ID: 1142493661

View in Genome Browser
Species Human (GRCh38)
Location 17:294518-294540
Sequence GTGCAGAAATGGACGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 7, 3: 19, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142493654_1142493661 23 Left 1142493654 17:294472-294494 CCTGAGTGGACACAGCATTAAGT 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG 0: 1
1: 0
2: 7
3: 19
4: 141
1142493653_1142493661 27 Left 1142493653 17:294468-294490 CCAACCTGAGTGGACACAGCATT 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG 0: 1
1: 0
2: 7
3: 19
4: 141
1142493656_1142493661 -4 Left 1142493656 17:294499-294521 CCAGGACTGAAGAACACCTGTGC 0: 1
1: 0
2: 2
3: 16
4: 147
Right 1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG 0: 1
1: 0
2: 7
3: 19
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142493661 Original CRISPR GTGCAGAAATGGACGGCAGA GGG Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901247400 1:7743470-7743492 GGGCAGAGACGGACTGCAGATGG - Intronic
904823891 1:33262252-33262274 GTTCAGAAAAGGACCCCAGATGG - Intronic
908159005 1:61387577-61387599 GTGCAGACATGAAAGGCAGCAGG - Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
911824842 1:102469372-102469394 GAGCAGAAGAGGAAGGCAGATGG + Intergenic
914785664 1:150827315-150827337 GAGCAGAGATTGACTGCAGATGG - Intronic
915564080 1:156704391-156704413 GTGCAGGAATTGAAGGCAGCAGG + Intronic
916014291 1:160735247-160735269 GTGCAGAAATCCACAGCACATGG - Intergenic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
921082312 1:211751844-211751866 GGGCAGAAATGAAGGGAAGAGGG - Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
1063353591 10:5377793-5377815 GTCTAGAAAAGAACGGCAGAGGG + Intergenic
1063858251 10:10279107-10279129 TTGCAAAAATGGACACCAGAAGG - Intergenic
1065746075 10:28843614-28843636 GGGCAGAAATGGAAGAGAGAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1066011717 10:31200589-31200611 AGGCAGAAATGGAGGTCAGAAGG + Intergenic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1071048264 10:81412037-81412059 AGGCAGAAATGGAAGACAGAAGG + Intergenic
1074538884 10:114348545-114348567 GTGCAGAAGTGCCCAGCAGAGGG - Intronic
1075123612 10:119682199-119682221 GTGCAGGAATGGATGGCTGTAGG - Intergenic
1075646495 10:124100220-124100242 TGGCAGAAAAGGAGGGCAGAGGG - Intergenic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1081230774 11:40583351-40583373 GTTGAGAAATGGGCTGCAGAAGG + Intronic
1087080640 11:94168022-94168044 GTGGAGAAGTGGGAGGCAGATGG + Intronic
1088826246 11:113496681-113496703 TTGCAGAAATAGACTGCACATGG + Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1090923769 11:131231621-131231643 GTCCAGATATTGATGGCAGAAGG + Intergenic
1096193443 12:49634317-49634339 GTCCAGAACTGGAGGGCACAGGG - Exonic
1096419472 12:51444622-51444644 CTGCAGAAAGGGACTACAGAAGG - Intronic
1097007238 12:55928097-55928119 TTGCTGAAATGGGCGGCGGAGGG - Intronic
1109314484 13:60734132-60734154 GAGCAGGAATGGTCAGCAGAGGG + Intergenic
1112343250 13:98569686-98569708 GTACATTAATGGACTGCAGACGG - Intronic
1114916121 14:27267413-27267435 ATGGAGAAATGGATGACAGATGG + Intergenic
1115534682 14:34362097-34362119 GTGCAGCAATGGAAGGCTTATGG - Intronic
1115646042 14:35369104-35369126 CTGCAGAGATGGGCGGCGGAGGG + Intergenic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1119332200 14:73803163-73803185 GTGGAGAAATGGAGGCCCGAGGG - Intergenic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1129171983 15:73813558-73813580 GTACAGAAAGGAAGGGCAGAGGG - Intergenic
