ID: 1142493866

View in Genome Browser
Species Human (GRCh38)
Location 17:295834-295856
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 5, 1: 3, 2: 3, 3: 40, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900358191 1:2274809-2274831 CTGCAGCAAGGGGCAGCAGCCGG - Intronic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
907525153 1:55049703-55049725 CTGCAAGCATGGCCAGCAGAGGG - Intronic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
913243673 1:116852538-116852560 CTGCAGAGATTGACAACTGAAGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914251315 1:145924264-145924286 CAGCAGAAAGAGGCAGCAGAAGG - Intergenic
914784163 1:150813287-150813309 TTCCAGACACGGACAGCAGAGGG - Exonic
914904819 1:151735233-151735255 CTGCAGACATGCCCAGGAGAGGG - Intergenic
916014291 1:160735247-160735269 GTGCAGAAATCCACAGCACATGG - Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
917722219 1:177796682-177796704 CTTCAGAGAGGGACAGGAGAGGG - Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921996063 1:221419550-221419572 CAGCAGAAAAAGGCAGCAGAAGG + Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922578208 1:226677424-226677446 CTCCAGAGAGAGACAGCAGAGGG + Intronic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
923309611 1:232723470-232723492 CAGCAGTAATGTACAGCAAAAGG - Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063858251 10:10279107-10279129 TTGCAAAAATGGACACCAGAAGG - Intergenic
1063861307 10:10310817-10310839 CTTCAGAAAGTGAGAGCAGATGG + Intergenic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1065591497 10:27266806-27266828 CTGCACAAAAGGACAGAAGGCGG - Intergenic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1067238744 10:44472896-44472918 CTGCAGACAGACACAGCAGAGGG - Intergenic
1067749491 10:48961138-48961160 TTGCAGAAAAGGACAGGAAAAGG - Intronic
1068966596 10:62918107-62918129 CTGAAGAAATGGACCTCAGTAGG + Intronic
1069890916 10:71652019-71652041 TGGCAGAAATGGGCAGAAGATGG + Intronic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1072253849 10:93601675-93601697 CTGCACAAGTGGACCTCAGAAGG - Intronic
1073011757 10:100365549-100365571 ATGCTGATATGCACAGCAGAAGG + Intergenic
1073151170 10:101312620-101312642 CTACAGAAATGGACAGAATGAGG - Intergenic
1074536322 10:114330757-114330779 CTGCAGACATGGACAGATGTAGG - Intronic
1074538884 10:114348545-114348567 GTGCAGAAGTGCCCAGCAGAGGG - Intronic
1076318386 10:129559894-129559916 CTGCAGAAATGGACAAATGCAGG + Intronic
1076844554 10:133062842-133062864 CTGACGAAATGGACAGGAAACGG - Intergenic
1077544984 11:3165290-3165312 CTGCAGGAAATGCCAGCAGATGG + Exonic
1078848583 11:15143446-15143468 CTGCAGGGATGAACAGCAGCTGG + Intronic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1081199879 11:40202861-40202883 CTGCAGAGCAGGACAGAAGAGGG + Intronic
1083625021 11:64067869-64067891 CTGGCTAAATGGACAGCAGCAGG - Intronic
1084091294 11:66880765-66880787 CTGCAGCATGGGACCGCAGAGGG - Intronic
1085160990 11:74344956-74344978 CTGCAAAAATGGTCAGCTTAAGG + Intronic
1086003111 11:82003314-82003336 CTGCAGGCATGCACAGCACATGG - Intergenic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1086416776 11:86596810-86596832 TTACAGAAAAGGAGAGCAGAAGG - Intronic
1086517441 11:87629134-87629156 CTGCAGTAAAGCCCAGCAGATGG + Intergenic
1088264925 11:107979806-107979828 CTACCATAATGGACAGCAGAGGG + Intergenic
1088826246 11:113496681-113496703 TTGCAGAAATAGACTGCACATGG + Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089962248 11:122626388-122626410 CTGCTGATATGGGCAGGAGAAGG - Intergenic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1091671883 12:2457750-2457772 ATTCAGCAAAGGACAGCAGAAGG - Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1096419472 12:51444622-51444644 CTGCAGAAAGGGACTACAGAAGG - Intronic
1100662440 12:96714755-96714777 CTGCTGAAAGGGACAAAAGAGGG + Intronic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1101336858 12:103804376-103804398 CTGCAGAAAGGCTCAGCACAAGG + Intronic
1102060982 12:109930876-109930898 CTGCAGAAAAGGCTATCAGATGG + Exonic
1102460228 12:113095302-113095324 CTGCAGAGAGGGACAGTACAGGG - Intronic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1104760376 12:131294500-131294522 ATGGAGAGATGGACAACAGATGG + Intergenic
1104760388 12:131294636-131294658 ATGGAGAGATGGACAACAGACGG + Intergenic
1104819391 12:131666147-131666169 ATGGAGAGATGGACAACAGATGG - Intergenic
1106578427 13:30997545-30997567 CTGCCGAAATGGGGAGCTGAGGG + Intergenic
1109314484 13:60734132-60734154 GAGCAGGAATGGTCAGCAGAGGG + Intergenic
1114455917 14:22853447-22853469 CTCCACACAGGGACAGCAGACGG - Intergenic
1114646710 14:24260114-24260136 CTGCAGAACTGGCCAGAAGTAGG - Intronic
1114744605 14:25134285-25134307 CTGCAGGAATGGCCAGAAGCTGG - Intergenic
1114814603 14:25942715-25942737 CTGCAGACATGGACAACTAAGGG + Intergenic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1115646042 14:35369104-35369126 CTGCAGAGATGGGCGGCGGAGGG + Intergenic
1115810719 14:37104088-37104110 CTTCAGAAATGGACACCAATGGG + Intronic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1117889245 14:60399878-60399900 CAGCAGAAAGAGGCAGCAGAAGG + Intronic
1117946177 14:61024398-61024420 CTGAGGAAATGGGCTGCAGAGGG - Intronic
1117973327 14:61273606-61273628 TTGCAAAAATGAATAGCAGATGG - Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118504938 14:66400904-66400926 AGGCAGACATGGACAGCAAACGG - Intergenic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1119713939 14:76844912-76844934 CTGGAGGAAGGGACAGCAAAGGG + Intronic
1121821734 14:96974153-96974175 CTGCACAAATGCACTGAAGAAGG + Intergenic
1125305221 15:38304682-38304704 CTGCTGAAATGAAGACCAGAAGG - Intronic
1125782635 15:42283800-42283822 CTGCAGAAATGGCCAGGAACAGG + Intronic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126509958 15:49459413-49459435 CTGCAAAAATGTACAACACATGG - Intronic
1128691909 15:69731038-69731060 CTGGAGCAAAGGCCAGCAGAAGG - Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130829973 15:87589459-87589481 CTGGAGACAAGGACACCAGAGGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1131016729 15:89063899-89063921 CTGCACAGCTGCACAGCAGAAGG - Intergenic
1131469458 15:92683652-92683674 TTGCTCAACTGGACAGCAGATGG - Intronic
1131885895 15:96912377-96912399 CAGCAGATATGGCCAGCTGATGG + Intergenic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1132689545 16:1176450-1176472 CTGCAGAAAGAGACGGCAGCTGG - Intronic
1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG + Intronic
1134517876 16:14901535-14901557 CTGCTGTAAGGCACAGCAGAAGG - Intronic
1134705545 16:16300186-16300208 CTGCTGTAAGGCACAGCAGAAGG - Intergenic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1134961996 16:18411928-18411950 CTGCTGTAAGGCACAGCAGAAGG + Intergenic
1134966294 16:18494527-18494549 CTGCTGTAAGGCACAGCAGAAGG + Intronic
1135940005 16:26814441-26814463 CTGCAGAAATGCAATGGAGATGG - Intergenic
1137390061 16:48073955-48073977 CTGCAGCAGTGGACACCAGCTGG + Intergenic
1138836460 16:60441946-60441968 CTACAGAACTGGATAGAAGAAGG - Intergenic
1139106493 16:63833015-63833037 CTGCACAAATAGAAAGCAGCAGG - Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142029407 16:87831086-87831108 CTGCAAATAAGGACAGCAGCTGG - Exonic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143063923 17:4228339-4228361 CTGCAGAAGTGGATGGCAAAAGG + Intronic
1143334671 17:6163267-6163289 CTGCAAAAATGGGCAGAGGAGGG - Intergenic
1143406107 17:6678093-6678115 CTGCAGAAAAGGACAGCGTGGGG + Intergenic
1145787201 17:27601895-27601917 TTCCAGCAATGGCCAGCAGATGG - Exonic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1149140451 17:53426973-53426995 CATCAGATATGGACAGCAAATGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1150447629 17:65239560-65239582 CTGCAAAACTTGACAGCTGAGGG + Intergenic
1151215112 17:72571820-72571842 CCCCAGAAATGCACAGCAGCTGG + Intergenic
