GGG Intronic
900285812 1:1899786-1899808 GCCATGGCTGGGTGGCCCCTTGG + Intergenic
901044153 1:6385571-6385593 GCCAGGGATGTGTGGGGCCCCGG - Exonic
902061749 1:13649789-13649811 GCAAAGTATGAGTTGGTCCTGGG - Intergenic
903817593 1:26076065-26076087 GCCATGAGTGAGTAGGTCCTGGG - Intergenic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
904419970 1:30385133-30385155 CCCAGGAATGAGGGGGTCCTGGG - Intergenic
904626936 1:31811694-31811716 GACAGGGCTGAGTGGGGCCTGGG - Intronic
904991665 1:34598262-34598284 CCCATGGACTAGTGGATCCTGGG + Intergenic
905274257 1:36806917-36806939 GGCAAAGCTGAGTGGGTCCTGGG + Intronic
908730077 1:67217009-67217031 GCACTGGATGAGAGGGTCCTTGG - Intronic
910355956 1:86355329-86355351 GGCATGGGTGAGTGTGTCTTTGG - Intronic
915170322 1:153972942-153972964 GCCCAGGATGTGTGAGTCCTGGG - Intronic
916938087 1:169651455-169651477 GCTATGGATGAGTGGGGGCAGGG + Intergenic
921598953 1:217086999-217087021 TCCTTGGATGAGTGTGTCATTGG - Intronic
923783363 1:237044512-237044534 ACCTTTGATAAGTGGGTCCTGGG + Intronic
924325844 1:242893145-242893167 GCCATGGAGGAGAAGGGCCTGGG + Intergenic
1066351543 10:34641618-34641640 GCCATCGGTGAGGGGGTGCTGGG - Intronic
1067045286 10:42981925-42981947 CCCATGGCTCAGTGGGGCCTGGG - Intergenic
1072914079 10:99526581-99526603 GCCATGGGGGAGTGGGGGCTTGG + Intergenic
1073467851 10:103704697-103704719 CCCAGGGATGGGTGGCTCCTGGG + Intronic
1075088766 10:119431219-119431241 GCCAGGCATCACTGGGTCCTGGG + Intronic
1075287222 10:121197343-121197365 GCAAAGGATGAGAGGGTCCCAGG + Intergenic
1075626027 10:123965102-123965124 GCCCTGGAGGAGGGGGGCCTGGG + Intergenic
1075786489 10:125053505-125053527 CCCAGGGATGAGTGGCTCCTGGG + Intronic
1076180092 10:128400330-128400352 TCAATGGATGAGTGTGTTCTTGG - Intergenic
1078452244 11:11449086-11449108 TTCATGGATGAATGGGTCTTTGG - Intronic
1080790027 11:35514328-35514350 GCCATGTATGTGTGGGCCCCTGG - Intronic
1082255621 11:50029380-50029402 ACGATGGATGGATGGGTCCTGGG - Intergenic
1082884846 11:58070746-58070768 GCCATAGATGATTGGGCACTGGG + Intronic
1085476349 11:76791552-76791574 GCCATGGCTGAGTTGTACCTTGG - Intronic
1087731092 11:101779446-101779468 GCCATGGCTGAGAGGATCCAAGG + Intronic
1087983649 11:104650026-104650048 TCCCTGGATGAGTGGGTTCAGGG + Intergenic
1088447723 11:109950165-109950187 GCCATGGATGAAAGGGGCCAAGG - Intergenic
1088848576 11:113687780-113687802 TCCATGGCTGAGAGGCTCCTGGG - Exonic
1089395814 11:118135928-118135950 CCTTTGGATGAGGGGGTCCTTGG - Exonic
1089581464 11:119484137-119484159 GGCATGGAGGAGGGGGTCCCAGG + Intergenic
1090482415 11:127080134-127080156 GGCATGAATGAGTGGATCCCAGG - Intergenic
1091457490 12:618625-618647 GCCATGACTGAGAGGGCCCTGGG - Intronic
