ID: 1142495965 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:306440-306462 |
Sequence | GGTCACGGTCTCCTCGTTGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 47 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 44} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142495965_1142495973 | 5 | Left | 1142495965 | 17:306440-306462 | CCTGCAACGAGGAGACCGTGACC | 0: 1 1: 0 2: 1 3: 1 4: 44 |
||
Right | 1142495973 | 17:306468-306490 | GGTGGTTTTGCTAATCAGCTGGG | 0: 1 1: 0 2: 7 3: 21 4: 149 |
||||
1142495965_1142495972 | 4 | Left | 1142495965 | 17:306440-306462 | CCTGCAACGAGGAGACCGTGACC | 0: 1 1: 0 2: 1 3: 1 4: 44 |
||
Right | 1142495972 | 17:306467-306489 | AGGTGGTTTTGCTAATCAGCTGG | 0: 1 1: 0 2: 3 3: 65 4: 129 |
||||
1142495965_1142495974 | 12 | Left | 1142495965 | 17:306440-306462 | CCTGCAACGAGGAGACCGTGACC | 0: 1 1: 0 2: 1 3: 1 4: 44 |
||
Right | 1142495974 | 17:306475-306497 | TTGCTAATCAGCTGGGTGCTTGG | 0: 1 1: 1 2: 0 3: 12 4: 169 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142495965 | Original CRISPR | GGTCACGGTCTCCTCGTTGC AGG (reversed) | Intronic | ||