ID: 1142495965

View in Genome Browser
Species Human (GRCh38)
Location 17:306440-306462
Sequence GGTCACGGTCTCCTCGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142495965_1142495973 5 Left 1142495965 17:306440-306462 CCTGCAACGAGGAGACCGTGACC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1142495973 17:306468-306490 GGTGGTTTTGCTAATCAGCTGGG 0: 1
1: 0
2: 7
3: 21
4: 149
1142495965_1142495972 4 Left 1142495965 17:306440-306462 CCTGCAACGAGGAGACCGTGACC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1142495972 17:306467-306489 AGGTGGTTTTGCTAATCAGCTGG 0: 1
1: 0
2: 3
3: 65
4: 129
1142495965_1142495974 12 Left 1142495965 17:306440-306462 CCTGCAACGAGGAGACCGTGACC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1142495974 17:306475-306497 TTGCTAATCAGCTGGGTGCTTGG 0: 1
1: 1
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142495965 Original CRISPR GGTCACGGTCTCCTCGTTGC AGG (reversed) Intronic