1092728281 12:11505405-11505427 ACCATGGATCAGTGAGTCCATGG - Intergenic
1094851372 12:34383773-34383795 GCCACGCATGTGTGGGACCTAGG - Intergenic
1094853718 12:34393693-34393715 ACCATGCATGCGTGGGTCCCAGG + Intergenic
1096510766 12:52126753-52126775 GCCCTGGGAGAGTGTGTCCTTGG + Intergenic
1098998673 12:77150871-77150893 GCCATTGCTGAGTGGGGGCTGGG + Intergenic
1099925800 12:89015151-89015173 GTCATGGCTGAGTGAGTCCCTGG + Intergenic
1100455883 12:94751307-94751329 GCCATGGAGGGATGGGTCTTGGG + Intergenic
1104209114 12:126670230-126670252 GCAATGAATGATTGGGTTCTAGG - Intergenic
1108112607 13:47092227-47092249 CCCATGGAGGATTGGGGCCTGGG - Intergenic
1108355524 13:49625770-49625792 GCCAAGGTTGAGGGGCTCCTGGG - Intergenic
1113408732 13:110065226-110065248 TCAATGGCTGAGTGGGTCCCTGG + Intergenic
1113431015 13:110250640-110250662 GCCATGGGTCAGTGGTTCCTTGG + Intronic
1114075494 14:19159194-19159216 GCCAGGGATGACAGGGTCCCCGG - Intergenic
1115950261 14:38713188-38713210 GGCATGGCTTACTGGGTCCTTGG - Intergenic
1116997195 14:51336227-51336249 GCCATGGATGTGTGTGTGCGTGG + Intergenic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1117684336 14:58238044-58238066 TCCATCGATGGGTGAGTCCTTGG - Intronic
1121250747 14:92497725-92497747 GCCCTGGGTGAATGGGTCCTTGG + Exonic
1121308500 14:92922470-92922492 GCCATGGGTGAGTGAATCCTGGG - Intergenic
1121734866 14:96211208-96211230 GCCAAGCATGAGTGGGTGCTAGG - Intronic
1121787785 14:96675464-96675486 GGCAAGGATGAGTGGTTTCTGGG + Intergenic
1122400629 14:101465319-101465341 GCAATTGATCAGTGGGTGCTGGG - Intergenic
1122520434 14:102339827-102339849 GCCATAGATGGATGTGTCCTGGG - Intronic
1202898832 14_GL000194v1_random:24464-24486 GCCACGGAGAAGGGGGTCCTGGG - Intergenic
1123491532 15:20785480-20785502 GCCAAGGAAGAGTGGACCCTAGG + Intergenic
1123548036 15:21354574-21354596 GCCAAGGAAGAGTGGACCCTAGG + Intergenic
1124231821 15:27952505-27952527 GCCATGGCTGCGTGGGGCCAGGG + Intronic
1125459049 15:39890835-39890857 ACCATGGATGAGTTGGGCTTGGG + Intronic
1125611346 15:40973135-40973157 GCCTTGGAAGAGGTGGTCCTAGG - Intergenic
1126795465 15:52257430-52257452 GCCATGGATGAATGCGGCCCAGG + Intronic
1127383154 15:58446751-58446773 GCCAGGCCTGTGTGGGTCCTGGG - Intronic
1129080585 15:73036198-73036220 GCACTGGTTGAGTGGGGCCTGGG - Intergenic
1129241625 15:74255581-74255603 GCGTTGGAGGAGTGGGGCCTAGG + Intronic
1129845624 15:78766534-78766556 GCCAAGGAGGAGGGGGTACTGGG - Exonic
1132145021 15:99424511-99424533 CCCATGGATGAAGGGGCCCTGGG + Intergenic
1202956366 15_KI270727v1_random:81804-81826 GCCAAGGAAGAGTGGACCCTAGG + Intergenic
1132513469 16:354957-354979 TCCAGGGATGAGGGAGTCCTGGG + Intergenic
1133241225 16:4415857-4415879 GCCACGGCTGGGTGGGGCCTGGG - Intronic
1134208618 16:12257821-12257843 GGCATTTATGAGTGGGTGCTGGG - Intronic
1136233675 16:28902333-28902355 GCCACTGATGAGGGGCTCCTTGG - Exonic
1141022710 16:80512688-80512710 GTCATGGAGGAGTGGCTCCGTGG - Intergenic
1142482926 17:229688-229710 GCCATGGATGAGTGGGTCCTGGG + Intronic
1143407915 17:6690355-6690377 GCCTTGGAGGAGTGGGGACTTGG - Intronic
1143855007 17:9842057-9842079 TCCATGCATGAGTGTGTCCTGGG - Intronic
1144494782 17:15739217-15739239 GCCATGGATGAGAGTTTCCGGGG - Intronic
1144905471 17:18637455-18637477 GCCATGGATGAGAGTTTCCGGGG + Intronic
1148243206 17:46013295-46013317 GCCATGGCTGTGTGGGGCCTGGG - Intronic
1149158049 17:53657333-53657355 GCCATGCATAAGTGGCTTCTCGG - Intergenic
1149400029 17:56286546-56286568 GCCATGTATGGGTGTGTTCTAGG - Intronic
1149918671 17:60635698-60635720 TCCTTGGATGAGTGAGGCCTAGG - Intronic
1150366340 17:64589483-64589505 GCCATGGATGGGTGGGGTATTGG + Intronic
1153917828 18:9761520-9761542 GGCATGGCTTAGTAGGTCCTCGG + Intronic
1154163591 18:11997669-11997691 GCCTGGCATGAGCGGGTCCTTGG + Intronic
1160168299 18:76532098-76532120 GTCCTGGGTGGGTGGGTCCTGGG + Intergenic
1160168336 18:76532219-76532241 GTCCTGGGTGAGTGGGTCCTGGG + Intergenic
1160168360 18:76532295-76532317 GTCCTGGGTGGGTGGGTCCTGGG + Intergenic
1162407849 19:10486341-10486363 GGCATGGGTGAGTGGGACCCAGG + Exonic
1165821242 19:38677565-38677587 GGCAGGGGTGAGTGGGGCCTGGG - Intronic
1166810503 19:45511524-45511546 TGCAGGGAGGAGTGGGTCCTGGG + Intronic
1167348617 19:48961986-48962008 GTTAGGGATGAGTTGGTCCTGGG + Intergenic
1167418852 19:49390972-49390994 GCCATGGGTGAATGGGTGCCAGG + Intronic
1202647973 1_KI270706v1_random:158473-158495 GCCACGGAGAAGTGGGGCCTGGG + Intergenic
927698260 2:25251974-25251996 GCCCTCGAGGAGTGGGGCCTTGG + Intronic
932012674 2:67994008-67994030 GCCATGGGTGAGCTGGTCGTGGG - Intergenic
932497424 2:72153345-72153367 GCTATGGAGGAGAGGGACCTGGG + Intergenic
934859273 2:97750155-97750177 GGCATGGATGAGTGTGGCCTGGG - Intergenic
935327415 2:101949168-101949190 GCAATGGCTGAGTGAGTCCTGGG + Intergenic
935537189 2:104308314-104308336 GCCCTGGATGAGTTGGCACTGGG + Intergenic
937247545 2:120503358-120503380 GCCATGGATGGGTGGGGGCAGGG - Intergenic
937593018 2:123638059-123638081 GCCATGGGTGAGTGTGTCCATGG - Intergenic
938489703 2:131755192-131755214 GCCACGGAGAAGTGGGGCCTGGG + Intronic
939498300 2:142949572-142949594 GCCATGGATGAAAGGGGCCAAGG - Intronic
946228067 2:218275299-218275321 GCTATGGATGTGTGGGTACTTGG - Exonic
948081234 2:235207059-235207081 GCCCTGGATTTGTGGGCCCTGGG + Intergenic
948165878 2:235862147-235862169 GCCATGGATGAATGGAGCCATGG - Intronic
948365800 2:237453765-237453787 GGGATGGATATGTGGGTCCTGGG - Intergenic
1168895598 20:1321364-1321386 GTGATGGATGAGTATGTCCTCGG - Intronic
1169241421 20:3984343-3984365 GCCAGGGATGACTAGGTCCTGGG - Intronic
1170846269 20:19964538-19964560 GCCAGGGAAGTGTGTGTCCTAGG + Intronic
1172092819 20:32446008-32446030 GCCAGGGCCGAGTGGATCCTAGG - Exonic
1172190494 20:33059476-33059498 GCTCTGGGTGAGTGTGTCCTGGG + Exonic
1173393302 20:42654480-42654502 GCCCTCAATGAGTGGGTTCTGGG - Intronic
1175723231 20:61300222-61300244 GCCAGGGATGCGTGGGTCTGAGG + Intronic
1176447096 21:6830332-6830354 GCCAAGGAAGAGTGGACCCTAGG - Intergenic
1176603874 21:8814256-8814278 GCCACGGAGAAGTGGGGCCTGGG - Intergenic
1176707208 21:10125514-10125536 GCCAGGGATGACAGGGTCCCCGG - Intergenic
1176825267 21:13695358-13695380 GCCAAGGAAGAGTGGACCCTAGG - Intergenic
1177107538 21:16978692-16978714 GCCATGGATGAGGCGGTGCTGGG - Intergenic
1177156024 21:17502464-17502486 GCCCTGGATAAGTTGGCCCTGGG - Intergenic
1178273140 21:31212110-31212132 GCCATGGATGAGTATTTCCAAGG + Intronic
1180291087 22:10851949-10851971 GCCAGGGATGACAGGGTCCCCGG - Intergenic
1180353930 22:11823990-11824012 GCCACGGAGAAGTGGGGCCTGGG - Intergenic
1180384316 22:12168335-12168357 GCCACGGAGAAGTGGGGCCTGGG + Intergenic
1180493892 22:15881371-15881393 GCCAGGGATGACAGGGTCCCCGG - Intergenic
1180801829 22:18635527-18635549 GCCCTGGCTGAGCGGGTGCTGGG - Intergenic
1180853069 22:19031068-19031090 GCCCTGGCTGAGCGGGTGCTAGG - Intergenic
1180984847 22:19898211-19898233 GCCATGGATGGGTGGGGTGTGGG - Intronic
1181219891 22:21359734-21359756 GCCCTGGCTGAGCGGGTGCTGGG + Intergenic
1181556203 22:23673095-23673117 GTAAGGGATGGGTGGGTCCTGGG - Intergenic
1183387932 22:37525655-37525677 TCCATGGTTGAGTGGGTGGTTGG - Intergenic
1183676321 22:39300734-39300756 GCCTGGGAGGAGCGGGTCCTGGG + Intergenic
1183872223 22:40748640-40748662 CCCATGGTTCAGTGGGTCCCAGG - Intergenic
1184288418 22:43484823-43484845 GCCATGGATGAGGGGGCCCAAGG + Intronic
1184607502 22:45582476-45582498 ACCAAGGATGAGTGGGCCCTCGG - Intronic
1184827876 22:46965370-46965392 GCCATGGATGTGCAGGGCCTGGG + Intronic
1184919355 22:47594727-47594749 GCCTTGAATGAGAGGGTCCCTGG + Intergenic
950452277 3:13072164-13072186 GCCCCAAATGAGTGGGTCCTGGG + Intronic
952285842 3:31969267-31969289 GGGATGGATGAGGGGTTCCTTGG - Intronic
953279787 3:41543131-41543153 GCCATGGATCAGTGACTGCTAGG + Intronic
957920911 3:86747798-86747820 GCCATGGATAAATGGGGCCAAGG + Intergenic
964196049 3:154066092-154066114 GCCATGAATGAGTTGGGCCCGGG - Intergenic
967303553 3:188039527-188039549 CGCATGGATGACTGGATCCTTGG + Intergenic
968463093 4:735685-735707 GCCATGGAGCAGATGGTCCTGGG + Intronic
969255945 4:6001915-6001937 GCCATGCATGTGAGGGCCCTGGG + Intergenic
973374243 4:49276659-49276681 GCCACGGAAAAGTGGGGCCTGGG + Intergenic
973383169 4:49333580-49333602 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
973386778 4:49518595-49518617 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
973725113 4:53767622-53767644 CCCATGGGTGAGTAGGTCTTGGG - Intronic
980308849 4:131100872-131100894 GCCATGGCTGAATGGGGCCAAGG + Intergenic
981810492 4:148768751-148768773 ACCATGCATGAGTGGACCCTTGG + Intergenic
984824612 4:183913470-183913492 GCCATAGAACAGTGTGTCCTGGG + Intronic
985492545 5:187989-188011 GCCAGGGATGCCTGGATCCTGGG - Exonic
987012303 5:13779955-13779977 ACCATTGATGAGTTGCTCCTAGG - Intronic
987385815 5:17328375-17328397 AGGATGGATGAGTAGGTCCTTGG + Intergenic
990937086 5:61162555-61162577 GCCATTGCTGTGTGGGTCTTGGG + Intergenic
993423703 5:87735091-87735113 GCAATTGTTGAGTGGTTCCTAGG - Intergenic
997612607 5:135225764-135225786 GCCAGAGATGAATGGGTCCGTGG - Intronic
998003600 5:138642934-138642956 GCCAAGGCTGGCTGGGTCCTAGG + Intronic
998403598 5:141861588-141861610 TCCTTGGAGGAGTGGGGCCTGGG - Intronic
1000182336 5:158823474-158823496 GCTATTGATGAGTGGGTCTTTGG + Intronic
1002975449 6:2070723-2070745 GCCATGGGTGAGGACGTCCTGGG - Intronic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1003847307 6:10186300-10186322 ACCTTGGATGAGGGGGACCTTGG - Intronic
1005952766 6:30643622-30643644 GCAATGGAAGAGTGGGTCTGAGG - Intronic
1006439364 6:34043590-34043612 CCCATGGCTGGGTGCGTCCTTGG - Intronic
1007343580 6:41209583-41209605 GCCACAGGTGAGTGGGGCCTGGG - Intergenic
1007344981 6:41222660-41222682 GCCTTGGGTGAGTGGGGGCTGGG + Intergenic
1007718370 6:43870285-43870307 GGCATGGAGGAGTGGGCCCCAGG + Intergenic
1010428281 6:75749565-75749587 GTGATGGATGGGTGGGCCCTGGG + Intronic
1011394430 6:86891453-86891475 GCCAGGGATGGGTGGGGGCTGGG + Intergenic
1012877855 6:104750645-104750667 GTCATGGATGATTGAGTCCCTGG - Intronic
1017753078 6:157506871-157506893 GCCATTGATAAGTGGCACCTAGG + Intronic
1018541903 6:164890151-164890173 GCCATTGATACGTGAGTCCTTGG - Intergenic
1018685663 6:166302462-166302484 GCCCTTGATGACTGTGTCCTAGG - Intergenic
1019103530 6:169650561-169650583 GCAATGGATGAATGGGTGCATGG - Intronic
1020872160 7:13644863-13644885 ACCATGGATGAGTCGGTCCCAGG - Intergenic
1021517940 7:21507475-21507497 GGCATGGATGATAGGGTCCCAGG + Intronic
1023307014 7:38841342-38841364 ACCTTGGATGATTGGTTCCTTGG - Intronic
1024246059 7:47471406-47471428 TCCATGGGTGAGTGGGACCCAGG - Intronic
1026955446 7:74373717-74373739 GACATGGATCAGTGGTTTCTAGG - Intronic
1027049544 7:75013252-75013274 GCCATGGTTCAGTGGATGCTGGG + Intronic
1029383482 7:100228400-100228422 GCCATGGTTCAGTGGATGCTGGG - Intronic
1031007644 7:116492139-116492161 TTCATGGATGAGTGGATCGTTGG + Intronic
1031055097 7:116984530-116984552 GCCATCTATTACTGGGTCCTTGG - Intronic
1032692375 7:134301631-134301653 GCCATGGAAGAGAGGCACCTGGG - Intronic
1032840011 7:135706006-135706028 GGCATGGCTGAGGGGGTCCTGGG + Intronic
1033206458 7:139427228-139427250 GCCATGCATGAGTGGGGCCTTGG + Intergenic
1035168095 7:157003395-157003417 GCCAGGGAAGAGTGGGGGCTCGG - Intronic
1036699680 8:11003997-11004019 GCTGTGGAGTAGTGGGTCCTGGG + Intronic
1039005183 8:33028395-33028417 GCCATGGATCAGCGAGTCCATGG - Intergenic
1040284682 8:46093746-46093768 GCAAGGCCTGAGTGGGTCCTGGG + Intergenic
1040322771 8:46326949-46326971 GCGAGGTCTGAGTGGGTCCTGGG - Intergenic
1044367021 8:91359689-91359711 GCCATGGATTATTGGGTTATTGG + Intronic
1047501565 8:125445748-125445770 GCCATGGATTGGTGGCTCCTGGG - Intergenic
1050164129 9:2746701-2746723 GCCATTGTTGAGTGGGTGCTAGG - Intronic
1053614499 9:39749534-39749556 AACATGCATGAGTGTGTCCTGGG + Intergenic
1053872532 9:42507472-42507494 AACATGCATGAGTGTGTCCTGGG + Intergenic
1053900224 9:42788443-42788465 AACATGCATGAGTGTGTCCTGGG - Intergenic
1054142246 9:61539219-61539241 TGGATGGATGAGTGGGTGCTTGG + Intergenic
1054239019 9:62592858-62592880 AACATGCATGAGTGTGTCCTGGG - Intergenic
1054261415 9:62869152-62869174 AACATGCATGAGTGTGTCCTGGG + Intergenic
1054553148 9:66627380-66627402 AACATGCATGAGTGTGTCCTGGG - Intergenic
1055474198 9:76645217-76645239 ATCAAGGATGAGTTGGTCCTTGG - Intronic
1056187118 9:84146336-84146358 TACATGGATGAGTGTTTCCTAGG + Intergenic
1057522990 9:95774960-95774982 GTCATGGAGGAGTGGTTCCGCGG + Intergenic
1059191718 9:112333458-112333480 GCCATGGATGGGTAAGTACTAGG - Intronic
1061041715 9:128144563-128144585 GCCAAGGAGGAGTGGGGGCTGGG + Intergenic
1061711868 9:132493534-132493556 GTCATGGATGAATGGCTCCTGGG + Intronic
1203522094 Un_GL000213v1:54199-54221 GCCAAGGAAGAGTGGACCCTAGG + Intergenic
1203551290 Un_KI270743v1:166416-166438 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
1186066906 X:5776182-5776204 GCCTTGGAGGAGTGGGGCTTGGG + Intergenic
1186103947 X:6185948-6185970 TGTATGGATGAGTGGGGCCTGGG - Intronic
1187460970 X:19486290-19486312 TCAATGGCTGAGTGGGGCCTGGG + Intronic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1193885537 X:86981470-86981492 GCCATGGCTCAGAGGGCCCTAGG - Intergenic
1199636456 X:149817392-149817414 GCAATGGATGAGTGGCTCAGTGG + Intergenic
1200097552 X:153671303-153671325 GCCGTAGATGTGTGGGCCCTGGG - Exonic
1201152262 Y:11100732-11100754 GCCGCGGATAAGTGGGGCCTGGG - Intergenic
1201223295 Y:11791688-11791710 GCCATGGAGGAGAAGGGCCTGGG + Intergenic