1129608260 15:77035254-77035276 GTGCTGAGATGGCCTGCAGAGGG + Intronic
1132689545 16:1176450-1176472 CTGCAGAAAGAGACGGCAGCTGG - Intronic
1138507244 16:57484509-57484531 AGGCAGACAGGGACGGCAGAAGG + Intronic
1139488076 16:67270627-67270649 TCGCAAAAATGGACGGCATATGG + Intronic
1141171732 16:81695983-81696005 GTCAAGAAAGGGAGGGCAGAAGG + Intronic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143063923 17:4228339-4228361 CTGCAGAAGTGGATGGCAAAAGG + Intronic
1143987424 17:10926815-10926837 GTCCAGCAATGGCTGGCAGAGGG - Intergenic
1144456549 17:15423447-15423469 GTGCTGAAATGGAGGGCACGTGG + Intergenic
1146937915 17:36824058-36824080 GTGCAGGGATGGAGGGCAGGTGG + Intergenic
1150658700 17:67057256-67057278 GTTCAGACATGATCGGCAGATGG + Intergenic
1151359107 17:73577934-73577956 ATGCAGAAGAGGACGGCAGAAGG + Intronic
1152295696 17:79465909-79465931 GTGCAGACATCGAGGACAGATGG - Intronic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1158803229 18:60938053-60938075 TTGAAAAAATGGATGGCAGAAGG - Intergenic
1161978459 19:7618791-7618813 GTGTAGAACTGGGCGGCAGCTGG - Intergenic
1164336274 19:24324235-24324257 GGGCTGAAATGGACGGGGGAGGG - Intergenic
1165350182 19:35270835-35270857 GTGTTGAAATGGAAGGAAGAGGG + Intronic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
1167707298 19:51089142-51089164 GGGGAGAAAAGGAAGGCAGATGG - Intergenic
929977310 2:46647379-46647401 GTGCAGAAAGGGAGGGGGGAAGG - Intergenic
931137497 2:59420300-59420322 TTGCAGAATTGGACTCCAGATGG + Intergenic
931428390 2:62191342-62191364 GTGAAGAAATGAAAGGCACAAGG - Intergenic
933231535 2:79813270-79813292 GTGCAAAAATAGACATCAGAAGG + Intronic
934216827 2:90038782-90038804 GTGCAGAGAGGGGAGGCAGATGG + Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
938815031 2:134893566-134893588 TTGCAGAAATGGAGGACAGGGGG - Intronic
940721812 2:157290758-157290780 ATGCAGAAATAGAAGTCAGATGG + Intronic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1175656413 20:60774987-60775009 TTGCAGAAATTGGAGGCAGAAGG + Intergenic
1176981716 21:15389392-15389414 GTTAACAAATGGACCGCAGAGGG + Intergenic
1177125108 21:17184563-17184585 GTGCAGAAGTGGTCAGCTGAAGG - Intergenic
1179167536 21:38946603-38946625 CTGCAGACATAGTCGGCAGATGG - Intergenic
1179771819 21:43625427-43625449 GTGGAGAACTGGACTACAGAAGG + Intronic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1182740551 22:32564227-32564249 GTGCAGTCATGGCCGGCAAATGG - Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
949915301 3:8957733-8957755 GTCCAGAAATAGACTACAGATGG + Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
953137941 3:40199686-40199708 GTGGAGAATTGAAGGGCAGAGGG - Intronic
953739372 3:45523864-45523886 AAGCAGAAATGGATGGCAAAGGG + Intronic
954798548 3:53173932-53173954 GGGTAGAGATGGACGGAAGACGG - Intronic
955571432 3:60310858-60310880 GTGCACAAATGATAGGCAGATGG - Intronic
956634058 3:71345753-71345775 GTGCAGAAATTCAGTGCAGATGG + Intronic
956893072 3:73631670-73631692 ATGCAAATATGGACTGCAGAAGG - Intergenic
957765451 3:84619279-84619301 GTGCAAAAAAGAAAGGCAGAGGG + Intergenic
962106931 3:132399969-132399991 GTGAAGAAATGGGTGGCAGAAGG - Intergenic
962945570 3:140166010-140166032 GAGAAGAAATGGACCCCAGATGG - Intronic
967767218 3:193294148-193294170 GTGAATAAATGGAAGACAGATGG + Intronic
972084279 4:35194230-35194252 ATACACAAATGGATGGCAGATGG - Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
975768749 4:77698241-77698263 TGGCAGAAATAGACGGCACAAGG + Intergenic
976476526 4:85490108-85490130 GGGCAGAAATGGGAGGGAGAGGG + Intronic
978724558 4:111955342-111955364 GTGCAAAAATTGAAGGGAGATGG - Intergenic
984083524 4:175280072-175280094 GTCCACAAATGGATGGCAAAGGG + Intergenic
984115205 4:175671622-175671644 GTGGAGGAATGGTTGGCAGAGGG + Intronic
984417902 4:179483949-179483971 GTGCTGAAATAGACTGCAGCGGG - Intergenic
985730321 5:1543868-1543890 GTGCAGGAAGGGAGGGCAAAGGG - Intergenic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
991265854 5:64716521-64716543 GGGGAGAAATGGAGGACAGAAGG + Intronic
992955283 5:81901780-81901802 GTGCAGAAGAGGCCTGCAGAGGG + Intergenic
995054606 5:107745407-107745429 GTGCAGATAGGGAAGGTAGAAGG - Intergenic
995130987 5:108630286-108630308 GTGCAGAAATGTCCAGGAGAAGG - Intergenic
995512589 5:112923272-112923294 TTGCAGAAGTGGAAGGCAGTAGG - Intergenic
995832055 5:116364155-116364177 TAGCAGATATGGATGGCAGATGG + Intronic
1000825130 5:166035208-166035230 GTGCAGAAATGCAGGCAAGAAGG - Intergenic
1003772805 6:9325861-9325883 GTGCAGAGATTGACCGCAAAAGG - Intergenic
1005532413 6:26721399-26721421 GTGAAGAAATTGACGGAAAACGG + Intergenic
1005535987 6:26756195-26756217 GTGAAGAAATTGACGGAAAACGG - Intergenic
1005538382 6:26780266-26780288 GTGAAGAAATTGACGGAAAACGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006398670 6:33803210-33803232 GTGCTGCAAGGGAGGGCAGACGG - Intronic
1006676506 6:35768370-35768392 GTGCAGGAAGGGACACCAGAAGG - Intergenic
1009007022 6:57799854-57799876 GTGAAGAAATTGACGGAAAACGG - Intergenic
1009009236 6:57822616-57822638 GTGAAGAAATTGACGGAAAACGG - Intergenic
1010980404 6:82364272-82364294 GTGCAGGAAGGAACGGGAGAGGG + Intronic
1011183051 6:84643027-84643049 GTGCAGAAATGCATTGCAGGAGG + Intergenic
1012815507 6:104018067-104018089 ATGCAGCAAGGGAGGGCAGATGG + Intergenic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1026452017 7:70537805-70537827 GAGCAGAAATGGAAGTAAGAAGG + Intronic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1030856653 7:114565984-114566006 TTTCAGAAATGGACTGGAGAAGG + Intronic
1032894228 7:136233141-136233163 GTGTAGAAAAAGAAGGCAGAGGG + Intergenic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1039981984 8:42415661-42415683 GTGCGGAAATGAAGGGCTGAAGG + Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1045641656 8:104257968-104257990 TTGCAGAAATGTACAGCAAATGG + Intergenic
1048550673 8:135431016-135431038 GAGCAGGAAAGGACTGCAGATGG - Intergenic
1051897303 9:22001050-22001072 GTGCATAGATAGACGGCAGATGG + Intronic
1054871306 9:70049339-70049361 GTGCAGAACTGAAACGCAGATGG - Intronic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1060082544 9:120664114-120664136 GTGCACAAAGGGAGGGCAGGTGG - Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1062178659 9:135178870-135178892 ATGAAGGAATGGACGCCAGATGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1189585150 X:42452757-42452779 ATAAGGAAATGGACGGCAGATGG + Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1191869910 X:65737153-65737175 GAGCAGAAAAGGAGGGGAGAAGG - Intronic
1197192194 X:123660122-123660144 TTGCAGAGATGAAGGGCAGAAGG - Intronic
1198675812 X:139128920-139128942 GTGCTGAAATAGACTGCAGAAGG - Intronic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199984699 X:152942029-152942051 GTGCAGACAGGGAAGGCAGCTGG + Intronic
1199997250 X:153033078-153033100 GTGCAGACAGGGAGGGCAGCTGG + Intergenic