ID: 1142493881

View in Genome Browser
Species Human (GRCh38)
Location 17:295943-295965
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 3, 1: 6, 2: 8, 3: 61, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900008574 1:84474-84496 ATACAGAAAAGGAAAGCACAGGG + Intergenic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
901115153 1:6837513-6837535 TCTCAGAAATGGGAAGCAGATGG - Intronic
901188007 1:7387426-7387448 GGACAGAAATGGAAAACAGATGG - Intronic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902571592 1:17350630-17350652 CTGCAGAAATCCAAGGCTGAAGG + Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
902968412 1:20029162-20029184 CAGCAGATGTGGAAACCAGAAGG + Intronic
903801729 1:25973777-25973799 CTGCTGAAATAGGAACCAGATGG + Intronic
904293190 1:29500811-29500833 CTGCAGGGAGGGAAAGCGGAAGG - Intergenic
904754755 1:32762046-32762068 ATGAGGAAATGGAAACCAGAGGG - Intronic
905028725 1:34867620-34867642 CTCCAGGACTAGAAAGCAGAAGG + Exonic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
907767575 1:57425219-57425241 GTGCAGAAAAGGAAAGCAAGAGG + Intronic
908100297 1:60784190-60784212 CTGTAGAAATTGTAAACAGAAGG - Intergenic
908366098 1:63425234-63425256 CAGCAGAGAAGGAAAGCTGATGG + Intronic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910675212 1:89809309-89809331 CAGCAGGAAGGGAAAGCTGAAGG - Intronic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
911437091 1:97875042-97875064 ATGCAGAAATGAAAATCAAATGG + Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
912646062 1:111393242-111393264 CTGTATAAATGGTAGGCAGAAGG - Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914222658 1:145694418-145694440 ATGCTGAAATGGAAAATAGAAGG - Intronic
914404119 1:147353615-147353637 CTGCAAAAAAGGGAAGCAGCTGG + Intergenic
915715858 1:157944138-157944160 CTGCAGAGAAGGAAAGCATGGGG - Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
917112835 1:171568539-171568561 CATCTTAAATGGAAAGCAGATGG - Intronic
917910854 1:179643905-179643927 CTGCTGAAATCTAAAGCAAAAGG + Intronic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922580697 1:226695729-226695751 CAGCAGAATTGGAAGACAGATGG + Intronic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
922808895 1:228405220-228405242 CTGCTAAAATCCAAAGCAGAAGG + Intronic
923112168 1:230900291-230900313 ATACAGAAAGGGAAAGAAGAAGG + Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924040857 1:239982377-239982399 CTCCAGGAATGGAAACCACATGG - Intergenic
924940810 1:248811589-248811611 GAGCAGAAAGGGAAAGCAAAGGG + Exonic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1063293243 10:4773441-4773463 CTGCAGAAAATGGAAGCAGAAGG + Intergenic
1063464285 10:6232959-6232981 CTGCAGAAATGGAAATGGAATGG - Exonic
1063858251 10:10279107-10279129 TTGCAAAAATGGACACCAGAAGG - Intergenic
1063861307 10:10310817-10310839 CTTCAGAAAGTGAGAGCAGATGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064969448 10:21049344-21049366 CTCCAAAAATGCAAAGCAGCGGG - Intronic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1067189906 10:44060427-44060449 CTGCAGAAAAGGAAATCTCAGGG + Intergenic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1068263701 10:54619577-54619599 ATGCAGAGATGTTAAGCAGAGGG + Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1070154246 10:73823997-73824019 CTGCTGACCTGGAAAGCAGGAGG + Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1070925327 10:80217095-80217117 CTGAAACAATGGAAAGCACATGG - Intergenic
1071048264 10:81412037-81412059 AGGCAGAAATGGAAGACAGAAGG + Intergenic
1071249960 10:83807515-83807537 CTGCAGCATTGAAAAGCAAATGG + Intergenic
1071743384 10:88387816-88387838 CAGCAGAAAAGAAAATCAGAAGG + Intronic
1071770613 10:88725769-88725791 CTGCAGATATACAAAGAAGAGGG - Intronic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1075300840 10:121322831-121322853 CTGCAGAAAACCAAGGCAGAGGG - Intergenic
1075716068 10:124556137-124556159 CTGAAGAAGTGAAAGGCAGAGGG + Intronic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1076634672 10:131874369-131874391 CTCCAGAAATGCAAAGTTGAGGG + Intergenic
1076772694 10:132675221-132675243 CTGCAGAAATGGTAACCGCAGGG + Intronic
1077872513 11:6273662-6273684 CTCAAGAAATGGAAAATAGATGG - Intergenic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1079819968 11:25113960-25113982 CTACAGATAGGAAAAGCAGAAGG - Intergenic
1079821124 11:25130348-25130370 CTTCCGAAATGGAAAACAGCAGG - Intergenic
1081430251 11:42968856-42968878 CTACAGAAAGGTAAAGCAGCAGG - Intergenic
1081447525 11:43145192-43145214 CTCAAGAATTGGAAGGCAGAAGG - Intergenic
1084955666 11:72690026-72690048 CTGCAGGCATGGAAAACACAAGG + Intronic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1086416776 11:86596810-86596832 TTACAGAAAAGGAGAGCAGAAGG - Intronic
1086617039 11:88833625-88833647 CTGAAGAAAAGGAAATCAGTAGG + Intronic
1086646425 11:89227408-89227430 CTCCAGAACTGGAAAGCAAGGGG + Intronic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087243170 11:95803409-95803431 CTCCAGAAAAAGAAAGTAGAGGG + Intronic
1087368268 11:97248839-97248861 CTGCAGAAAGGGAACCCACAAGG - Intergenic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1088398518 11:109396262-109396284 CTCAAGAAAAGGAAAGCTGAAGG + Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089653476 11:119930494-119930516 ATCAAGAAATGGCAAGCAGAAGG - Intergenic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1091651716 12:2315301-2315323 TGGCACAAAAGGAAAGCAGACGG - Intronic
1091983513 12:4886564-4886586 CAGCAGAAATGGCAAACAGCAGG + Intergenic
1092088088 12:5781726-5781748 CTGCATAAATGCAAGGCAGCAGG + Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092784695 12:12016672-12016694 CTGCAGACATGGGAACCACACGG + Intergenic
1093744384 12:22722917-22722939 GAGCAAAAATGGAAAACAGAGGG + Intergenic
1093966976 12:25338219-25338241 CTGAAGGAATGGAAAATAGATGG - Intergenic
1094071562 12:26420463-26420485 CTTCAGAAATTGAAAGGAAAAGG - Intronic
1094364859 12:29669404-29669426 CTGCACTATTGGAAATCAGATGG - Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1096419472 12:51444622-51444644 CTGCAGAAAGGGACTACAGAAGG - Intronic
1096900798 12:54879335-54879357 CAGTAATAATGGAAAGCAGAAGG + Intergenic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1099812996 12:87608673-87608695 CTACAGGAAGGGAAAGCAAAGGG + Intergenic
1099972927 12:89518140-89518162 CAGCAGAAATGAAAATTAGAGGG - Intronic
1100388886 12:94129724-94129746 CTTCCGATATGGAAAGCTGATGG - Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1100864924 12:98847254-98847276 GGGCAGAAATGGAAAGGTGATGG - Intronic
1100918710 12:99457162-99457184 CTGCATAAATGAAAAAAAGATGG + Intronic
1101488682 12:105192223-105192245 CGGCAGAGATGAAAAGTAGATGG - Intronic
1101581781 12:106048364-106048386 TTGCAGAAGGGGAATGCAGAAGG - Intergenic
1102060982 12:109930876-109930898 CTGCAGAAAAGGCTATCAGATGG + Exonic
1102885317 12:116517415-116517437 CTGCAGAACTTCAAAGCTGAAGG - Intergenic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1104683549 12:130768948-130768970 TTACAGAAATGGAAATCACATGG - Intergenic
1104731855 12:131110639-131110661 AACCAGAAATGGAAATCAGAAGG - Intronic
1104875365 12:132030015-132030037 CTTCAGAAATTGAAATCTGAAGG + Exonic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1105964622 13:25372713-25372735 CTGCAGAGCTCAAAAGCAGAGGG + Intronic
1106578427 13:30997545-30997567 CTGCCGAAATGGGGAGCTGAGGG + Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109162472 13:58992636-58992658 CAACAGAAATGGTAACCAGAGGG + Intergenic
1109518475 13:63476408-63476430 ATTCAGAAGTGGAAAGGAGAAGG - Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110838874 13:80118293-80118315 CTCCTAAAATGAAAAGCAGATGG - Intergenic
1111014124 13:82355118-82355140 CAACAAAAATGGAAAGCACAAGG - Intergenic
1111367794 13:87272369-87272391 TTGCAGAGATAGAAAGCATAAGG - Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1112298669 13:98210935-98210957 CAGCAGCAATGGAAATCAAAAGG - Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112938254 13:104827580-104827602 CTGCATACATGGAAAGTACATGG - Intergenic
1113813656 13:113157428-113157450 CTTCAGGAAGGGAAAGCTGATGG - Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115217515 14:31027078-31027100 TTCCAGAAAAGGAAAGAAGAGGG - Intronic
1115535435 14:34368720-34368742 CTGCAGAGAAGTAAAACAGATGG - Intronic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1117973327 14:61273606-61273628 TTGCAAAAATGAATAGCAGATGG - Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118160568 14:63285658-63285680 CTACAGTAATAGAAAGAAGAGGG - Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1119140626 14:72264025-72264047 CTGCAGAAATGTTAATGAGATGG - Intronic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1119745273 14:77039384-77039406 CTGCAGAGTTGTAAAGCAAAGGG - Intergenic
1120460294 14:84786662-84786684 CTGCTGACATGGAAGGTAGAAGG + Intergenic
1120944246 14:89978826-89978848 TTTCACAAATGGAAAGAAGATGG + Intronic
1121592886 14:95132533-95132555 CAGCAGAAATGGAAAAAGGACGG - Exonic
1121745090 14:96282479-96282501 CTGAAGCAAAGCAAAGCAGAGGG + Exonic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1122788011 14:104172830-104172852 CTGCCGAACTGAAAGGCAGAGGG + Intronic
1122851583 14:104535903-104535925 CTCCAGAAAAGAGAAGCAGAGGG - Intronic
1123901921 15:24885959-24885981 ATGCAGAAACAGAAACCAGACGG - Intronic
1125305221 15:38304682-38304704 CTGCTGAAATGAAGACCAGAAGG - Intronic
1125375558 15:39025104-39025126 ATGCAGAAGTGAAAAGGAGAGGG + Intergenic
1125462217 15:39918223-39918245 CTACAAAAATGGAAAGGACATGG + Intronic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126576591 15:50203274-50203296 CTGCAGAAGTTTAAAGCTGATGG - Intronic
1126811073 15:52404617-52404639 CTACAATAAAGGAAAGCAGAAGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1129531024 15:76264845-76264867 ATGTAGAAATGGAAATCAAAAGG + Intronic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1131894588 15:97012620-97012642 ATGCAGAAAGGGGAAGCGGAAGG - Intergenic
1131931391 15:97446356-97446378 CTTCAGATAAGGAAAGCAGCAGG + Intergenic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1133342932 16:5049032-5049054 CCACATAAATGGAAACCAGAAGG + Intronic
1134777954 16:16869217-16869239 CTGCAGAAAAGCAAAGGAAAAGG - Intergenic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1135106867 16:19657413-19657435 CTGCAGAAATGGGAAGGCCAAGG - Intronic
1135336854 16:21608992-21609014 CTGAATAAATGGGAAGCATAGGG - Intronic
1135666787 16:24342483-24342505 AGGCAAAAATGGAAAGCAAAGGG - Intronic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1135940005 16:26814441-26814463 CTGCAGAAATGCAATGGAGATGG - Intergenic
1137366081 16:47860862-47860884 ATGCAGAAATGGAAAGAATGTGG - Intergenic
1137906650 16:52330147-52330169 ATGCAGAAACGTGAAGCAGAGGG - Intergenic
1138836460 16:60441946-60441968 CTACAGAACTGGATAGAAGAAGG - Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139106493 16:63833015-63833037 CTGCACAAATAGAAAGCAGCAGG - Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142772669 17:2110603-2110625 AAGCAGCAAAGGAAAGCAGACGG + Intronic
1143063923 17:4228339-4228361 CTGCAGAAGTGGATGGCAAAAGG + Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1148354820 17:46968806-46968828 CTGCAGTCATTGAATGCAGAAGG + Intronic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1150591474 17:66566316-66566338 GTCCAGAAGTGGAAAGAAGATGG + Intronic
1154094889 18:11404089-11404111 CTGAAGAAAATGATAGCAGATGG + Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155940920 18:31801235-31801257 CTCCAGAACTGCACAGCAGAGGG - Intergenic
1157127887 18:44974433-44974455 CTGCAGAAAGGCAAAGAGGAGGG + Intronic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158081594 18:53598960-53598982 ATGCAGAAATGCTAAGCACAAGG + Intergenic
1158465907 18:57689715-57689737 CTGCAGAAAATCAAAGCAGGGGG + Intronic
1158585715 18:58732214-58732236 CTCCAGATATTGCAAGCAGAGGG + Intronic
1158769524 18:60498353-60498375 CTGCTGAAATAGAAGGCAGGAGG + Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159369204 18:67509892-67509914 CTGCAAAAGTTGAAAGCAAATGG - Exonic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160110193 18:76020524-76020546 CTTCTGAAAAGGAAAGCAGCAGG + Intergenic
1160349968 18:78169656-78169678 CTGCTGAAACAAAAAGCAGAAGG - Intergenic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1162693440 19:12452550-12452572 ATGTAGAAAAGGAAATCAGAAGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
1167303461 19:48693660-48693682 AAGCTGAAATGGAAAACAGAGGG + Intergenic
1167728961 19:51239067-51239089 CTGCAGTACTGGAAATCACAGGG + Intronic
1168024234 19:53632171-53632193 GTGAAGAAGTGGAAAGCAGCTGG + Intronic
925488573 2:4366418-4366440 CTGCACAAATGGAAGCCAAAAGG - Intergenic
927060819 2:19417514-19417536 CTACGGAAGTGGAATGCAGAAGG + Intergenic
927333326 2:21891589-21891611 CAGCAAAAATAGAAAGCAAATGG - Intergenic
927441483 2:23121574-23121596 CTGCAGCACTGAAGAGCAGAGGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928128103 2:28629969-28629991 CTGCAAAAATGGGAACCAGCTGG - Intronic
930774167 2:55156527-55156549 TTGCATAAATGGAAAGGAGCAGG - Intergenic
931188145 2:59973645-59973667 CAGCAGAACTGGCAAGCGGAGGG + Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931561940 2:63571363-63571385 CTCCAGAAATGGTAAGTATATGG - Intronic
931674944 2:64685302-64685324 CTCCAAAAATGGAATTCAGAAGG + Intronic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932734245 2:74243237-74243259 CTGCAGAACGGGGGAGCAGAAGG - Intronic
932947520 2:76253746-76253768 TTACAGAAATAGAAAGTAGAAGG + Intergenic
937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG + Intergenic
938341275 2:130538151-130538173 CTGCACTCATGGAAAGCACAAGG + Intergenic
938348556 2:130582558-130582580 CTGCACTCATGGAAAGCACAAGG - Intronic
938739804 2:134220407-134220429 CTGCACTAATGGAAAGGAGCAGG + Intronic
939264215 2:139850838-139850860 TGGCAGAAAAGGAAAGTAGAGGG - Intergenic
940274702 2:151927143-151927165 AGGCAGAAATGGATAGGAGAAGG + Intronic
940721812 2:157290758-157290780 ATGCAGAAATAGAAGTCAGATGG + Intronic
941499989 2:166262297-166262319 CTGAATAAATGGAAAGGAAAGGG + Intronic
941873832 2:170413315-170413337 CTACAGCACTGGAAAGGAGAAGG + Intronic
942018327 2:171840623-171840645 CAGCAGAAATAGAAAATAGAAGG + Intronic
942179117 2:173362933-173362955 CTAAAGAAATGAAAAGCAGGTGG + Intronic
943057476 2:182999992-183000014 CTCCAGAAGTGGGAAGGAGAGGG + Intronic
943079762 2:183244632-183244654 CTGCTGATAGAGAAAGCAGATGG + Intergenic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
944113396 2:196160200-196160222 ATGCAGAAGGGGAATGCAGAAGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945179238 2:207074969-207074991 TTGGAGAAAGGGAAAGCAAAAGG - Exonic
945682297 2:212928592-212928614 AGGCAGAAAAGGGAAGCAGATGG + Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946620685 2:221559608-221559630 CTTTAGAAATAGTAAGCAGAAGG - Intronic
946636262 2:221730865-221730887 CAGCAAAGATGAAAAGCAGAAGG + Intergenic
949058556 2:241943288-241943310 CTGCAGAAAGGGACTGCAGAGGG - Intergenic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1171172655 20:23029236-23029258 GTGCAGAAATGGAAAGGCCATGG - Intergenic
1171382227 20:24742561-24742583 CAGCAGAACTGGGAAGCGGAAGG - Intergenic
1172408689 20:34707025-34707047 CTGCAGAAATGGAAACACCAAGG - Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173633720 20:44536445-44536467 CAGCGGAAAGGGAAAGGAGAGGG + Intronic
1173806201 20:45926954-45926976 CTGGAGAAATGGAAAGCCTTAGG + Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174183871 20:48691782-48691804 CTGCAGCAATGGAAACCAACAGG + Intronic
1174441639 20:50560273-50560295 CTGGAAAAATGTAAACCAGAAGG - Intronic
1174705056 20:52646960-52646982 GTGCTGAAATGGGAAGTAGAAGG - Intergenic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175631471 20:60541574-60541596 CAGCAGAAATGCAAAAGAGATGG - Intergenic
1175656413 20:60774987-60775009 TTGCAGAAATTGGAGGCAGAAGG + Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175776234 20:61655567-61655589 CTTCAGGAAGGGGAAGCAGAAGG + Intronic
1175840773 20:62025812-62025834 CTGCAGTGACAGAAAGCAGATGG + Intronic
1177683600 21:24408499-24408521 AAGCAGAAATGGAAAGAAAATGG + Intergenic
1179661507 21:42879007-42879029 CTGCAGAACTGGGAAGAAGCGGG - Intronic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1180902786 22:19386699-19386721 CTTGGGAAATGGTAAGCAGATGG + Intronic
1181416356 22:22762257-22762279 CTGCAGGAGAGGAAAGGAGAGGG - Intronic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1181635664 22:24173227-24173249 CTGCAGAAGTGCCCAGCAGAAGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183085150 22:35482412-35482434 GTGCAAAAATTGAAAGCAGCAGG - Intergenic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949448791 3:4163883-4163905 CTGTAGAAATGGAAAATATATGG - Intronic
949454909 3:4228054-4228076 CTGCAGGAACTAAAAGCAGAAGG + Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
950395993 3:12734543-12734565 CTGCAAGGATGGAAGGCAGAGGG - Exonic
951043333 3:18012068-18012090 CTCCACACATGCAAAGCAGATGG - Intronic
951815575 3:26750458-26750480 CTGCAGAAATGGGGAGCTGGAGG - Intergenic
952366808 3:32682144-32682166 CTGCTGATACGGAAAGTAGAGGG + Intergenic
952423764 3:33153866-33153888 CCACAGAAATGGAGACCAGACGG + Exonic
952722651 3:36549292-36549314 CTGCAGAAATTAAAAGCACAAGG + Intergenic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953785094 3:45905582-45905604 CTGAAGAACTGGCAACCAGAGGG - Intronic
954164902 3:48748927-48748949 CTCCAGGAAGCGAAAGCAGAAGG - Exonic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
955855800 3:63272104-63272126 CGACAGCAATGGAAAGGAGATGG - Intronic
956384931 3:68706371-68706393 CCCCAGTAAGGGAAAGCAGACGG - Intergenic
956931191 3:74045191-74045213 CTGGATAAATTGAAAACAGATGG - Intergenic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
958472405 3:94537393-94537415 CTGAAGACATGGAAATCAAATGG - Intergenic
958750077 3:98185326-98185348 CTGCTGAAAGGGACATCAGATGG + Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960259544 3:115550669-115550691 CAGAGTAAATGGAAAGCAGATGG + Intergenic
960531871 3:118774280-118774302 ATGCAGAAAAGCAAAGCAGCAGG + Intergenic
961170738 3:124796193-124796215 GTGCAGAATACGAAAGCAGAAGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
963958328 3:151280203-151280225 ATGGAGAAATGGAAAGCTAAAGG + Intronic
965467758 3:169053558-169053580 ATCCAGGAGTGGAAAGCAGAGGG - Intergenic
965554969 3:170009302-170009324 CTCCAGAAGTGGAGAGCTGAGGG + Intergenic
965853727 3:173063351-173063373 ATGCAAAAGTGGAAAGAAGAAGG + Intronic
966274108 3:178143604-178143626 CTGCAGAAAGAGAAAGAAGTGGG - Intergenic
966474887 3:180333115-180333137 CTGCAGAAGAGGAAAGGAAAAGG + Intergenic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
966680594 3:182637989-182638011 CTGCTGACATGGCAAGCAAAAGG + Intergenic
967075182 3:185995444-185995466 CTGCAGAACTGGGAGACAGAGGG + Intergenic
967215807 3:187209239-187209261 CCTATGAAATGGAAAGCAGAGGG - Intergenic
967847821 3:194058148-194058170 CTGCAGAAAAGAAAAAAAGAAGG + Intergenic
968951520 4:3697081-3697103 ATTCAGTAATGGATAGCAGATGG - Intergenic
969108217 4:4824067-4824089 TTGCAGTAAGGGAATGCAGAGGG + Intergenic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970266800 4:14297247-14297269 CTGCTGAAAGGTCAAGCAGAAGG + Intergenic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
971658352 4:29379497-29379519 CTTCACAAAGGGAAAGCAAAGGG + Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972857652 4:43126460-43126482 ATGCGGAAATGGAAAGGAGTGGG + Intergenic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
974088161 4:57282936-57282958 TATCAGAAGTGGAAAGCAGAGGG - Intergenic
974439619 4:61899322-61899344 TTGCAGAAATGGAAAGAGGTAGG - Intronic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
975225658 4:71868659-71868681 TTGCAGTTGTGGAAAGCAGAAGG + Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975692754 4:76982179-76982201 TTGCAGAAAGGGAATGGAGATGG - Intronic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
975990992 4:80260009-80260031 CTACTGAAATGAAAAGCAAATGG + Intergenic
977061637 4:92265494-92265516 CTGAATAAATGTAATGCAGATGG - Intergenic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
979611753 4:122696877-122696899 CTTAAGTAATAGAAAGCAGAAGG + Intergenic
979625419 4:122839684-122839706 CTGCAGAAATGAAATGGACAGGG - Intronic
980501326 4:133657987-133658009 CAGCAGAAATGGAAAAGAAATGG + Intergenic
981180667 4:141739836-141739858 CTGCATCAATGGAAATCATATGG - Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982112948 4:152072828-152072850 CTGCAGAAAAGGAAGGCACCAGG + Intergenic
982331857 4:154189849-154189871 CTGCAGAAAAGGACAGTAGTAGG - Intergenic
983344037 4:166503054-166503076 ATGCAGAAAAGGAAAGCTGCAGG - Intergenic
984863607 4:184261463-184261485 CTGCAGAAGAGGAAAGGAGCTGG - Intergenic
986353373 5:6901200-6901222 CTGAAGAAATAAAAAACAGATGG - Intergenic
986639621 5:9859322-9859344 CTGCAGAAAGAAAAAGCTGAAGG + Intergenic
986832431 5:11595155-11595177 CTGCTGAAATGGATTGCAGGAGG + Intronic
987244020 5:16029944-16029966 CTGCTAAAATAGAAAACAGATGG - Intergenic
987812167 5:22851724-22851746 CTTCAGAATTGAAAGGCAGATGG - Intronic
988866373 5:35339483-35339505 AATCTGAAATGGAAAGCAGATGG + Intergenic
989041387 5:37233135-37233157 CTCCAGAAAGGGAAAACACATGG + Intronic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
990137996 5:52670486-52670508 CTGCAGCAGTGGAATACAGAGGG + Intergenic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
990723908 5:58731959-58731981 TTGCAGAAGTGGTTAGCAGAAGG + Intronic
991502046 5:67286781-67286803 CAACAGAAATGGGAAGCAGGAGG + Intergenic
991734414 5:69618665-69618687 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
991810848 5:70473800-70473822 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991859852 5:71003483-71003505 CTGCAGATAGGGGCAGCAGAGGG + Intronic
991873012 5:71128379-71128401 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
995074554 5:107966821-107966843 CTGCAAAACAGGAAAGCAGATGG - Intronic
995250776 5:109991019-109991041 CTGAAGAACTGGAACACAGATGG + Intergenic
995455534 5:112347968-112347990 GTGCAGATATGGTAAGCAGTAGG - Intronic
995512589 5:112923272-112923294 TTGCAGAAGTGGAAGGCAGTAGG - Intergenic
996929060 5:128864305-128864327 CTGCTGATATGGAAATTAGAAGG - Intronic
998867704 5:146521918-146521940 GTGCAGAACTGCAAAGCTGAGGG - Intergenic
999181999 5:149676308-149676330 GGGGAGAAATGGGAAGCAGAGGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999737312 5:154522311-154522333 CTGCAGGAAGGAGAAGCAGATGG - Intergenic
999783285 5:154868664-154868686 CAGCATAAATGGAAAGGAGTGGG - Intronic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1002958388 6:1891171-1891193 CTGTAGAAATGGAAACCACGTGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1004005261 6:11632272-11632294 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004005604 6:11634658-11634680 CTGCTGAAATGAAAAGAAAAGGG - Intergenic
1004169294 6:13283552-13283574 CTGCAGACAAAGTAAGCAGAGGG + Exonic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006065423 6:31458127-31458149 CACCAGAAATGGTAAGCACATGG - Intergenic
1006200666 6:32287064-32287086 CTGCATCAATGGAAGGGAGATGG + Intergenic
1007028425 6:38602752-38602774 AGACAGAAATGGCAAGCAGAAGG + Intronic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1008627113 6:53327488-53327510 CTACAGAGACAGAAAGCAGATGG + Intronic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009936890 6:70245007-70245029 CTGCACAAATGGACAGCATGTGG + Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010145287 6:72661544-72661566 CTGAATAAATGGAAAACATATGG - Intronic
1010544350 6:77131465-77131487 CAGCAGAATGGCAAAGCAGAAGG - Intergenic
1010745771 6:79559842-79559864 CTACACAAATGTAAAGCAAATGG + Intergenic
1010762214 6:79736376-79736398 CTGCCAAAATGGAAATCAGGAGG - Intergenic
1010767942 6:79797609-79797631 CTGCAGAAATGGATAACTGCTGG + Intergenic
1010908205 6:81519595-81519617 CTGAACAGCTGGAAAGCAGATGG - Intronic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1011454309 6:87530745-87530767 CTGCATCATGGGAAAGCAGAAGG + Intronic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013468852 6:110442673-110442695 CTGCAAAAAAGGAATGCAAATGG + Exonic
1013610360 6:111788917-111788939 CTGCAGGCAGGGGAAGCAGATGG - Intronic
1013697536 6:112721612-112721634 CTCCAGAGATAGAAAGCACATGG - Intergenic
1014855006 6:126389472-126389494 TTGCAGAAATGGAAAAGAAAAGG - Intergenic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1016683143 6:146853412-146853434 TTACAGAAACAGAAAGCAGAAGG - Intergenic
1017828855 6:158106147-158106169 CTTCATTAATGGAAGGCAGAAGG - Intergenic
1019174649 6:170153967-170153989 CTGCAGACATGGAAGCCAGCAGG + Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020908549 7:14097852-14097874 CAGCAGAAATGAAATGCATAAGG - Intergenic
1021649043 7:22815177-22815199 ATGAAGAAATGAAAAGCAGTAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022190905 7:28016134-28016156 CTGCAGCAAAGAAAGGCAGAGGG - Intronic
1022445726 7:30469328-30469350 CCTCAGAATTTGAAAGCAGATGG + Intronic
1022744574 7:33157463-33157485 CTGAAGAAATGAAAGACAGAAGG - Intronic
1024011684 7:45272133-45272155 ATGTAGAAATGGTAAGGAGAAGG - Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026213962 7:68331807-68331829 ATGCAGAAAGAGAAAGCTGAGGG + Intergenic
1027221444 7:76216766-76216788 CTGCAGAATTGGACAGTAAAAGG - Intronic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1028848201 7:95506588-95506610 CTGCAGTACTGGAAACTAGAAGG - Intronic
1029032384 7:97482459-97482481 ATACAGAAAGGGTAAGCAGAAGG + Intergenic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1031695943 7:124854326-124854348 CTGAATAATTGGAAAGCAAAGGG + Intronic
1031823423 7:126532940-126532962 CAGCAGAAAAGGTAAGTAGAAGG - Exonic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1035955497 8:4073728-4073750 TTGCTGAAATGGAAAACAGCTGG - Intronic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1036729355 8:11248707-11248729 CTGCAACAATGCAAAGGAGAAGG - Intergenic
1036960659 8:13241422-13241444 CTGAGGAAAAGGAAACCAGAGGG - Intronic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037109204 8:15145617-15145639 CTGAAGAAAAGAAAATCAGATGG - Intronic
1037715584 8:21394704-21394726 CTGCAGAGAGGGAACGCAGCGGG - Intergenic
1038556337 8:28520813-28520835 CTGAAGATATGGAATGCAGTAGG + Exonic
1038977983 8:32723147-32723169 CTGCAAAAATGGATACCAAAGGG - Intronic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039332458 8:36553492-36553514 CTGTAGAAATGGAAAGTTGCAGG + Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1039888386 8:41668541-41668563 CTGCAGGACTGGGATGCAGACGG - Exonic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1041015230 8:53586315-53586337 CTGCACACATGTAAAGCAGTGGG + Intergenic
1041131767 8:54709350-54709372 CTTCAGGAAGGGAAAACAGAAGG - Intergenic
1041629866 8:60075152-60075174 CTGCTGAAAGTGGAAGCAGAAGG + Intergenic
1041734280 8:61093520-61093542 CTGCAGAAATTTACAGCAAATGG + Intronic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1042881681 8:73499502-73499524 CTGCAGAAAAGGCAAGTAGGAGG + Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043236636 8:77876291-77876313 CAGGAGAAATGGAAATCACAGGG + Intergenic
1043389636 8:79779855-79779877 CTTCAGGAATGGAAAGAATAAGG + Intergenic
1043518572 8:81019684-81019706 CTGCAGGAGTGGCAAGCTGATGG + Intronic
1044491393 8:92820765-92820787 TTGCAGAAATGGAATGCATGTGG + Intergenic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1045641656 8:104257968-104257990 TTGCAGAAATGTACAGCAAATGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046421822 8:113995303-113995325 CAGTAGAAATGGAAAACAGCTGG - Intergenic
1046428099 8:114082903-114082925 CTGTTGAAATTTAAAGCAGAAGG + Intergenic
1047382532 8:124376491-124376513 CTACAGAAATGGAAGATAGAAGG + Intergenic
1048206646 8:132420766-132420788 CTCCAGAAATGCAAAACACATGG - Intronic
1048223667 8:132565373-132565395 CTCAAGAAAAGGAAATCAGAAGG + Intergenic
1048524714 8:135191551-135191573 TTGCAAGAATGGGAAGCAGAAGG - Intergenic
1049081991 8:140450728-140450750 CATCAGAAAGGGAAAGCACAGGG - Intronic
1050799231 9:9588228-9588250 CAGCAGAATTGGAAGACAGAAGG + Intronic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051367556 9:16331919-16331941 CAGTAGAAAAGGAAAGCAAAGGG + Intergenic
1051682774 9:19624752-19624774 CTACATAAAAGGAAAGTAGAGGG - Intronic
1051810996 9:21049319-21049341 CTGCTGAAAGAGAAAGCAGATGG - Intergenic
1051811762 9:21057271-21057293 TGGCAGATATGGAAAACAGAAGG - Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054871306 9:70049339-70049361 GTGCAGAACTGAAACGCAGATGG - Intronic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1058017393 9:100050118-100050140 CTCCAGTGATGGAAAGTAGATGG + Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060336336 9:122726693-122726715 CTTCAGAAGTGGAAACCACATGG + Intergenic
1061001777 9:127906713-127906735 CTGCAAAACAGGAAGGCAGAGGG - Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1186185796 X:7018563-7018585 TTGCAGAAATGAAAAACACATGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187191145 X:17036574-17036596 CTCCAGAACTGGGAAGCAGCTGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187587879 X:20684093-20684115 CTGAAAAAATGAAAAGTAGATGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189716214 X:43869372-43869394 CTACAGCAATGCAAAGCAGTTGG - Intronic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1190256280 X:48765108-48765130 CTGCAGAATGGGAAAGGAGGGGG + Intronic
1190260341 X:48793323-48793345 ATGAAGACAGGGAAAGCAGAGGG - Intronic
1190557785 X:51653874-51653896 ATACACAAATGGAAATCAGAAGG - Intergenic
1190711781 X:53076839-53076861 CAGCACAAAGGGGAAGCAGACGG - Exonic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1193118966 X:77803431-77803453 TTGCAGAAAAGGAAATAAGAAGG - Intergenic
1193282007 X:79663229-79663251 TTGCAGAAAAGAAAAGCAGTTGG - Intergenic
1194402456 X:93455721-93455743 CTGCCCAAAAGGAATGCAGAGGG + Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196653659 X:118194610-118194632 ATGAAGAAAAGCAAAGCAGACGG + Intergenic
1197105411 X:122707984-122708006 TTCCAAAAATGTAAAGCAGAAGG + Intergenic
1197222806 X:123929792-123929814 CTGCTGAAATCTAAAGGAGAAGG - Intergenic
1198144258 X:133839143-133839165 CTCCAGAAAGGAAAAGTAGATGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198956295 X:142135484-142135506 CTTCAGAAAAGGAAGCCAGAAGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199826463 X:151505224-151505246 CTGCAAAAATGGAAATCTTAAGG - Intergenic
1199971913 X:152867565-152867587 CTGCAGAAATGGGAAGAACTTGG + Exonic
1200735572 Y:6790400-6790422 CTTCAGAAATGAAAAGAAAAGGG - Intergenic