1151359107 17:73577934-73577956 ATGCAGAAGAGGACGGCAGAAGG + Intronic
1151402371 17:73864250-73864272 CTGCAGAACCGGCCAGCAGCAGG + Intergenic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1155786934 18:29913692-29913714 CTCCTGAGATGGCCAGCAGAAGG - Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155940920 18:31801235-31801257 CTCCAGAACTGCACAGCAGAGGG - Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158254412 18:55529852-55529874 CTGCAGAAATGGCCACAAGGAGG - Intronic
1159968315 18:74618495-74618517 CTCCACAAATGAACATCAGAAGG - Intronic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161470793 19:4455998-4456020 CTGCAGTGGTGGACAGGAGAAGG - Intronic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
926893305 2:17657690-17657712 CTGGAGAGATGGCCAGCAGCGGG + Intergenic
927213373 2:20651912-20651934 CTGCAAACAGGGCCAGCAGAAGG + Intergenic
927441483 2:23121574-23121596 CTGCAGCACTGAAGAGCAGAGGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927973587 2:27321376-27321398 CTGCATGAATGGCCAGGAGATGG - Intronic
930323383 2:49882731-49882753 CTGCAGAAAGGGGCAGCTGTGGG + Intergenic
931137497 2:59420300-59420322 TTGCAGAATTGGACTCCAGATGG + Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
932734245 2:74243237-74243259 CTGCAGAACGGGGGAGCAGAAGG - Intronic
933231535 2:79813270-79813292 GTGCAAAAATAGACATCAGAAGG + Intronic
934656955 2:96121378-96121400 CTACAGAGATGGACAGGAGCAGG - Intergenic
935194426 2:100803967-100803989 CTCCATCTATGGACAGCAGAGGG + Intergenic
935341004 2:102059890-102059912 CTGCGGAGGTGGACTGCAGATGG + Intergenic
936099083 2:109559529-109559551 CTGAAGAAATGCTCAGCAAATGG + Intronic
937103108 2:119286740-119286762 CTGCAGGGAAGGACACCAGACGG + Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG + Intergenic
937862427 2:126721397-126721419 CTGCAAAATGGGACAGCAAATGG + Intergenic
938386368 2:130870096-130870118 CTGCAGGGGTTGACAGCAGAGGG - Intronic
939881722 2:147639267-147639289 ATGCAGAATAGGGCAGCAGAGGG - Intergenic
940274702 2:151927143-151927165 AGGCAGAAATGGATAGGAGAAGG + Intronic
941489548 2:166126371-166126393 CTCCTGAAATGCACAGCTGAGGG + Intronic
941899512 2:170664612-170664634 CAGCAGAAATGGCCAGAAGTAGG + Intergenic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
944233422 2:197418589-197418611 CTGCAGAAAAGAACAGCAACAGG + Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
947029644 2:225779268-225779290 CTGCAGGATTGCACAGCAGGTGG + Intergenic
948309752 2:236976281-236976303 TTGCAGAAATAGACAGCTAAGGG - Intergenic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1171445556 20:25201128-25201150 CACCAGAAATCAACAGCAGAAGG - Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173565449 20:44035277-44035299 CAGCAGGGATGGACAGCAAAAGG - Intronic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174169363 20:48606597-48606619 CTGCAGAAAGCGACAGTGGACGG + Intergenic
1174538757 20:51273295-51273317 CTGCAGGGATGTACAGCAGGAGG + Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1175262282 20:57682128-57682150 CTGGATAAATGAACAGAAGATGG + Intronic
1175447604 20:59034595-59034617 CTGCTGAAGTGTACAGCAGCAGG + Exonic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1177125108 21:17184563-17184585 GTGCAGAAGTGGTCAGCTGAAGG - Intergenic
1177828308 21:26108451-26108473 CTACAGTACTGGACAGCACACGG + Intronic
1179126751 21:38597976-38597998 CAGCAGAAATTGACAGCATTAGG + Intronic
1179144768 21:38758170-38758192 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1179144878 21:38759219-38759241 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1179167536 21:38946603-38946625 CTGCAGACATAGTCGGCAGATGG - Intergenic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1181635664 22:24173227-24173249 CTGCAGAAGTGCCCAGCAGAAGG + Intronic
1182886287 22:33776939-33776961 ATGCAGAGATGGTCAGCACATGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1184189277 22:42884196-42884218 CTGCAGAAACACTCAGCAGAGGG + Intronic
1184195972 22:42928340-42928362 CATCAGAAATGGACAGAAGGAGG + Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1184877501 22:47284719-47284741 CTGAGGAAATGGTCAGCAAATGG + Intergenic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
951062315 3:18223661-18223683 CTGCAGAAAGACACAGCAGCTGG - Intronic
951815575 3:26750458-26750480 CTGCAGAAATGGGGAGCTGGAGG - Intergenic
952423764 3:33153866-33153888 CCACAGAAATGGAGACCAGACGG + Exonic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953021245 3:39114751-39114773 CTGCACAAATGGGCAGCCAAGGG + Intronic
954258057 3:49419852-49419874 CTGCAGAGCTGGACAGTAGTAGG + Intronic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
956893072 3:73631670-73631692 ATGCAAATATGGACTGCAGAAGG - Intergenic
957864497 3:86004674-86004696 TTGCAGAAATAGCCAGCAGCAGG - Intronic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
958750077 3:98185326-98185348 CTGCTGAAAGGGACATCAGATGG + Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961217893 3:125175717-125175739 CTGCAGAGATGGCCCGCATATGG - Intronic
962215526 3:133517661-133517683 CTGCAGAGTTACACAGCAGAGGG - Intergenic
962705524 3:138039584-138039606 CTGCAGAAAGGTACAGCCAATGG + Intergenic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964248039 3:154677058-154677080 CTGCAGAAGGGGTCTGCAGAGGG - Intergenic
965554969 3:170009302-170009324 CTCCAGAAGTGGAGAGCTGAGGG + Intergenic
965879551 3:173372033-173372055 ATGCAGAAGAGGTCAGCAGATGG + Intergenic
966368500 3:179218778-179218800 CTGCAGAAATGCACTGCAACTGG - Intronic
968951520 4:3697081-3697103 ATTCAGTAATGGATAGCAGATGG - Intergenic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
973041978 4:45479479-45479501 CTGCATAAATGTACATCATAAGG - Intergenic
973698393 4:53513338-53513360 ATGAAGATATGGACAGTAGAAGG + Intronic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
975731013 4:77337254-77337276 CTTCAGAAATCCACAGGAGACGG + Intronic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
980484370 4:133436330-133436352 CTGAAAAGATGGACAGCAGCAGG + Intergenic
980902298 4:138916530-138916552 CTGCAGCAAGGAACTGCAGATGG - Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982131438 4:152232421-152232443 CTGCATAGATTGGCAGCAGAAGG - Intergenic
982331857 4:154189849-154189871 CTGCAGAAAAGGACAGTAGTAGG - Intergenic
982565044 4:156975429-156975451 CTGCAGAAATGGACTTTAGTTGG + Intergenic
985794388 5:1951417-1951439 ATGCACACATGCACAGCAGACGG - Intergenic
986309825 5:6543700-6543722 CTTCAAAAAGGGACAGAAGAGGG + Intergenic
986363128 5:7001505-7001527 CTGCTGAACTGGGCATCAGAGGG + Intergenic
986832431 5:11595155-11595177 CTGCTGAAATGGATTGCAGGAGG + Intronic
986955758 5:13147882-13147904 CTACTGTAATGGCCAGCAGAGGG - Intergenic
990723908 5:58731959-58731981 TTGCAGAAGTGGTTAGCAGAAGG + Intronic
991734414 5:69618665-69618687 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
991810848 5:70473800-70473822 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991859852 5:71003483-71003505 CTGCAGATAGGGGCAGCAGAGGG + Intronic
991873012 5:71128379-71128401 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
992770402 5:80042135-80042157 CTGAGGACATGGCCAGCAGATGG + Intronic
993062480 5:83055339-83055361 CAGCAGAGCTGGACAACAGATGG + Exonic
995074554 5:107966821-107966843 CTGCAAAACAGGAAAGCAGATGG - Intronic
995130987 5:108630286-108630308 GTGCAGAAATGTCCAGGAGAAGG - Intergenic
1002311992 5:178320487-178320509 CTGCAGAGCTGGGCAGCTGAGGG - Intronic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006676506 6:35768370-35768392 GTGCAGGAAGGGACACCAGAAGG - Intergenic
1008786669 6:55175913-55175935 CTGCTGAAAATGACAGGAGATGG + Intronic
1009936890 6:70245007-70245029 CTGCACAAATGGACAGCATGTGG + Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010767942 6:79797609-79797631 CTGCAGAAATGGATAACTGCTGG + Intergenic
1011424088 6:87206921-87206943 TTGCAGAAGTGGGCACCAGAAGG + Intronic
1011733525 6:90290766-90290788 CTGCAGAAAGTGACAGGGGAGGG + Intronic
1013876036 6:114829883-114829905 CTGGAGAGTTGGACAGCAGCTGG - Intergenic
1014867817 6:126553425-126553447 CTGTAGAAAGGGACAACACAAGG - Intergenic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1017691554 6:156970954-156970976 CTGCAGAAGCTGGCAGCAGAGGG - Intronic
1019141168 6:169944502-169944524 CTGCATAATGGGACACCAGAAGG + Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019435602 7:1020747-1020769 CTGCAGGGGTGGTCAGCAGACGG - Intronic
1019653115 7:2171477-2171499 CAGCAGAGAAGGACAGCAGCCGG + Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023275259 7:38512310-38512332 CTGCAGAAATGAGCTGCAGTTGG - Intronic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026562448 7:71461776-71461798 CTGCAGAACCGGACAGGAAAAGG - Intronic
1027221444 7:76216766-76216788 CTGCAGAATTGGACAGTAAAAGG - Intronic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1029540571 7:101179966-101179988 CCGCAGAATGGGGCAGCAGAAGG - Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030715311 7:112801784-112801806 CTGCAGGGATGTACAGCAGGTGG + Intergenic
1030856653 7:114565984-114566006 TTTCAGAAATGGACTGGAGAAGG + Intronic
1032311937 7:130795775-130795797 CTGAAGAAATGGCCATCTGAGGG - Intergenic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036110423 8:5894062-5894084 CTGCAGATATTGACAAAAGAAGG + Intergenic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1036486104 8:9180306-9180328 CTACAGACAGGGCCAGCAGAGGG + Intergenic
1036824581 8:11966217-11966239 TTGCAGAAATACACAGCACAGGG - Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1038401010 8:27284516-27284538 CTGGAGAAATGCACTGCAGCGGG + Intergenic
1038977983 8:32723147-32723169 CTGCAAAAATGGATACCAAAGGG - Intronic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1040937801 8:52799493-52799515 CAGCAGGATTGGACATCAGATGG - Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1041734280 8:61093520-61093542 CTGCAGAAATTTACAGCAAATGG + Intronic
1041924500 8:63222399-63222421 TTACACAAAAGGACAGCAGAGGG + Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1044809467 8:96043378-96043400 CTGCAGAACTTCACAGCAAAAGG + Intergenic
1044998875 8:97862917-97862939 CTGCAGAAATTGCCTGCAGTGGG - Intergenic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1045641656 8:104257968-104257990 TTGCAGAAATGTACAGCAAATGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046164770 8:110418049-110418071 CTGTAGAACTGTACAACAGAAGG + Intergenic
1047527333 8:125644746-125644768 CTGCAAAAATGATCAGCAGTGGG + Intergenic
1049286403 8:141777707-141777729 CTGCAGAAATGGACATTCCATGG - Intergenic
1049750017 8:144278601-144278623 CTGGAGACGTGGACAGCAGGAGG + Intronic
1050611530 9:7359059-7359081 CTGCAGAACTGGCCTGGAGAGGG + Intergenic
1051810996 9:21049319-21049341 CTGCTGAAAGAGAAAGCAGATGG - Intergenic
1051850367 9:21499730-21499752 CTGAAGAAGTTGACATCAGAGGG - Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1055806909 9:80105939-80105961 CTCAAGAAAAGGACAGTAGAAGG + Intergenic
1058013809 9:100007673-100007695 CTACAGGAATTGACAGAAGAAGG - Exonic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060927956 9:127468376-127468398 CAGGAGAGATGCACAGCAGAAGG + Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061974053 9:134059545-134059567 CTGCGGGAATGTGCAGCAGAAGG + Intronic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186659461 X:11654336-11654358 CTGTAGAAGTGGACAGCTCATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1195538969 X:106040562-106040584 AAGCAGAAATGAACAGCAGTAGG - Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1197477586 X:126943082-126943104 CTACCACAATGGACAGCAGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198675812 X:139128920-139128942 GTGCTGAAATAGACTGCAGAAGG - Intronic
1199226176 X:145377420-145377442 CAACAGAAATGGACACAAGATGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic