ID: 1142493731

View in Genome Browser
Species Human (GRCh38)
Location 17:294984-295006
Sequence CTGTAGAAATGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 4, 2: 12, 3: 42, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142493731 Original CRISPR CTGTAGAAATGGAAAGCAGA GGG Intronic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904754755 1:32762046-32762068 ATGAGGAAATGGAAACCAGAGGG - Intronic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
907252853 1:53154313-53154335 GAGTAGAAATGGAAAGAAAATGG + Intergenic
908100297 1:60784190-60784212 CTGTAGAAATTGTAAACAGAAGG - Intergenic
908240121 1:62181936-62181958 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
912646062 1:111393242-111393264 CTGTATAAATGGTAGGCAGAAGG - Intergenic
913454335 1:119015615-119015637 ATGTAGAAATAGAAAGAAAATGG - Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916667100 1:166976004-166976026 CTGTCAAAAAGGAAACCAGACGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
917973355 1:180222700-180222722 CGCTAGAAATGGTAAGGAGAAGG - Intergenic
918178487 1:182065959-182065981 CACTAGAAATGGAGAGCGGAAGG + Intergenic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
919005940 1:191899733-191899755 CTGTAAAATTGCAAACCAGATGG + Intergenic
919587391 1:199455709-199455731 CTCTACAAATAGAAGGCAGAAGG + Intergenic
919902954 1:202057370-202057392 CTGTAGGGAAGGAAACCAGACGG - Intergenic
920424086 1:205859643-205859665 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
922073596 1:222220635-222220657 CTGTAAAAATGTTAAGCTGATGG + Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922458775 1:225798714-225798736 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063319208 10:5036996-5037018 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063961762 10:11312106-11312128 CAGTAATAATGGAAATCAGAAGG + Intronic
1064477641 10:15707906-15707928 TAGTAGCAATGGAAAGCAAATGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064776004 10:18778009-18778031 TTCTAGAAATGGAAAGCTCATGG - Intergenic
1064790854 10:18956577-18956599 ATGTAGAAATGGATAGAAAAGGG - Intergenic
1065067498 10:21985547-21985569 ATATAGAGATGGAAAGCAGGTGG - Intronic
1065279335 10:24118483-24118505 TTGTAGTAAAGGAAAACAGATGG - Intronic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1065567337 10:27026625-27026647 GTGTAGAAATGAAGATCAGAAGG - Intronic
1067424865 10:46200133-46200155 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068715185 10:60179782-60179804 GTGTGCAAATGGAAAACAGATGG + Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1070367147 10:75748556-75748578 TTGTAGAAATGAGAAGCACAGGG - Intronic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1070861350 10:79666351-79666373 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1070925327 10:80217095-80217117 CTGAAACAATGGAAAGCACATGG - Intergenic
1071782732 10:88864480-88864502 GTGTAGAAATTAAAAGCACATGG + Intergenic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1072108192 10:92293063-92293085 ATGTAAAAATGAAAAGCAGGAGG - Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1074230539 10:111530934-111530956 CCATAGAAATGGAAATTAGAAGG - Intergenic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075716068 10:124556137-124556159 CTGAAGAAGTGAAAGGCAGAGGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077872513 11:6273662-6273684 CTCAAGAAATGGAAAATAGATGG - Intergenic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1080097273 11:28424052-28424074 CTCTAAAAATGCAAAGCATATGG - Intergenic
1081447525 11:43145192-43145214 CTCAAGAATTGGAAGGCAGAAGG - Intergenic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1085156675 11:74301955-74301977 GGGTAGAAAGGGAAAGCAGGGGG - Intronic
1086617039 11:88833625-88833647 CTGAAGAAAAGGAAATCAGTAGG + Intronic
1087549220 11:99626120-99626142 CTGTAGAAATTGCAGGAAGAAGG + Intronic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1088398518 11:109396262-109396284 CTCAAGAAAAGGAAAGCTGAAGG + Intergenic
1088551949 11:111022159-111022181 CTGTGCACTTGGAAAGCAGATGG - Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089653476 11:119930494-119930516 ATCAAGAAATGGCAAGCAGAAGG - Intergenic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1091305093 11:134531588-134531610 CTGTAGGGAAGGAAACCAGAGGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092334815 12:7622423-7622445 CTATAGGAATAGAAAGCATAGGG + Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093966976 12:25338219-25338241 CTGAAGGAATGGAAAATAGATGG - Intergenic
1094730910 12:33174431-33174453 TTCTAGAAATGAGAAGCAGAGGG - Intergenic
1095260526 12:40093949-40093971 GTGTATAAAAAGAAAGCAGAGGG + Intronic
1096675601 12:53224139-53224161 CTGTGCTCATGGAAAGCAGAGGG - Intronic
1096900798 12:54879335-54879357 CAGTAATAATGGAAAGCAGAAGG + Intergenic
1096977811 12:55709439-55709461 GTGTAGTATTGGAAAACAGAGGG - Intronic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098369601 12:69742780-69742802 AAGTTGAAAAGGAAAGCAGAAGG - Intronic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1103319794 12:120085510-120085532 CACTAGAAATCAAAAGCAGAAGG + Intronic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1104097693 12:125573345-125573367 GTTTAAAAATGGAAAGGAGAAGG - Intronic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1107429449 13:40327005-40327027 CTGTAGAATTTGAAGTCAGATGG + Intergenic
1107763190 13:43703763-43703785 CTATAGAACTGGTAAGCATAGGG - Intronic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110236372 13:73221707-73221729 TTCTACAAATGGGAAGCAGAAGG - Intergenic
1110593222 13:77288300-77288322 CAGTAAATATTGAAAGCAGAAGG + Exonic
1110958001 13:81581050-81581072 CTGTAGTAATTGAAAGGTGAAGG + Intergenic
1111285343 13:86084036-86084058 CCATAGAGATGGAAAACAGATGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111744762 13:92253771-92253793 CTGTAGAAATAAAAAAAAGAAGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112781265 13:102903473-102903495 TGGTAGAAATGGAAACCCGAGGG + Intergenic
1113145559 13:107203820-107203842 GTGTAGCAATGAGAAGCAGAAGG + Intronic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1117458496 14:55921460-55921482 CTTTAGAAATGGAAAAGACAAGG + Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1118470362 14:66069528-66069550 TTGTAGAAAAGGAATGCAGCCGG + Intergenic
1119158825 14:72436062-72436084 CTTTAGAAAGGAAAGGCAGAAGG - Intronic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1120911694 14:89672696-89672718 AAGTTGAAATGGAAATCAGATGG - Intergenic
1121217755 14:92261830-92261852 CTATAGAAATGAAATTCAGAGGG - Intergenic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121745090 14:96282479-96282501 CTGAAGCAAAGCAAAGCAGAGGG + Exonic
1202901337 14_GL000194v1_random:42285-42307 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1123602024 15:21982617-21982639 CTCTAAAACTGGAAAGGAGAGGG - Intergenic
1124933095 15:34143008-34143030 GTATAGAAATTGAAAGAAGAGGG - Intronic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126690256 15:51283639-51283661 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128945200 15:71815025-71815047 CTGTAGAGATGCCAAGCACATGG + Intronic
1129531024 15:76264845-76264867 ATGTAGAAATGGAAATCAAAAGG + Intronic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1131973684 15:97919384-97919406 CTGTAGTAAAGGCAAGCACAAGG + Intergenic
1132212784 15:100036771-100036793 CGGTAGAGATGGAAGGTAGATGG - Intronic
1132407620 15:101553659-101553681 CTCTAGAAATGGAAAAGACAAGG - Intergenic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1202974131 15_KI270727v1_random:272423-272445 CTCTAAAACTGGAAAGGAGAGGG - Intergenic
1133876047 16:9735598-9735620 TGGTAGAAATGGAATGCAGTGGG + Intergenic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1135050167 16:19186023-19186045 CTCTTCAAATGGAAAGGAGATGG - Intronic
1135336854 16:21608992-21609014 CTGAATAAATGGGAAGCATAGGG - Intronic
1135940005 16:26814441-26814463 CTGCAGAAATGCAATGGAGATGG - Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139106493 16:63833015-63833037 CTGCACAAATAGAAAGCAGCAGG - Intergenic
1139240515 16:65387142-65387164 CTGTAGAGATGGAAAACATGTGG - Intergenic
1139620719 16:68139505-68139527 ATGTGAAAATGGAAAGTAGAAGG + Intronic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144698132 17:17319670-17319692 CTGTACTGATGGAAAGTAGATGG + Intronic
1144706926 17:17375048-17375070 CTCTAGAAATGGAAAACCAAAGG + Intergenic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1145408216 17:22629275-22629297 GTGTAGAAAGGGAAAGGAAAAGG + Intergenic
1145889172 17:28402946-28402968 CTTTATAAGAGGAAAGCAGACGG + Exonic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1148068256 17:44889463-44889485 CTGTAGACAGGGAAAACTGATGG + Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1148884740 17:50764097-50764119 AAGTCCAAATGGAAAGCAGATGG + Intergenic
1149143446 17:53461169-53461191 TTATAGAAAGGGAAAGCAAAGGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149399104 17:56275763-56275785 CTGTTGAAATGAAAGACAGAAGG + Intronic
1149419377 17:56494327-56494349 CAGTAAAAATGGAACACAGATGG + Intronic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG + Intronic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1151588237 17:75024806-75024828 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1152603057 17:81274807-81274829 CTGTAGGAGTTGAAACCAGAGGG - Intronic
1153394007 18:4596919-4596941 CTATAAGAATGGAAAACAGATGG - Intergenic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155995398 18:32325806-32325828 TTATAGAACTGGAAAGCAAATGG - Intronic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157080924 18:44524228-44524250 CTGTAGAAATGGCAGACATAAGG - Intergenic
1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG + Intergenic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1158869336 18:61669408-61669430 CTGTAAAAATGTTAAGCAAATGG - Intergenic
1159023151 18:63159513-63159535 TTGTAAAAATGGAAAGTAAAAGG - Intronic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159186699 18:64984147-64984169 ATCTAGAACAGGAAAGCAGATGG + Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1162693440 19:12452550-12452572 ATGTAGAAAAGGAAATCAGAAGG + Intronic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165350182 19:35270835-35270857 GTGTTGAAATGGAAGGAAGAGGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1168024234 19:53632171-53632193 GTGAAGAAGTGGAAAGCAGCTGG + Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1168367510 19:55801384-55801406 ATGTAGAAATTGAAATCAAAAGG + Intronic
1168476688 19:56680926-56680948 CCTTAAAAATGGAAAGCAGTGGG - Intergenic
1168623431 19:57897398-57897420 ATGTAGAAAAGGAAATCAAAAGG + Intronic
925119745 2:1409018-1409040 TTGTAGAAACGCAAAGCACAGGG + Intronic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
929346781 2:40894253-40894275 CTGTTGAAAGGGAAACAAGATGG + Intergenic
929437181 2:41937955-41937977 CAGTAGAAATGGAAAATGGAAGG - Exonic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
931087315 2:58847148-58847170 TTGTAGTAATGGATAGCAAACGG + Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
933305560 2:80593658-80593680 TCATAGAAATGGAAGGCAGATGG - Intronic
933867519 2:86535417-86535439 CTGTACAAAAGGAAATAAGAAGG - Intronic
934505444 2:94888834-94888856 CTATAAAAATGCAAAGCAAAGGG + Intergenic
937094722 2:119228124-119228146 TTATAGAAATGGGAAGCAGCCGG - Intronic
937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG + Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
939222661 2:139322518-139322540 CTGTGAAAATGGAAGCCAGATGG - Intergenic
940090225 2:149907221-149907243 CTGTATAAATGAGAAACAGAAGG - Intergenic
941499989 2:166262297-166262319 CTGAATAAATGGAAAGGAAAGGG + Intronic
942179117 2:173362933-173362955 CTAAAGAAATGAAAAGCAGGTGG + Intronic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
944053171 2:195494552-195494574 CTATAAAAATGTAAAGCTGACGG - Intergenic
944117089 2:196200019-196200041 CTGTACAAATAAAAAGCAGTGGG + Exonic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945179238 2:207074969-207074991 TTGGAGAAAGGGAAAGCAAAAGG - Exonic
945924645 2:215790724-215790746 CTGTAGAAATTCAAAACAGCAGG - Intergenic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946620685 2:221559608-221559630 CTTTAGAAATAGTAAGCAGAAGG - Intronic
946634753 2:221712330-221712352 ATTTAGAAATGGAAAAAAGAAGG + Intergenic
946955486 2:224925301-224925323 CTTTAGCAATGAAAAGCAAATGG - Intronic
947134615 2:226964809-226964831 CTTTACAAATGGATAGTAGAAGG + Intronic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1168894836 20:1317042-1317064 TTATAGAGATGGAAAACAGAGGG + Intronic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173806201 20:45926954-45926976 CTGGAGAAATGGAAAGCCTTAGG + Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174440381 20:50546939-50546961 CTGTCATTATGGAAAGCAGAAGG + Intronic
1174441639 20:50560273-50560295 CTGGAAAAATGTAAACCAGAAGG - Intronic
1174745287 20:53056244-53056266 CTGTAGTACTGAAAAGCAGCAGG - Intronic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176620712 21:9057063-9057085 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1179441194 21:41395412-41395434 CAATAGAAATGCAAAGAAGAGGG + Intronic
1180902786 22:19386699-19386721 CTTGGGAAATGGTAAGCAGATGG + Intronic
1181679106 22:24479129-24479151 CTGTGGAAATGAAAATCAAAGGG - Intergenic
1181898135 22:26129237-26129259 CTGTAGAAAGCAAAAGCAAAAGG - Intergenic
1182000139 22:26913417-26913439 TTGTAAAATGGGAAAGCAGAAGG + Intergenic
1182191428 22:28464974-28464996 CTATAAAAATGGAAAGCATCTGG - Intronic
1182491881 22:30678022-30678044 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183707869 22:39485893-39485915 CTGTATAAATGAATAGCAAATGG + Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1185183259 22:49376228-49376250 CTTTAGAAATGCAAAGGATACGG + Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949448791 3:4163883-4163905 CTGTAGAAATGGAAAATATATGG - Intronic
949956185 3:9270766-9270788 CAGTAAAAATGGAAAAAAGAAGG - Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953785094 3:45905582-45905604 CTGAAGAACTGGCAACCAGAGGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
955067045 3:55542874-55542896 GGGTGGAAATAGAAAGCAGAAGG - Intronic
955568754 3:60279515-60279537 CTTTAGATAGGTAAAGCAGAGGG + Intronic
956931191 3:74045191-74045213 CTGGATAAATTGAAAACAGATGG - Intergenic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
958472405 3:94537393-94537415 CTGAAGACATGGAAATCAAATGG - Intergenic
959964438 3:112337138-112337160 CTCTCAAACTGGAAAGCAGATGG + Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960259544 3:115550669-115550691 CAGAGTAAATGGAAAGCAGATGG + Intergenic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961724926 3:128921614-128921636 ATGTAGAAAAGGAAATCAAAAGG + Intronic
961735205 3:128997086-128997108 CTGTACATCTGGTAAGCAGAGGG + Intronic
963211890 3:142701753-142701775 TGGTAGAACTGTAAAGCAGATGG + Intronic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
963958328 3:151280203-151280225 ATGGAGAAATGGAAAGCTAAAGG + Intronic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
967196511 3:187030952-187030974 CTGTAGCAATTGAAGGCAGTGGG + Intronic
967215807 3:187209239-187209261 CCTATGAAATGGAAAGCAGAGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970172365 4:13302724-13302746 CTATAGAATTGGAAATGAGAGGG + Intergenic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
972006683 4:34118444-34118466 CTGTTAAAATGGAAACTAGAGGG - Intergenic
972330454 4:38059480-38059502 CTGTTTAAATGTAAAGCAAATGG + Intronic
972491243 4:39589566-39589588 TTCTAGAAAGAGAAAGCAGATGG - Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
973984638 4:56338607-56338629 TTGTAGTTATGGAAAGCAAACGG + Exonic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
974984793 4:69009623-69009645 CTGTAGAAATAGGAGACAGAGGG + Intronic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
976648152 4:87406829-87406851 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
977061637 4:92265494-92265516 CTGAATAAATGTAATGCAGATGG - Intergenic
977074658 4:92438274-92438296 CTTTAAAAAAAGAAAGCAGAGGG + Intronic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978015589 4:103741464-103741486 CTGTAGATATGAAAACCAGGGGG - Intergenic
978203980 4:106057572-106057594 CAGTAGCATTGGAAAGCACAGGG - Intronic
978568808 4:110113810-110113832 ATGTAGAAATAGAATTCAGAAGG + Intronic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
979611753 4:122696877-122696899 CTTAAGTAATAGAAAGCAGAAGG + Intergenic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
981791923 4:148547619-148547641 CTGTAGAAAGTGCAAGAAGATGG - Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982387369 4:154824840-154824862 CTATTGAAATAGAAATCAGAAGG + Intronic
983192325 4:164767849-164767871 CAGTAGAAATTGAAAGCTGGGGG - Intergenic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
984797648 4:183678702-183678724 CTCTAGAAAGGGAAATTAGATGG + Intronic
985047773 4:185957686-185957708 ATTTAGAAAAAGAAAGCAGATGG + Intergenic
985048242 4:185963811-185963833 GTATAGAAAGGGAAATCAGAAGG + Intergenic
985238569 4:187903686-187903708 CTGTAGAAATGTAAAGAATCTGG - Intergenic
1202765106 4_GL000008v2_random:142679-142701 CAGTAGAAAAGGAAAGTATAGGG - Intergenic
986353373 5:6901200-6901222 CTGAAGAAATAAAAAACAGATGG - Intergenic
987923389 5:24311449-24311471 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
991272204 5:64797069-64797091 ATGTAAAAATGAAAATCAGAGGG - Intronic
992972025 5:82071272-82071294 CTGTCAAAATGGAAAGCTGGGGG - Intronic
993041600 5:82821013-82821035 CAGTTGAAAAGCAAAGCAGATGG + Intergenic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993388581 5:87290151-87290173 CTGTAAAAATGGAATACAAATGG - Intronic
993484220 5:88462569-88462591 CTGTGGAAAGAGAAAGCAGGGGG + Intergenic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
995074554 5:107966821-107966843 CTGCAAAACAGGAAAGCAGATGG - Intronic
995076733 5:107993655-107993677 ATGTAAAAATGGAAAACAGTAGG - Intronic
995250776 5:109991019-109991041 CTGAAGAACTGGAACACAGATGG + Intergenic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
995779305 5:115758810-115758832 CAATAGAAATGAAAAGCAAATGG + Intergenic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997434133 5:133862023-133862045 CTGTAGAACTGAGAAGCAGGAGG + Intergenic
998808057 5:145938020-145938042 CTGTAGACATGGTTTGCAGAAGG - Exonic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999181999 5:149676308-149676330 GGGGAGAAATGGGAAGCAGAGGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1000195709 5:158955452-158955474 TTGTTGATATGAAAAGCAGAAGG - Intronic
1001349093 5:170939082-170939104 CAGTAAAAATGGAAGCCAGAAGG + Intronic
1001622361 5:173098425-173098447 CTGTATAACTAGAAATCAGAAGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1002958388 6:1891171-1891193 CTGTAGAAATGGAAACCACGTGG - Intronic
