ID: 1142486189

View in Genome Browser
Species Human (GRCh38)
Location 17:248926-248948
Sequence GGGCGAAGCAACCGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142486186_1142486189 -8 Left 1142486186 17:248911-248933 CCGCTCGAGGCTCCAGGGCGAAG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486175_1142486189 20 Left 1142486175 17:248883-248905 CCACCTGCCTGCCTCCTTCCTGT 0: 1
1: 2
2: 14
3: 209
4: 1452
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486181_1142486189 2 Left 1142486181 17:248901-248923 CCTGTCCCTTCCGCTCGAGGCTC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486176_1142486189 17 Left 1142486176 17:248886-248908 CCTGCCTGCCTCCTTCCTGTCCC 0: 1
1: 0
2: 17
3: 223
4: 1714
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486179_1142486189 6 Left 1142486179 17:248897-248919 CCTTCCTGTCCCTTCCGCTCGAG 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486177_1142486189 13 Left 1142486177 17:248890-248912 CCTGCCTCCTTCCTGTCCCTTCC 0: 1
1: 1
2: 29
3: 301
4: 2166
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486183_1142486189 -3 Left 1142486183 17:248906-248928 CCCTTCCGCTCGAGGCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486178_1142486189 9 Left 1142486178 17:248894-248916 CCTCCTTCCTGTCCCTTCCGCTC 0: 1
1: 0
2: 7
3: 112
4: 1080
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1142486185_1142486189 -4 Left 1142486185 17:248907-248929 CCTTCCGCTCGAGGCTCCAGGGC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142486189 Original CRISPR GGGCGAAGCAACCGAGGCTG AGG Intronic
901420899 1:9150422-9150444 GGGAGAAGCAGCAGAGGCTGGGG + Intergenic
903237925 1:21962311-21962333 GGATGAAGCAACTGAGGCTCAGG - Intergenic
903372624 1:22846716-22846738 AGGAGAAGCATGCGAGGCTGAGG - Intronic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
907516604 1:54997073-54997095 AGGCGAGGAAACCGAGCCTGCGG - Intergenic
907937733 1:59057650-59057672 GTGCAAAGCCCCCGAGGCTGTGG - Intergenic
908311696 1:62890583-62890605 GGCCGAAACAACAGAGGTTGAGG - Intergenic
911498137 1:98655262-98655284 GGGTGCAGCAACCTGGGCTGGGG + Intergenic
915574711 1:156767958-156767980 GGGGGAAGCAACAGCGGCGGGGG - Exonic
916310851 1:163397415-163397437 GGCCAAAGCAACAAAGGCTGAGG + Intergenic
923000999 1:230006318-230006340 GGGTTAAGCCAGCGAGGCTGTGG - Intergenic
923075127 1:230602943-230602965 GGGTGAAGGAGCAGAGGCTGAGG - Intergenic
923173619 1:231441892-231441914 GGGTGAAGCATCCCAGGCAGAGG + Intergenic
923772356 1:236948658-236948680 GGACCCAGCAAGCGAGGCTGGGG - Intergenic
1062859954 10:803349-803371 GGGCGAAGGACACGAGGGTGGGG + Intergenic
1063027285 10:2192984-2193006 GGCAGAAGCCACCGAGGCTGAGG - Intergenic
1063141018 10:3256736-3256758 GGGCAAAGCAAGGGAGGCTGCGG + Intergenic
1063363031 10:5472477-5472499 GGGCGGAGGAGCGGAGGCTGAGG - Intergenic
1063527758 10:6801088-6801110 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
1067266445 10:44749432-44749454 GGTCCTAGGAACCGAGGCTGAGG + Intergenic
1067557468 10:47282807-47282829 GAGGGAAGGAACCAAGGCTGAGG + Intergenic
1068658057 10:59594473-59594495 GGGAGAAACAACTGAGCCTGGGG - Intergenic
1069034133 10:63630249-63630271 GGGCGGGGCGACCGCGGCTGCGG + Intergenic
1072580186 10:96733938-96733960 GGGTGGAGGAACGGAGGCTGAGG - Intergenic
1073709562 10:106021627-106021649 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1074731753 10:116385488-116385510 GGGTGGAGCAACCCAGGCAGAGG - Intergenic
1075622698 10:123939510-123939532 GGATGAAGAAACTGAGGCTGAGG - Intronic
1076832863 10:133005635-133005657 GTGGGAAGCAGCCCAGGCTGTGG - Intergenic
1077056954 11:598405-598427 GGATGAAGCCATCGAGGCTGTGG + Exonic
1082948506 11:58786737-58786759 GGACCAAGCAACGCAGGCTGAGG + Intergenic
1085385229 11:76153786-76153808 GAGAGCAGCAGCCGAGGCTGGGG - Intergenic
1090850676 11:130568361-130568383 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
1091689121 12:2583812-2583834 AGCCGCAGCAACCCAGGCTGGGG - Intronic
1094473231 12:30822636-30822658 GGGCGAAGCAGCCGGAGCCGCGG - Intergenic
1097211525 12:57374224-57374246 GGGAGAATCACCTGAGGCTGGGG + Intronic
1101409676 12:104457870-104457892 GTGGGAAGCAACCGGGGGTGAGG + Intronic
1102015729 12:109646667-109646689 GGATGAAGCCACCCAGGCTGTGG + Intergenic
1103600975 12:122054427-122054449 GGACGAAGCCACCTTGGCTGCGG + Intronic
1104161864 12:126189029-126189051 GGGCTAAGAAAATGAGGCTGGGG + Intergenic
1108803955 13:54131714-54131736 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1113566973 13:111325093-111325115 GGGAGAAGCCACCCTGGCTGAGG - Intronic
1113795281 13:113053612-113053634 GGGCGAAGGTCCCGTGGCTGAGG + Intronic
1116702485 14:48259407-48259429 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
1116703367 14:48266369-48266391 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
1118371862 14:65144347-65144369 GGGCAAAGCACCTGAGGCGGTGG - Intergenic
1119371772 14:74152028-74152050 GGGCGAATCACTTGAGGCTGAGG + Intronic
1121324976 14:93014555-93014577 GGAGGAAGGAACTGAGGCTGTGG + Intronic
1121369089 14:93340661-93340683 GGGAGAATCATCTGAGGCTGGGG - Intronic
1122447728 14:101781673-101781695 GGGCGAGGCAGCGGAGGCCGGGG - Intronic
1131543171 15:93291567-93291589 GGTTGAAGCAACCCAGTCTGTGG - Intergenic
1133049124 16:3106673-3106695 GGGCGGGGCCACTGAGGCTGCGG + Intergenic
1134844908 16:17431873-17431895 GGGAGAAGCAGCCATGGCTGCGG + Intronic
1137572546 16:49576242-49576264 GGGAACAGCAACCGTGGCTGTGG + Intronic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1139340583 16:66265406-66265428 AGACGAAGCAACTGAGGCTCAGG - Intergenic
1139498089 16:67335956-67335978 GGGCGGATCACCTGAGGCTGGGG - Intronic
1140862561 16:79030998-79031020 GGGAGAATCACCCGAGGCTGGGG + Intronic
1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG + Intronic
1146708772 17:35022505-35022527 AGACAAAGCAACCGAGGCTTAGG + Intronic
1146838933 17:36136048-36136070 GGGTGAACCAGCAGAGGCTGTGG + Intergenic
1148493715 17:48039378-48039400 GGGAGAATCACCCGAGTCTGGGG + Intergenic
1148871022 17:50658898-50658920 TGAGGAAGCACCCGAGGCTGGGG + Intronic
1149810943 17:59670992-59671014 GGTTGAAGAAACTGAGGCTGAGG - Intronic
1150004441 17:61461396-61461418 GGGCCCAGCATCCAAGGCTGGGG - Intronic
1151743661 17:76000624-76000646 GGGAGCTGCAACCCAGGCTGTGG + Intronic
1154501535 18:15000102-15000124 GGGCGTAGCAGCCCTGGCTGCGG + Intergenic
1157613821 18:48975621-48975643 AGGCGATGCCGCCGAGGCTGCGG + Intergenic
1160041650 18:75351002-75351024 AGGGGAAGCAACGGAGGCAGGGG + Intergenic
1160974324 19:1785225-1785247 TGGCGTAGAAACCAAGGCTGAGG + Exonic
1163583676 19:18153101-18153123 GGGCGGATGAACCGAGGCCGAGG - Intergenic
1165800469 19:38546379-38546401 GGGAGAAGCAACAGAGGTGGGGG + Intronic
1166113857 19:40640777-40640799 GGGGGAAGCAACCAAGGTGGTGG - Intergenic
926543374 2:14208525-14208547 GGGCCAAGAAACAGAGTCTGTGG - Intergenic
926633984 2:15161628-15161650 GGGTGAAACAACCCAGGCTCAGG - Intergenic
927409361 2:22806828-22806850 GGGCAATGCAATCCAGGCTGAGG - Intergenic
929004912 2:37385002-37385024 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
933652009 2:84857134-84857156 GGTTGAAGCCACCTAGGCTGTGG + Intronic
934560478 2:95310613-95310635 GGGCGATGTAGCCCAGGCTGGGG - Intronic
936794376 2:116188259-116188281 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
936935756 2:117836773-117836795 GGGCGAAGACACAGAGGATGTGG + Intergenic
937981858 2:127620424-127620446 GTGGGAAGCAGCCGAGGCAGAGG - Exonic
938500718 2:131830284-131830306 GGGCGGAGCAGCCCTGGCTGCGG + Intergenic
939083220 2:137686965-137686987 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
939629764 2:144517183-144517205 GGGAAAAGGAACCGAGGCGGCGG - Intronic
946248537 2:218400150-218400172 GGGCAAAGGTACCGGGGCTGCGG + Exonic
946688036 2:222291197-222291219 GGCCGAGGCATCCGGGGCTGTGG - Intronic
946871842 2:224091869-224091891 GGGTGGAGAAGCCGAGGCTGAGG + Intergenic
947444688 2:230154924-230154946 GGGGGCAGCAACAGGGGCTGGGG - Intergenic
947448204 2:230180770-230180792 GGGAGAAGAAACTGATGCTGAGG + Intronic
1174202132 20:48814081-48814103 AGGCCAAGGAACCCAGGCTGCGG + Intronic
1174305054 20:49609158-49609180 AGGTGAAGAAACCGAGGCTCAGG - Intergenic
1178294149 21:31394864-31394886 GGAAGAAGAAACCAAGGCTGTGG - Intronic
1180686398 22:17670598-17670620 GGCCGAAGCAGCCGAGGTCGGGG - Intronic
1183445221 22:37849216-37849238 GGGCGGATCACCTGAGGCTGAGG - Exonic
949162174 3:894670-894692 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
949982393 3:9509897-9509919 GGATGAAGAAACTGAGGCTGAGG + Intronic
951316402 3:21193219-21193241 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
952391405 3:32883956-32883978 GGGTGAAGCATTCCAGGCTGTGG + Intronic
960118160 3:113918809-113918831 GGTCCCAGCAACTGAGGCTGAGG - Intronic
968548256 4:1209667-1209689 AGGCCAGGAAACCGAGGCTGAGG + Intergenic
969163212 4:5279783-5279805 CGTGGAAGCCACCGAGGCTGGGG + Intronic
969857680 4:10013502-10013524 AGGCGAGGAAACTGAGGCTGAGG - Intronic
970488050 4:16544253-16544275 GGGAAAAGCAGCCGAGGATGTGG + Intronic
972780052 4:42279522-42279544 AGATGAAGCAACCGAGGCTCAGG + Intergenic
973754817 4:54064365-54064387 GGGCGAGGCGGCGGAGGCTGAGG + Exonic
974364573 4:60929398-60929420 GGGAGAAGCAGCTGAGCCTGGGG + Intergenic
976595551 4:86892158-86892180 GTGGGAAGGAGCCGAGGCTGAGG - Intronic
980112009 4:128644844-128644866 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
984099130 4:175465432-175465454 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
985770559 5:1807585-1807607 TGGGGAAGCAAGTGAGGCTGAGG + Intronic
986555637 5:9007899-9007921 GGGTGAAGGAGCGGAGGCTGAGG + Intergenic
987123909 5:14793369-14793391 GGGCAAAGCCACCATGGCTGAGG - Intronic
992394583 5:76359064-76359086 GGGTGAAGGAGCGGAGGCTGAGG - Intergenic
995230383 5:109754773-109754795 GGGCAAATCACCTGAGGCTGGGG + Intronic
996339716 5:122423080-122423102 GGGCCAAGCTCCTGAGGCTGGGG - Exonic
996726988 5:126681099-126681121 GGGCGGATCACCTGAGGCTGGGG - Intergenic
1000438507 5:161241654-161241676 GGGTGGAGGAACAGAGGCTGAGG - Intergenic
1000439641 5:161250178-161250200 GGGTGGAGGAACAGAGGCTGAGG - Intergenic
1000788139 5:165571297-165571319 GGGCAAAGAAGCCTAGGCTGAGG - Intergenic
1001507786 5:172293608-172293630 TGGAGAAGCCACCCAGGCTGTGG + Intergenic
1001927992 5:175653031-175653053 GGGGGAAGCAGCCAAGCCTGGGG + Intergenic
1010543635 6:77123699-77123721 GAGTGAAGCATCCCAGGCTGAGG + Intergenic
1013231350 6:108164692-108164714 GGGCGCCGCGACCAAGGCTGGGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1018495481 6:164342737-164342759 GGGTGGAGGAGCCGAGGCTGAGG + Intergenic
1019915619 7:4130351-4130373 GGGAGAGGCAGCAGAGGCTGGGG + Intronic
1023698969 7:42874606-42874628 GGGTGAAGGAGCGGAGGCTGAGG + Intergenic
1024365046 7:48510585-48510607 GGGTGAAGCTACCCAGCCTGTGG - Intronic
1029152729 7:98492371-98492393 GGTCGAAGCCACCTAGTCTGCGG + Intergenic
1029163175 7:98567426-98567448 GGGACGAGAAACCGAGGCTGTGG + Intergenic
1030870698 7:114752385-114752407 AGGGGAAGCAACCGAGAATGTGG - Intergenic
1032239148 7:130147878-130147900 GGGTGAAGCTTCCGCGGCTGAGG + Intergenic
1032414955 7:131728772-131728794 GGGCTGAGCAACCTAGGCAGAGG + Intergenic
1033253223 7:139777885-139777907 GGGCGGAGCGGCCGAGGCCGAGG + Intronic
1036282512 8:7413856-7413878 GGGCGAAGCGAGGGAGGCTCTGG - Intergenic
1036338960 8:7897693-7897715 GGGCGAAGCGAGGGAGGCTCTGG + Intergenic
1038040895 8:23723071-23723093 GGGCGAATCACCTGAGGCCGGGG + Intergenic
1038160590 8:25033525-25033547 GGGCAAAGCAATCCAGGATGTGG + Intergenic
1038524751 8:28263269-28263291 GGCTGAAGCAAACGAGGCTTGGG + Intergenic
1047127944 8:121983946-121983968 GAGAGAAGCACCCAAGGCTGAGG - Intergenic
1049172060 8:141167545-141167567 GGGACAAGTAACCCAGGCTGTGG + Intronic
1049310807 8:141932863-141932885 GTGCGAGGCAGCCCAGGCTGGGG - Intergenic
1049760537 8:144330207-144330229 GAGCGAAGGCACCCAGGCTGGGG + Intergenic
1051849370 9:21489700-21489722 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1062344144 9:136107100-136107122 GGGAGAAGGAACCAGGGCTGGGG - Intergenic
1062491681 9:136808001-136808023 GAGCGGAGCAGCCGCGGCTGAGG + Exonic
1062498963 9:136844245-136844267 GGGCGGAGCAGCCCTGGCTGCGG - Intronic
1193026714 X:76852598-76852620 GAGCCAAGCAACCCAGGCTGAGG - Intergenic
1193450116 X:81655352-81655374 GATCCAAGCAACCCAGGCTGAGG - Intergenic