1004176068 6:13341272-13341294 CAGTAGAAATGTCAAGTAGATGG + Intergenic
1004863229 6:19827691-19827713 CTGTTGACATGGGAAGCAAAAGG - Intergenic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005737459 6:28761750-28761772 CTGTTGAAATGGAAGGCCTAGGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1007944689 6:45815556-45815578 CACTAGAAATGAAAAACAGATGG - Intergenic
1008191220 6:48460941-48460963 CTTTATAAAAGCAAAGCAGAGGG + Intergenic
1008513447 6:52298365-52298387 CTGTATGAATGGAAACAAGAGGG - Intergenic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1010145287 6:72661544-72661566 CTGAATAAATGGAAAACATATGG - Intronic
1010685997 6:78856072-78856094 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1010908205 6:81519595-81519617 CTGAACAGCTGGAAAGCAGATGG - Intronic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1011995185 6:93577755-93577777 TGGTGGAAATGGAAACCAGATGG + Intergenic
1012015585 6:93845715-93845737 CTGTATAAATGTCAATCAGATGG - Intergenic
1012027438 6:94014752-94014774 CGGTAGCAAAGGAAAGAAGAAGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014395128 6:120918281-120918303 CAGTAAACATGGAAACCAGAAGG + Intergenic
1014867817 6:126553425-126553447 CTGTAGAAAGGGACAACACAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017986189 6:159445091-159445113 CTATAGCCATAGAAAGCAGATGG - Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020532055 7:9350443-9350465 CCATGAAAATGGAAAGCAGAGGG + Intergenic
1021458162 7:20852853-20852875 GTGTATAAATGCAAAGCAGCTGG - Intergenic
1021649043 7:22815177-22815199 ATGAAGAAATGAAAAGCAGTAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022744574 7:33157463-33157485 CTGAAGAAATGAAAGACAGAAGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024011684 7:45272133-45272155 ATGTAGAAATGGTAAGGAGAAGG - Intergenic
1025036533 7:55596553-55596575 GTATAGAACTGGAAAGTAGAAGG - Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1025984603 7:66437658-66437680 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1026030110 7:66785288-66785310 GTGTAGAAATGGAAAATAGGTGG - Intronic
1026443615 7:70465003-70465025 CTCTAAAAATGGGAAGCAGGAGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027142001 7:75664920-75664942 CTGTTGAAATGGAAAGTATCTGG - Intronic
1027207806 7:76116246-76116268 GTGTAGAAATGGAAAATAGGTGG + Intergenic
1028043260 7:86085487-86085509 GTGTAGTAATGTAAAGGAGATGG - Intergenic
1028366192 7:90035631-90035653 GTGTATAAATGAAAAGAAGATGG + Intergenic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1029067471 7:97866204-97866226 CTATAAAAATGTAAAGCAAAGGG + Intronic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1030950701 7:115787864-115787886 CTGTAGAAAGAGAAAGGAAAAGG + Intergenic
1031041898 7:116847240-116847262 CTTTTTAAAAGGAAAGCAGAAGG + Intronic
1031327446 7:120419283-120419305 CTTTAGCAATGCATAGCAGATGG - Intronic
1031695943 7:124854326-124854348 CTGAATAATTGGAAAGCAAAGGG + Intronic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1032894228 7:136233141-136233163 GTGTAGAAAAAGAAGGCAGAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036079465 8:5539018-5539040 AAGTAGAAATGGAATGCAGGAGG - Intergenic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1036674267 8:10817030-10817052 CTGTAGAAATTAAAATCAGTAGG + Intronic
1036960659 8:13241422-13241444 CTGAGGAAAAGGAAACCAGAGGG - Intronic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037109204 8:15145617-15145639 CTGAAGAAAAGAAAATCAGATGG - Intronic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037410905 8:18596078-18596100 AAGTAGAAATTAAAAGCAGAAGG + Intronic
1038556337 8:28520813-28520835 CTGAAGATATGGAATGCAGTAGG + Exonic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039332458 8:36553492-36553514 CTGTAGAAATGGAAAGTTGCAGG + Intergenic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1040354612 8:46605402-46605424 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1040440265 8:47434215-47434237 CTGTCCACATGGGAAGCAGATGG + Intronic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1041444883 8:57939961-57939983 CTGTAAAGCTGGAAAGCAGGTGG - Intergenic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043236636 8:77876291-77876313 CAGGAGAAATGGAAATCACAGGG + Intergenic
1043976044 8:86586101-86586123 CTGTATAAATGGAAAAGAAAAGG + Intronic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1045572592 8:103384731-103384753 ATCTAGAAATGGGAAGTAGAAGG + Intergenic
1045643492 8:104278257-104278279 CTGTTGAATAGGAAAGCAGGAGG - Intergenic
1045645620 8:104294325-104294347 CTTTTGAAATGGAAAGTAAATGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046164770 8:110418049-110418071 CTGTAGAACTGTACAACAGAAGG + Intergenic
1046421822 8:113995303-113995325 CAGTAGAAATGGAAAACAGCTGG - Intergenic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1048223667 8:132565373-132565395 CTCAAGAAAAGGAAATCAGAAGG + Intergenic
1048398393 8:134037787-134037809 CATTAGAAATGCAAAGAAGAAGG + Intergenic
1048856915 8:138693945-138693967 CTGTAGAAATGTAGCTCAGAGGG + Intronic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051367556 9:16331919-16331941 CAGTAGAAAAGGAAAGCAAAGGG + Intergenic
1051608830 9:18942228-18942250 CTCTCTAAATGGAAATCAGATGG + Intronic
1051711797 9:19938545-19938567 CATTAGAAATGTGAAGCAGAAGG - Intergenic
1051810996 9:21049319-21049341 CTGCTGAAAGAGAAAGCAGATGG - Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1053023416 9:34710944-34710966 ATATAGAAAAGGAAAGCAAAGGG - Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054818408 9:69497691-69497713 CTGTGGAAATGGAAAAGAGGAGG - Intronic
1058056414 9:100453624-100453646 CTGTGGAAATGGGACGCAGTGGG - Intronic
1058359757 9:104130693-104130715 ATGTAGAAATGAAAACCAGCAGG - Intronic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1062433721 9:136536882-136536904 CTGTAAGAATGCAAAGTAGAGGG - Intronic
1203743922 Un_GL000218v1:27506-27528 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1203566191 Un_KI270744v1:92029-92051 CTATAAAAATGTAAAGCAAAGGG + Intergenic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1185951316 X:4437612-4437634 TTTTAGAAATGGATAGGAGATGG + Intergenic
1186136079 X:6522545-6522567 CTCTAAATATGGAAATCAGAAGG - Intergenic
1186659461 X:11654336-11654358 CTGTAGAAGTGGACAGCTCATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187587879 X:20684093-20684115 CTGAAAAAATGAAAAGTAGATGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189368644 X:40410234-40410256 CTGTAGGAATGGAATCCACAAGG - Intergenic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190260341 X:48793323-48793345 ATGAAGACAGGGAAAGCAGAGGG - Intronic
1190450395 X:50573703-50573725 CTGTAGAGACTGAAAACAGATGG - Intergenic
1190774545 X:53542245-53542267 CTGTAGTAAAGGAAAGAAAATGG - Intronic
1192484819 X:71515984-71516006 CCATAGAAACGGAAAGTAGAAGG + Intronic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194770931 X:97903804-97903826 TTTTTGAAATAGAAAGCAGAGGG - Intergenic
1195060321 X:101187964-101187986 ATGTAGAAAAGGAAATCAAAGGG - Intergenic
1195292695 X:103444335-103444357 CTGTAGAAAGGGTAAACACAGGG + Intergenic
1196653659 X:118194610-118194632 ATGAAGAAAAGCAAAGCAGACGG + Intergenic
1196664168 X:118298826-118298848 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199652834 X:149963888-149963910 CTGTATAAATGGGAAGAACATGG - Intergenic
1199687546 X:150277828-150277850 TTGTAAAACTGGAGAGCAGAAGG + Intergenic
1201157245 Y:11142491-11142513 CTATAAAAATGTAAAGCAAAGGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic