ID: 1142496547

View in Genome Browser
Species Human (GRCh38)
Location 17:309410-309432
Sequence GGCTCCTGCCAGCCCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 2, 1: 2, 2: 7, 3: 73, 4: 456}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142496540_1142496547 -8 Left 1142496540 17:309395-309417 CCCCGCCCTGCCCAGGGCTCCTG 0: 2
1: 2
2: 13
3: 137
4: 1025
Right 1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG 0: 2
1: 2
2: 7
3: 73
4: 456
1142496541_1142496547 -9 Left 1142496541 17:309396-309418 CCCGCCCTGCCCAGGGCTCCTGC 0: 2
1: 3
2: 21
3: 179
4: 1143
Right 1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG 0: 2
1: 2
2: 7
3: 73
4: 456
1142496537_1142496547 12 Left 1142496537 17:309375-309397 CCTTAGGAAAATGGCATGTACCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG 0: 2
1: 2
2: 7
3: 73
4: 456
1142496542_1142496547 -10 Left 1142496542 17:309397-309419 CCGCCCTGCCCAGGGCTCCTGCC 0: 2
1: 0
2: 16
3: 154
4: 1178
Right 1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG 0: 2
1: 2
2: 7
3: 73
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142496547 Original CRISPR GGCTCCTGCCAGCCCCCTGC TGG Intronic
900332038 1:2140134-2140156 GGCCTCTGCCAGCCACCTGAGGG - Intronic
900422599 1:2562076-2562098 TGCTCCTGCCTGCCCCCTGTGGG + Intronic
900641297 1:3689237-3689259 GGCCCCAGCCGACCCCCTGCAGG + Intronic
902551118 1:17220142-17220164 GGGTCTTGCCAGCAGCCTGCAGG + Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
902772562 1:18654057-18654079 GGCTGCAGCCAGCCAGCTGCGGG - Intronic
902840562 1:19071430-19071452 GGCTCCTCCCAGTCCCCTACAGG + Intergenic
903322432 1:22551114-22551136 GGCTCCAGCCAGCCATCCGCAGG + Intergenic
903534862 1:24060234-24060256 GGCGCCCCTCAGCCCCCTGCAGG + Intronic
903835309 1:26199862-26199884 GGCCCCTGCCTGCCATCTGCAGG + Exonic
904266668 1:29322266-29322288 GTCTCCTCCCTGCCCACTGCAGG - Intronic
904419856 1:30384662-30384684 GGCTCCTGCCAGTCCACCCCAGG - Intergenic
904563628 1:31414217-31414239 GGCTCCAGCAAGACCCCGGCTGG + Intronic
904755224 1:32765274-32765296 GGCTCCTGCCTGGCTGCTGCAGG + Intronic
904804285 1:33119991-33120013 GGGCCCTGCCAGTCCCATGCTGG + Intronic
904972535 1:34430370-34430392 GGCTCCTGCCTTCTCCCTGATGG + Intergenic
905594196 1:39191819-39191841 AGCTCCTCTCAGCTCCCTGCAGG - Intronic
905861905 1:41357659-41357681 GGCTCAGGCCTGGCCCCTGCAGG - Intergenic
905890543 1:41516112-41516134 GGCCCCGGCCAGCCCCGAGCTGG - Intronic
905919790 1:41711771-41711793 GGCCCCTGCCAGCCACGTGGTGG - Intronic
905964660 1:42081667-42081689 TGCTACTGCCAACACCCTGCCGG - Intergenic
906082491 1:43102377-43102399 GGCTCCTGCCTGCTCCATGAAGG + Intergenic
906607831 1:47183842-47183864 GACTCCCTCCAGCCCCATGCCGG - Exonic
907268032 1:53274642-53274664 GTCTCCTACCATCCCCCTCCTGG - Intronic
907272365 1:53298502-53298524 GGCTCCAGCCAGCCCCACCCTGG + Intronic
907326103 1:53639432-53639454 GCCTCCTGCCAGCCCCGAGAGGG - Intronic
908534950 1:65067947-65067969 GGCTGCTGCCTGTCCGCTGCCGG - Intergenic
913175967 1:116273566-116273588 GCCTGCAGCCAGCCCCCTGAAGG + Intergenic
913962672 1:143352384-143352406 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
913963988 1:143359728-143359750 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914057027 1:144177969-144177991 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914058352 1:144185332-144185354 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914120796 1:144781039-144781061 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914122119 1:144788397-144788419 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914171821 1:145232854-145232876 GGCTCCCGCCCGCTCCCAGCCGG + Intergenic
914988700 1:152480248-152480270 GGCTCCTCTCCGCCCCCTGGTGG + Intergenic
915004445 1:152623358-152623380 GGCTCCTGCGCACGCCCTGCGGG + Intergenic
915074197 1:153295397-153295419 CACTCCTGCTAGCCCCCTTCTGG - Intergenic
915364949 1:155309827-155309849 TCCTGCTGCCAGCCCCCTACTGG + Exonic
916000652 1:160612084-160612106 GGCCACTGCTAACCCCCTGCTGG - Intronic
916169410 1:161989323-161989345 AGCTCCTGCCTGACCCCTGTAGG - Intronic
917443417 1:175086464-175086486 TGCTCCTGCCTTCCCCATGCTGG + Intronic
917699716 1:177568053-177568075 GGGTGCTGCAAGCCACCTGCAGG + Intergenic
919781750 1:201225754-201225776 GGCTGCTACCAGCCCCCTCCAGG - Intronic
920521831 1:206633608-206633630 GGCTCCTGCCAGATCCCTTATGG + Intergenic
920571802 1:207023199-207023221 GGCACCTGCCAGCCCCCAGGAGG - Exonic
921054997 1:211536838-211536860 GGGTCTTTCCAGCCCCATGCTGG - Intergenic
921670492 1:217918940-217918962 GGCTCCAGCGAGCCCTCTCCAGG - Intergenic
922717554 1:227885231-227885253 CTCTCCTGCCAGCCTCCTGTGGG + Intergenic
922755260 1:228093072-228093094 GGCTCCTGGCATCCTCCTGCTGG + Intronic
922912281 1:229227628-229227650 GGCTGATGCGCGCCCCCTGCCGG + Intergenic
923264679 1:232302825-232302847 GGCTCTTGTCTGGCCCCTGCTGG + Intergenic
924710524 1:246527187-246527209 CTCTCCTGCCAGCCCCCTGCAGG + Intergenic
1062901165 10:1147919-1147941 GGCTCCTGGCTGACCTCTGCAGG + Intergenic
1063127371 10:3147591-3147613 GTCTCCTGCAGGTCCCCTGCGGG + Exonic
1065953311 10:30671638-30671660 GGCACCAGCCAGCAGCCTGCAGG + Intergenic
1067066144 10:43105363-43105385 GAGTCCTGCCAGCACCCAGCTGG + Intronic
1067662809 10:48249248-48249270 GGGTACTGCCAGGCACCTGCTGG - Intronic
1069552736 10:69375819-69375841 GGTTCTTGCCAGCTCCCGGCTGG + Intronic
1070145235 10:73769146-73769168 GCCTCCCGCCTGCCACCTGCAGG - Exonic
1070401121 10:76054518-76054540 GGTTCCTGCCAGCCCCGTGAAGG + Intronic
1070915802 10:80153876-80153898 GGCTCCTGCCAGGACCCAGCAGG + Exonic
1070952671 10:80443671-80443693 GGCTCCTCCCTGCCTTCTGCCGG - Intergenic
1071479515 10:86054475-86054497 GTGTCCTGCCAACCCCCTTCTGG + Intronic
1071759394 10:88583337-88583359 GCCTCCTTTCCGCCCCCTGCAGG - Intronic
1072613013 10:97031537-97031559 GGGTCCTGCCACCCACCTGGTGG - Intronic
1074138027 10:110644450-110644472 GGCTGCTGCCAGCACCATGCGGG - Exonic
1074979131 10:118605289-118605311 GACTCCAGCCAGGCTCCTGCAGG + Intergenic
1075228013 10:120646922-120646944 GGCTCTTGCCACTCTCCTGCTGG + Intergenic
1075626534 10:123967842-123967864 AGGTCCAGCCTGCCCCCTGCTGG + Intergenic
1076294522 10:129374276-129374298 CGCTCCTGCCAGGCCCCCGTCGG + Intergenic
1076602652 10:131668820-131668842 GGCTCCTGACAGCTCTTTGCTGG + Intergenic
1076761995 10:132610560-132610582 GGCCCCAGCCAGCTCGCTGCAGG + Intronic
1076806422 10:132861446-132861468 GGCTCCTGCTGGCCCCGTCCTGG + Intronic
1076889789 10:133277771-133277793 GACTCCCTCCAGCCCCTTGCTGG - Intergenic
1077168775 11:1157183-1157205 GGCTCCTGGCAGCAGCCTCCAGG - Intergenic
1077225357 11:1437032-1437054 GGACCCTGCCAGCCCCATCCAGG - Intronic
1077369116 11:2173332-2173354 GGCTCCTCGCTGCCCTCTGCAGG + Intergenic
1077453307 11:2663707-2663729 GGGTCTTGCAAGGCCCCTGCAGG + Intronic
1077459321 11:2700736-2700758 CGCGCCTGCCAGCGCCCGGCCGG + Intronic
1078507100 11:11960426-11960448 GTGTCTTGCCAGCCTCCTGCTGG + Intergenic
1078761833 11:14257917-14257939 AACTCCTGCCAGCCCCTGGCTGG - Intronic
1079146668 11:17858388-17858410 GACTCCCCCCAGCCCCCTTCCGG + Intronic
1079247092 11:18760681-18760703 GGCTCCAGCCAGCTGCCCGCAGG + Intronic
1080584085 11:33665997-33666019 GGCTCCTGCCTGCTCCGTGGAGG + Intronic
1081754634 11:45535891-45535913 GGGTCCTGCCCACCCCCTCCAGG + Intergenic
1082014034 11:47471045-47471067 GGGGCCTGCCAGACCCCTGTGGG + Intronic
1083172669 11:60932121-60932143 GGCACCTGCCACTCACCTGCAGG - Exonic
1083272543 11:61579724-61579746 CCCTCCTGCCAGCCTCCTGGGGG - Intronic
1083602526 11:63957883-63957905 GGCTCCTGCCAGCCCTGGCCCGG + Intergenic
1084030824 11:66479813-66479835 GGCTCCTTCCAGGCCCGTGGCGG + Intergenic
1084741966 11:71145920-71145942 GGGTCCTCCCAGCCCACTGAGGG + Intronic
1085025495 11:73234149-73234171 GTCTGCTGCCATCGCCCTGCAGG - Exonic
1088745064 11:112798105-112798127 AGCACCTGACCGCCCCCTGCAGG - Intergenic
1089354407 11:117840467-117840489 GGCTCCTCCCAGTGCCCTGAGGG + Intronic
1089772695 11:120815008-120815030 GGCTCCCCCTACCCCCCTGCAGG + Intronic
1090732450 11:129583433-129583455 GGCTCCTGGACGCCCCTTGCTGG - Intergenic
1091262358 11:134244916-134244938 GACTCCTGCCCTCCCCCTACAGG + Exonic
1091406630 12:213482-213504 GGTTCCTGCCCGCTGCCTGCCGG - Intronic
1091567649 12:1660988-1661010 GCCTCCTGGCAGCCCCATGCGGG + Intergenic
1092000023 12:5024241-5024263 GGCTCATGCCGGACCTCTGCAGG + Intergenic
1092013093 12:5132558-5132580 TGCTTCTGCCAGCCTTCTGCAGG + Intergenic
1092952597 12:13521239-13521261 GGCTCCTGCAAGCTACATGCAGG + Intergenic
1095405890 12:41866810-41866832 GTATCCTGCCAGCCTCCTCCAGG + Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1097755904 12:63406489-63406511 GGATCCTGCAACCCCCCTTCTGG - Intergenic
1099436161 12:82648027-82648049 TGAACCAGCCAGCCCCCTGCTGG - Intergenic
1101233293 12:102763834-102763856 GGCATCTGCCACCTCCCTGCTGG - Intergenic
1101759328 12:107645973-107645995 GGCCCCTGGGAGCCTCCTGCTGG - Intronic
1101778690 12:107816548-107816570 GGGACCAGCCAGCCTCCTGCTGG + Intergenic
1101789214 12:107912484-107912506 CTGCCCTGCCAGCCCCCTGCAGG + Intergenic
1102258159 12:111428171-111428193 GGCGCTGGCCAGCCCCCTCCAGG - Intronic
1102911525 12:116717993-116718015 GGACTCGGCCAGCCCCCTGCAGG - Intronic
1103200149 12:119081635-119081657 GGATCCCGCCAGCCGCCTTCTGG + Intronic
1103870258 12:124086194-124086216 AGCTCCTGCCTGCTCCCTGAAGG + Intronic
1103931582 12:124453548-124453570 GCCTCCTCCCTGGCCCCTGCTGG - Intronic
1103969943 12:124664165-124664187 GGCCCCTGCCTGCCCTCAGCTGG - Intergenic
1104087823 12:125492539-125492561 GGCTCCTGTCCGCCCTGTGCAGG - Intronic
1104848048 12:131856929-131856951 GGCTCCTCCCAGCACTCGGCTGG + Intergenic
1104976616 12:132555030-132555052 GGCGCCATCCTGCCCCCTGCTGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1106356884 13:28991719-28991741 AGCTCCTGCCAGCCCAGAGCAGG - Intronic
1106490388 13:30216286-30216308 GGTTCCTTCCTGCCCTCTGCTGG - Intronic
1106815800 13:33405400-33405422 GGCTCCTGGCTTCTCCCTGCAGG - Intergenic
1107339050 13:39386721-39386743 GGCTCCAGCCAGCCACTTGCAGG - Intronic
1111116120 13:83779897-83779919 TGCTCATGCCAGCCCCCAGAGGG - Intergenic
1112092845 13:96100528-96100550 AGCTCCTGTCAGCCACCAGCAGG - Intronic
1112308993 13:98301179-98301201 AGCTCATGCCAGCCCCCACCTGG + Intronic
1112504688 13:99968846-99968868 GGCTCCTGCGGGCCGCCTGATGG - Intronic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1114393145 14:22331702-22331724 GCCTCCTCCCACCCCACTGCTGG - Intergenic
1114664325 14:24369102-24369124 GGCTCCTGCCAGCGCCGTTTGGG + Intronic
1115780230 14:36760561-36760583 GGGTCCTGCCAGCTCCATACTGG + Intronic
1116020619 14:39455661-39455683 AGCTCCTGCCAGCCCGCTGGGGG + Intergenic
1118312625 14:64704803-64704825 CCCCCGTGCCAGCCCCCTGCGGG + Intronic
1119428190 14:74549673-74549695 GGCTCCTGGCAGCCCTCTGCTGG - Intronic
1119667513 14:76495903-76495925 GGTTCCTGCCTGCCCTCTGGAGG - Intronic
1119936178 14:78594241-78594263 GTCTCCTGCCAGCCATCTGAAGG + Intronic
1120789232 14:88563520-88563542 GGCTCCTCCCAGCCCCCGCCCGG + Intronic
1122116008 14:99527598-99527620 GGCTGCAGCCAGATCCCTGCTGG - Intronic
1122140014 14:99657478-99657500 TGGCCCTGCCAGACCCCTGCTGG + Intronic
1122417689 14:101558184-101558206 TTCCCCTGCCCGCCCCCTGCTGG + Intergenic
1122536300 14:102465958-102465980 GACTCCTGCCAGCCCCCATTTGG + Intronic
1122626458 14:103087696-103087718 GACTCCTGCCAGTCCCTTCCTGG - Intergenic
1122783821 14:104154899-104154921 GGCTCCTGCCACCGCTGTGCTGG + Intronic
1122785043 14:104159718-104159740 GGCTTCTGCGAGGCCACTGCAGG + Intronic
1123014776 14:105368400-105368422 GGGTCCTGCCAGCACTATGCAGG + Intronic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123480913 15:20629842-20629864 GGCACCTGCCAGATGCCTGCTGG - Intergenic
1123637098 15:22370523-22370545 GGCACCTGCCAGATGCCTGCTGG + Intergenic
1124387786 15:29224764-29224786 GCTGCCTGCCAGTCCCCTGCTGG + Intronic
1125300989 15:38252981-38253003 TGCTGCCGCCACCCCCCTGCGGG + Exonic
1125578974 15:40772660-40772682 GCCTCCTGCCAGCCTGCTGAGGG + Intronic
1126438875 15:48665417-48665439 GACTCCTTCCAGCCTCCTGCAGG - Intergenic
1126850594 15:52794751-52794773 GGCCGCTGCCAGCCCACTTCCGG + Intergenic
1127599725 15:60523534-60523556 GGCTCAGGCCAGCCACATGCTGG - Intronic
1127715207 15:61643037-61643059 GGATGGTGCCAGCCTCCTGCAGG + Intergenic
1128092039 15:64925872-64925894 GACTCCTGCCAGCCCCCCTAAGG + Intronic
1128350709 15:66886559-66886581 GGCTCCCGCCAGTTCGCTGCGGG - Intergenic
1128539566 15:68517184-68517206 TTCTCCTCCCAGCCTCCTGCGGG + Intergenic
1128618803 15:69131649-69131671 GGCTCCTGCAAGCAACCTGCTGG - Intergenic
1128692567 15:69736343-69736365 AGCTCCTGCCTACCCCCTGGAGG + Intergenic
1128742921 15:70096083-70096105 GGCTCCTGCCATCCCCCGCGGGG - Intronic
1128775004 15:70313571-70313593 GGCCCATGCCTGCCCCATGCTGG + Intergenic
1128795049 15:70460372-70460394 TGCTCCTGCCAGCCACCAGGGGG - Intergenic
1129195687 15:73964901-73964923 TGCTCTTGCCCGCCCCCTGGTGG + Intergenic
1129228196 15:74181941-74181963 GGGTACTTCCAGCCCCATGCCGG + Intronic
1129325543 15:74798556-74798578 GGCCCCCTCCAGCCACCTGCTGG - Intronic
1129679539 15:77650470-77650492 GGGTCCAGGCTGCCCCCTGCTGG - Intronic
1130015180 15:80180659-80180681 GGGCTCGGCCAGCCCCCTGCAGG - Intronic
1130253203 15:82314093-82314115 GGCTCCTGCAGGCCTGCTGCTGG - Intergenic
1130415075 15:83685969-83685991 GGCTCTTTCCAGCCTCTTGCTGG + Intronic
1131218530 15:90560780-90560802 GGCTCCTGATTGCACCCTGCAGG + Intronic
1132518930 16:378587-378609 GGCTCCTTCCTGACACCTGCTGG - Intronic
1132546643 16:536227-536249 GGCTCCGGCCAGACCTCGGCAGG - Intronic
1132751916 16:1461538-1461560 GCCCCCTGCCAGCCCACTCCCGG - Intronic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133025648 16:2987984-2988006 GGTGCCTGCCTGCCCCTTGCTGG + Intergenic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1133297047 16:4759370-4759392 TGCTCCAGCCATCCCACTGCTGG + Intronic
1135250991 16:20900825-20900847 GCCTCCTCCCAGCCCGCCGCGGG + Intronic
1135555802 16:23435611-23435633 GGCTCCTGTCCGCCCCCTTCTGG + Intronic
1135753128 16:25073050-25073072 GGCTCCTGCCAGCCTGATGCTGG + Intergenic
1135764877 16:25168945-25168967 TGCTCCCGCCAGCACCGTGCTGG + Intronic
1136398517 16:30005597-30005619 GGCCCCTGCCACCCTCCTGGGGG - Exonic
1137378256 16:47973629-47973651 GGACCCTGCCAGCACACTGCAGG + Intergenic
1137566750 16:49538103-49538125 AGCTCCTGACAGCCCCCACCAGG + Intronic
1137598303 16:49739329-49739351 GCCTCCTGCCAGACCCCTCCGGG - Intronic
1137698566 16:50478971-50478993 GGCTCCTGCCTGCTCCCAGGAGG + Intergenic
1137773838 16:51039830-51039852 GGCTCCTCACTGCCCCCAGCAGG - Intergenic
1139372963 16:66479929-66479951 CTCTCCTGCCAGCCCCCCTCAGG + Intronic
1139390097 16:66601877-66601899 GGCTCCTGTCTGCCCCATGGAGG + Intergenic
1139443318 16:66979854-66979876 GGCCCCTGTCATCTCCCTGCGGG - Intergenic
1139559136 16:67730520-67730542 GGCTGCAGCATGCCCCCTGCTGG + Intronic
1139964415 16:70737558-70737580 GGAGCCTGCCAGCCCCTGGCAGG + Intronic
1140034436 16:71361559-71361581 GGCTCCAGCGAGCCCACTCCAGG - Intronic
1141113274 16:81287754-81287776 AGCTCCTGCCTGGTCCCTGCTGG - Intronic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1141983567 16:87565233-87565255 GGCTCCTACCTGCTCCCTGCTGG + Intergenic
1142041313 16:87896270-87896292 GGCTCCAGCCATGCCACTGCGGG + Intronic
1142492970 17:290431-290453 GGCTCCTGCCTGCCTCCCCCGGG + Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142752328 17:1996412-1996434 GGCAGCAGCCAGCCCTCTGCAGG - Intronic
1143256139 17:5559431-5559453 GGCTCCTGCAAGACCCATCCTGG + Exonic
1143498068 17:7323713-7323735 GTCTCCTGGCAGGGCCCTGCGGG - Exonic
1144363232 17:14516816-14516838 GGCTCATGCCACCTCCCTACAGG + Intergenic
1144495374 17:15742105-15742127 GCCTCTTGCCAGCCCCATGAGGG - Intronic
1144671685 17:17136404-17136426 TCCTGCTGCCAGCTCCCTGCGGG + Exonic
1144872867 17:18381405-18381427 GGCTGCTGCCCGTCTCCTGCTGG - Exonic
1145799937 17:27676504-27676526 CTCTCTTGCCAGCCCCCTGCAGG + Intergenic
1146654018 17:34624670-34624692 GACTCCTCCCAATCCCCTGCTGG - Intronic
1147326628 17:39672752-39672774 GGATCCTGCCCCCGCCCTGCTGG - Exonic
1147538225 17:41334754-41334776 TTCTCCTGCCAGCCCCCCACAGG + Intergenic
1147889127 17:43704732-43704754 GGCGCCTGCCCACCCCTTGCTGG + Intergenic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1151320235 17:73348553-73348575 CGCTGCTCCCTGCCCCCTGCAGG + Intronic
1152121455 17:78421378-78421400 GACTCCTGCCAGCCCTCGGGAGG - Intronic
1152445311 17:80339379-80339401 AGCTGCTGGCAGCCCTCTGCAGG + Exonic
1152484798 17:80583547-80583569 GGCTCCTGCCAGCCCTCAAGAGG - Intronic
1152596296 17:81239337-81239359 GGCTATTCCCAGCCCCCTGGAGG - Exonic
1153137531 18:1933850-1933872 GGGACCTGCCAGCCACCTGTAGG - Intergenic
1153818076 18:8808169-8808191 GGCTCCTGCCTGCTGCCCGCGGG + Intronic
1153895068 18:9551404-9551426 TGCTCCTGCCAGCCACCATCTGG - Intronic
1155219440 18:23671101-23671123 GGCCCCTCCAAGCCCCATGCTGG - Intergenic
1155494879 18:26433005-26433027 GGCTACTGCCATCCTTCTGCTGG + Intergenic
1157481891 18:48060481-48060503 TCCTCCTGCCTGCCTCCTGCTGG + Intronic
1159885109 18:73896355-73896377 GGGCCCTGCCAGCCCAGTGCGGG - Intergenic
1160851607 19:1195486-1195508 GGCTTCTGCCAGCCCCGCCCAGG - Intronic
1160852031 19:1197300-1197322 GGCTTCTGCCAGCCCCGCCCAGG - Intronic
1161119338 19:2516855-2516877 GGCTGCTGCCAGCCCGCCCCAGG + Intronic
1161325572 19:3662109-3662131 GGCACCTGCCAACCCCCTCCTGG + Intronic
1161428553 19:4217611-4217633 GGCTCGGGCCAGCCGGCTGCTGG + Exonic
1162145941 19:8611983-8612005 GGCTCTGGCCAGCTCCCTGGGGG - Intergenic
1162412409 19:10514493-10514515 GGCTCCTGCCAGCGCTGGGCTGG - Exonic
1162463807 19:10829334-10829356 GTTTCCTGCCAGGACCCTGCAGG - Intronic
1162938877 19:13996277-13996299 GGCTCCTGCCTGGCCCCAGAAGG + Intronic
1163104801 19:15117052-15117074 GCCTCCACCCAGCCCCCTTCCGG + Intronic
1163386065 19:17001405-17001427 GGCTGCTCCCCGCCCTCTGCAGG - Intronic
1163645921 19:18489011-18489033 GGCTCCTCCACACCCCCTGCAGG - Intronic
1163664116 19:18595096-18595118 GGCTGCAGCCAGCCCCCAGCAGG + Intronic
1163843603 19:19626778-19626800 GGCTGCTGCCTGCCCACTCCTGG - Exonic
1164559425 19:29278922-29278944 AGCTCTTGTCAGCCCGCTGCTGG - Intergenic
1164633030 19:29774077-29774099 GGCTCCAGCCTGGCCCTTGCAGG + Intergenic
1165078140 19:33292024-33292046 GGGTCCTGCCTTCCCCTTGCTGG - Intergenic
1165665192 19:37621977-37621999 GGCTCCTGCCTCATCCCTGCTGG - Intronic
1166121806 19:40691031-40691053 CGCTCCTGCCCGCCCCCGCCGGG - Intergenic
1166720619 19:44993939-44993961 GGCTCCAGCCTGCACCCAGCAGG - Intergenic
1166748890 19:45155436-45155458 GGCTCCTGCCAAGCCCCTACTGG - Intronic
1166951825 19:46433861-46433883 TGATCCTGCCATCCCACTGCTGG - Intergenic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
1202696510 1_KI270712v1_random:130642-130664 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
1202697833 1_KI270712v1_random:137989-138011 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
925281395 2:2687845-2687867 GGGTCCTGGCAGTCCCCTCCTGG + Intergenic
925619895 2:5781932-5781954 GTCTCCTGCCTGCTGCCTGCGGG - Intergenic
925982809 2:9191002-9191024 TGCTTCTGCCAGCCCCAGGCTGG + Intergenic
926056826 2:9778584-9778606 GGTTCCTGCCAACCCCTGGCCGG - Intergenic
926103713 2:10137307-10137329 GGCACCTGCCAGCCCCATGCTGG + Intergenic
926128701 2:10286923-10286945 GACTCCACCCAGCCCACTGCTGG - Intergenic
926166509 2:10524529-10524551 GTCTCCTGCCAGGCCTCTGCTGG - Intergenic
926683696 2:15681994-15682016 GACTCCTGGCAGCCCAGTGCAGG + Intergenic
927554682 2:24023408-24023430 ACCCCCCGCCAGCCCCCTGCCGG - Intronic
929079248 2:38106151-38106173 AGCTCCTCACAGCCGCCTGCGGG - Intronic
929561345 2:42958408-42958430 GGCTCCGGCCAGGCTGCTGCTGG + Intergenic
929578689 2:43068442-43068464 GGCCCCCGCCGGCCCCCTCCAGG - Intergenic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
930073970 2:47391726-47391748 GGCTCCTTTCAGCCCACTGCTGG + Intergenic
932321736 2:70827458-70827480 GGCTCCAGGTAGCCCCCAGCAGG - Intergenic
933632326 2:84672151-84672173 GGCCCCACCCAGGCCCCTGCAGG - Intronic
933757155 2:85648793-85648815 GCCTCCTTCAAGCCCCCTGCTGG - Exonic
934277672 2:91587667-91587689 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
934279004 2:91594985-91595007 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
934704956 2:96470831-96470853 GTCTCCTGCCTCCCGCCTGCAGG - Intergenic
934728088 2:96638101-96638123 GGCCCCTGCCAGCCCGCCCCCGG + Intronic
935177774 2:100664426-100664448 GGGTACTGCCGGCCCCCTGTTGG - Intergenic
935184903 2:100723220-100723242 GGTTGCTGGCAGCCCTCTGCTGG - Intergenic
936016022 2:108959614-108959636 GGCTCCAGCCAGGCCAGTGCCGG + Intronic
937303052 2:120854967-120854989 GGCTCCTGCCAGCCCACGAAGGG - Intronic
937976278 2:127583833-127583855 AGCTTCTCACAGCCCCCTGCCGG - Intronic
938000679 2:127733285-127733307 GACTCCTGTCAGTCCCCTGCAGG - Intronic
938903384 2:135817372-135817394 GGCACCGGCCAGCACCCTCCCGG - Exonic
944557703 2:200904465-200904487 GGCCCCTGCCTGCCTGCTGCTGG + Intergenic
945335286 2:208584689-208584711 TGCTCCTGCAAGAGCCCTGCAGG - Intronic
946161332 2:217837812-217837834 TGCTCCTGGCAGCCCCTGGCTGG - Intronic
946327322 2:218991491-218991513 GGCTCCGGCCTTCCCACTGCAGG + Intronic
946428933 2:219614375-219614397 GTCTCCTCCCAACCCCCTGCAGG + Intronic
947523985 2:230867428-230867450 GCCTCCTGCCTGCTCACTGCTGG - Intronic
948233095 2:236366059-236366081 ATCTCCTGCCAGACCCCTCCAGG - Intronic
948280464 2:236743337-236743359 GGGTCCTGCCAGCCCACCCCTGG - Intergenic
948641742 2:239379522-239379544 GGGACCTGCCAGACCCCTCCTGG - Intronic
948739474 2:240033439-240033461 GGCTCCTGCCACCCCGCTTGGGG + Intergenic
1168958111 20:1848860-1848882 GGCTCCTGCCCTCCACCTGACGG + Intergenic
1169231149 20:3889563-3889585 GGCTCCTGCCGCCGCCCTTCGGG - Exonic
1169474852 20:5922440-5922462 GGCTCCTGCCTCTCCCCTGCTGG - Exonic
1169557643 20:6767773-6767795 GGCGGCTGCCAGTCCCCGGCGGG - Exonic
1170816490 20:19719052-19719074 GGGTCCTGGAAGCCACCTGCTGG + Intronic
1171159433 20:22908101-22908123 AGCTCCTGCTAACCTCCTGCTGG - Intergenic
1171461858 20:25302498-25302520 GGCTCCTCCCAGCCCACCCCCGG - Intronic
1171881770 20:30622471-30622493 TGCTCCTGGCACACCCCTGCAGG - Intergenic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1172484492 20:35290262-35290284 GGCACCTCCCAGCCCCCAGCTGG + Intronic
1172502320 20:35436329-35436351 GCCCCCTGGCAGCCCCCTCCAGG + Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172762545 20:37332532-37332554 TGCTCCTGCTTGCCCTCTGCTGG - Intergenic
1174035451 20:47665800-47665822 GGGTCCTGCCAGGCCCGTGGTGG + Intronic
1174386341 20:50190446-50190468 GGCCCCGGCCCGCCCCCTGCTGG - Intergenic
1175024933 20:55891721-55891743 GGGTCCTGCAAGCCCCATGAGGG + Intergenic
1175259843 20:57667507-57667529 GGCTCCTGCCGGCCCCATGGAGG + Intronic
1175402200 20:58707207-58707229 GGGCCCTGCCCGCCCTCTGCAGG + Intronic
1175764787 20:61584791-61584813 CGCAGCTGTCAGCCCCCTGCAGG - Intronic
1175898466 20:62350634-62350656 GAGCCCTGCCAGCTCCCTGCTGG + Intronic
1175901024 20:62359982-62360004 GGCTGCTGGCAGCCCGCTGCAGG + Intronic
1175904276 20:62371980-62372002 GGCACCTCCCAGCACCTTGCTGG + Intergenic
1175989550 20:62781046-62781068 GGATGCTGCCAGCCACCTGCAGG + Intergenic
1176080379 20:63269602-63269624 GGGTCCAGCCAGCTCCCAGCAGG - Intronic
1176106559 20:63392288-63392310 GGCTCCTCCCAAACCCCTACAGG + Intergenic
1176218789 20:63960333-63960355 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1176218880 20:63960714-63960736 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1176218936 20:63960968-63960990 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1176250001 20:64116096-64116118 GGCTGCTGCCAACACCCGGCTGG + Intergenic
1176388126 21:6149874-6149896 GGCTCCTGCCCTCCCTCTCCAGG + Intergenic
1178738263 21:35172044-35172066 CTCTCCTGCCAGCCCCCTCGGGG - Intronic
1179225811 21:39451982-39452004 GGCTGCTGCCAGCCCCGACCTGG + Exonic
1179437131 21:41369684-41369706 GGCTGCTGAGAGCGCCCTGCAGG - Intronic
1179492237 21:41748145-41748167 GCGTCCTGCCAGGCCTCTGCTGG - Intronic
1179539357 21:42074153-42074175 GGCTCCTCCCGAGCCCCTGCAGG + Intronic
1179735346 21:43388374-43388396 GGCTCCTGCCCTCCCTCTCCAGG - Intergenic
1179966638 21:44810614-44810636 GGCTCCGGCCAGCCTCCTGGAGG - Intronic
1180879899 22:19196221-19196243 GGCTCCTGCCAGCCTCTGCCAGG - Intronic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181421403 22:22801556-22801578 GTCTCCTCCCAGGACCCTGCCGG - Intronic
1181443738 22:22952553-22952575 GGGGCCAGCCAGCCTCCTGCTGG + Intergenic
1181544296 22:23592310-23592332 GGCTGCTGCCATCCCTCTGCTGG - Intergenic
1181592368 22:23893358-23893380 GGCACCAGCCAGCCTCCAGCTGG - Intronic
1182361215 22:29747600-29747622 GGCTCCTGCCAGTCACCCTCTGG + Intronic
1182603987 22:31489550-31489572 CGCCCCTGCCCACCCCCTGCGGG + Exonic
1183582340 22:38733440-38733462 GGATCCAGTCAGCCCCCTGCTGG - Exonic
1183904159 22:41027516-41027538 GGGACCAGCCAGCCACCTGCTGG + Intergenic
1184259764 22:43307940-43307962 TCTTCCTGCCAGCCCCCTTCTGG - Intronic
1184406701 22:44304620-44304642 GCCTCCTCCCAGCCTCCTTCTGG + Intronic
1184551967 22:45209349-45209371 GCCTCCAGCCTGCCCCCTGCAGG + Intronic
1184641936 22:45877487-45877509 GTCTCCTGCCCACCCTCTGCTGG - Intergenic
1184780470 22:46646565-46646587 GGGAGCTGCCAGCTCCCTGCTGG + Intronic
1184786421 22:46674111-46674133 ACCCCCTGCCAGCGCCCTGCAGG - Intronic
1184838345 22:47037220-47037242 GGCTCCTGGCACCCCCATGGCGG - Intronic
1185068349 22:48643089-48643111 GGCTCCAGGCATCCACCTGCTGG + Intronic
949336217 3:2978378-2978400 TGTTCCTACCAGGCCCCTGCAGG - Intronic
950124802 3:10504707-10504729 GGCTCCTCCCTGCCCCCTGCAGG - Intronic
950486415 3:13276588-13276610 GGATCCTGCCAGCCTGCTACGGG + Intergenic
950540194 3:13607854-13607876 GGCTCCTCCCAGCCCCCATAGGG + Intronic
951423875 3:22519422-22519444 GGTGCCTGCCACCCCCCTCCTGG + Intergenic
952871698 3:37906461-37906483 GTTTCCTGCCAGAACCCTGCTGG + Intronic
953627111 3:44580324-44580346 TCCTGCTGCCAGCTCCCTGCGGG - Intronic
953958226 3:47247524-47247546 GGCCCCTGCCACTCCCCTGTGGG - Intronic
954384811 3:50238440-50238462 GGCTGCTGCCAGCCCAGTGTGGG - Intronic
954715255 3:52523720-52523742 TGCTCTGGCCAGCCCCCTCCTGG + Exonic
954795782 3:53160910-53160932 GGCCCCTCCCAGGCCCCAGCGGG + Intronic
954813426 3:53262019-53262041 GACTCCTCCCAGGCCCCTGAAGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
958097307 3:88963255-88963277 CTCACCTGCCAGCCCCATGCTGG - Intergenic
960054814 3:113269738-113269760 GGCTGCTGCCAACCTTCTGCTGG - Intronic
961255456 3:125546813-125546835 GGCTCCTTGCAGCCGCCTCCTGG - Intronic
961371427 3:126434135-126434157 TCCGCCTGCCAGCACCCTGCTGG + Intronic
961825701 3:129597978-129598000 GGATCCTGCCAGCACCTGGCAGG + Intronic
962313063 3:134339486-134339508 TGCACCTGCCGACCCCCTGCAGG + Intergenic
963253016 3:143119746-143119768 GGCTCCTGCCAGCCGGCGCCCGG - Exonic
963607031 3:147420737-147420759 GGCTTCTGCCAGGCCTCTGTGGG - Intronic
967881710 3:194306249-194306271 GGATCCAGCCAGGCTCCTGCTGG + Intergenic
967884781 3:194325915-194325937 TGCTCCTGCAAGCCCCCCACCGG + Intergenic
968001330 3:195208859-195208881 TCCTCTTGCAAGCCCCCTGCTGG - Intronic
968235914 3:197029896-197029918 GGCCCCGGCGCGCCCCCTGCTGG + Intergenic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
968731280 4:2270486-2270508 GGCTCCTCCGGGTCCCCTGCTGG + Exonic
968757955 4:2426565-2426587 GGCTGCGGCCACCTCCCTGCAGG + Exonic
968810593 4:2798050-2798072 GCCTCCTCCCTTCCCCCTGCGGG + Intronic
968869245 4:3233177-3233199 GGAGCCTGTCAGCCGCCTGCTGG + Exonic
969518067 4:7659697-7659719 ACCTCCAGCCAGCCCCATGCAGG + Intronic
969842363 4:9891914-9891936 GGCTCCTGCCTGCCAGCTTCAGG + Intronic
970146994 4:13046424-13046446 GGCTGCTGACTGCCCACTGCTGG + Intergenic
970435882 4:16034824-16034846 GGGACCTGGAAGCCCCCTGCTGG - Intronic
970891042 4:21044712-21044734 GGCTGCAGCCAGACCCCTCCTGG + Intronic
971019067 4:22516099-22516121 GGCTCCTCCCCGCCCGCCGCCGG + Intergenic
973309892 4:48697723-48697745 GGCTCATGCGAGGCCCATGCGGG - Intronic
973795814 4:54425196-54425218 GCCCCCTGCCAGGTCCCTGCAGG - Intergenic
976092313 4:81471510-81471532 GGCCCCTGCCCGGCCGCTGCGGG - Intronic
976771905 4:88662256-88662278 GGCTCCTGACAGATCCCAGCTGG - Intronic
978108357 4:104931313-104931335 GGCTCCTGCCAGATGCCAGCTGG - Intergenic
979408765 4:120347516-120347538 GTCTCCTAGCAGCCCCTTGCAGG - Intergenic
982436035 4:155383954-155383976 TGCTCCTGCCAGCCCCCCACAGG - Intergenic
983302082 4:165938725-165938747 GGCTCCTGCCAACCACTTTCTGG + Intronic
984584146 4:181543608-181543630 TTCTACTGCCAGCCACCTGCTGG + Intergenic
984778391 4:183504217-183504239 GGCTGCCGCCCGCCTCCTGCCGG - Intergenic
985565482 5:613323-613345 GCCTCCTTCCACCTCCCTGCTGG - Intronic
985573696 5:664007-664029 GGCTCTGCTCAGCCCCCTGCTGG + Exonic
985774125 5:1831802-1831824 TCCTCCTGCCAGCTCCTTGCTGG + Intergenic
985980174 5:3456337-3456359 GGCCCCTGCCAGCCCCTGGCAGG + Intergenic
989129723 5:38095080-38095102 GGCTCCTGCAAGTGCGCTGCTGG - Intergenic
991929908 5:71744135-71744157 GGCTCCTGCCACCCCCAGCCAGG + Intergenic
993895070 5:93523605-93523627 GGCACCTGCCAGATCCCAGCTGG - Intergenic
995479569 5:112581096-112581118 GGTGCCTGCCAGCCCTCTGCAGG - Intergenic
995724365 5:115169124-115169146 GGCCCCGGCCCGCCCCCCGCGGG + Intronic
997460285 5:134047235-134047257 GGTTCCTGCCCTCCCCCAGCAGG - Intergenic
997853487 5:137353638-137353660 AGCTGCTGCCAGCTCCCTCCAGG + Intronic
998184582 5:139968558-139968580 TCCTCCTTCCAGTCCCCTGCAGG - Intronic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
999261144 5:150239631-150239653 TGCTCCTGCCTCCCTCCTGCAGG - Intronic
999288553 5:150408524-150408546 TACTCCTGCCCACCCCCTGCAGG - Intronic
1001028507 5:168244550-168244572 GACAGCTGCCAGCCCGCTGCTGG - Exonic
1001293704 5:170484406-170484428 GTCACCTGCCAGCCTCCTGGAGG - Intronic
1001474470 5:172040344-172040366 GGCTGCGGCCTGCCCCCTGCTGG + Intergenic
1001752323 5:174141095-174141117 CTCTTCTGCCAGGCCCCTGCTGG + Intronic
1002422417 5:179155516-179155538 CGCACCAGCCAGCCCCCTGCTGG - Intronic
1002461866 5:179377910-179377932 GGCTGTTGCCAGACCCCAGCTGG + Intergenic
1002570986 5:180139294-180139316 GAGTCCTGCCAGCTCACTGCAGG + Intronic
1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG + Intergenic
1002785095 6:393880-393902 CGCTCCTGCTAGCTCTCTGCGGG + Intronic
1003276787 6:4660666-4660688 GGCCCCTGCCAACTCCCTTCTGG + Intergenic
1003278623 6:4673629-4673651 GCCTCCTGCCAGCCCTATTCAGG - Intergenic
1003566829 6:7229572-7229594 GGCCCCTGCCGCCCCACTGCAGG + Exonic
1004518283 6:16339209-16339231 GGATCCTGCCAGCCACCAGGGGG + Intronic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1006192916 6:32220554-32220576 GGCACCTGCCAGAACTCTGCTGG - Exonic
1006193285 6:32222468-32222490 TGCTCCTGCCTGTCCCCTCCTGG + Intronic
1006386425 6:33733569-33733591 TGATCCTGCCACCCCTCTGCTGG + Intronic
1006393336 6:33771673-33771695 GGCTGCAGGCTGCCCCCTGCCGG - Exonic
1006416352 6:33906435-33906457 GGCTCCTGCTGGCTCCCTGGCGG + Intergenic
1006620653 6:35361647-35361669 TGCTCCTGCCAGCCCCTGCCTGG + Intronic
1006921788 6:37632429-37632451 GGCTCCTCTCAGCTCCCTGGGGG - Exonic
1006969312 6:38024530-38024552 GGCTGCTGCCTGCCACCTACTGG - Intronic
1007368571 6:41411700-41411722 GCCGCCTGCCAGCCCCCAGCAGG - Intergenic
1007702924 6:43774927-43774949 AGCTACAGCCAGCCCTCTGCTGG - Intronic
1011437826 6:87357694-87357716 CTCTCCTGCCAGCCATCTGCAGG + Intronic
1014303444 6:119712004-119712026 GGTACCAGCCAGCTCCCTGCTGG - Intergenic
1015440311 6:133240854-133240876 GGCCACTGCGGGCCCCCTGCCGG - Intronic
1015965387 6:138692398-138692420 TGCTCCCGCCCGCCCCCTGGCGG - Intronic
1016438929 6:144064273-144064295 GGCTCCTGCCTGCGTCCTGCCGG - Intronic
1016865404 6:148761135-148761157 GGTTCCAGCCAGCCCGCTGGGGG - Intronic
1018237278 6:161738746-161738768 GGCTCCAGCCAGCCTGATGCTGG - Intronic
1018446869 6:163866363-163866385 TGCTTCTGCCTGCCTCCTGCTGG + Intergenic
1019000008 6:168742204-168742226 GGCAGCTGCAAGCCTCCTGCGGG - Intergenic
1019143041 6:169960223-169960245 TGCTCCTGCCAGCCCCTGGGAGG - Intergenic
1019170044 6:170128796-170128818 GGCTTCTGCCTGCCCACGGCAGG - Intergenic
1019186460 6:170223398-170223420 GGGTCCTGCCAGGCCTCTGCTGG + Intergenic
1019267018 7:123400-123422 GGATACTGCCTGCCCCCAGCAGG - Intergenic
1019473482 7:1233235-1233257 CGCTGCTGCCAGCCGCCTGCGGG + Exonic
1019564093 7:1671020-1671042 GCCTCCTCCCAGCCCCCAGAGGG - Intergenic
1019598593 7:1869931-1869953 TGCTCCAGCCAGCCGCCTGTTGG - Intronic
1019603307 7:1895998-1896020 GGCCCAGGCCAGACCCCTGCAGG + Intronic
1019664983 7:2247326-2247348 CGCTCAGGCCTGCCCCCTGCAGG - Intronic
1019698318 7:2460243-2460265 GGCTCCTGGCAGCCCCAGGAAGG - Intergenic
1020230931 7:6317970-6317992 GGCTCCTTCCAGCTCCAGGCTGG - Intergenic
1020369236 7:7414474-7414496 GCCTCCTGCCATTCCTCTGCTGG - Intronic
1020796788 7:12686807-12686829 GGCTCCTGCGCGCCCCCTACAGG + Intergenic
1021612875 7:22475210-22475232 GGCACCTGGCATCTCCCTGCTGG + Intronic
1023093528 7:36638313-36638335 GGCTGTTGACAGCCTCCTGCTGG - Intronic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1023907709 7:44533913-44533935 GGCACTTGCCAACTCCCTGCTGG - Intronic
1023939372 7:44760099-44760121 GGCTCCAACCTGACCCCTGCCGG - Intronic
1024088612 7:45917757-45917779 GGCTCAGGTCTGCCCCCTGCCGG - Intronic
1025033007 7:55572449-55572471 GGCTCCCGCCCGCTCCCAGCCGG - Exonic
1027151010 7:75733644-75733666 TACTCCTGCCAGCCTCCTCCAGG - Intronic
1027185765 7:75969735-75969757 CGCCCCTGCCAGCCTCGTGCTGG + Intronic
1030033231 7:105388251-105388273 GGCTCCGGCCCGCCCGCTGCGGG - Intronic
1032083651 7:128872664-128872686 GTCTCCGGCCTGCCCCCTACAGG + Intronic
1032295840 7:130638112-130638134 GGCTCCTGCCAGATGCCAGCTGG + Intronic
1032899881 7:136295171-136295193 GGCACCTGCCTGCCACCTACAGG - Intergenic
1032992684 7:137411233-137411255 TGCCCCTGCAAACCCCCTGCTGG - Intronic
1034162400 7:149002965-149002987 GGCTACTGCCAGGCCTCTGCAGG + Intergenic
1034904333 7:154930582-154930604 GTCTCCTGCCTGTGCCCTGCAGG + Intronic
1035205479 7:157291577-157291599 CCCTCCTGCCACACCCCTGCTGG - Intergenic
1035573528 8:689533-689555 TGCTCCTGCCAGACACCTCCAGG - Intronic
1035587287 8:785893-785915 GGCTCCTGCCGGGCCCCTCCCGG + Intergenic
1035757968 8:2048322-2048344 AGCTCTTCCCAGCACCCTGCTGG + Intronic
1036338762 8:7896174-7896196 AGCTCCTGCCAGACCCCACCTGG + Intronic
1036455718 8:8905385-8905407 GGCTCCTGACAGCCCACTACTGG - Intergenic
1036759956 8:11501442-11501464 GGCACCTGCCAGCACACTGGGGG + Intronic
1037752663 8:21692834-21692856 GCCCTCTGCCAGCCCCCAGCGGG + Exonic
1037813094 8:22098166-22098188 TGCTCCTGCCAGGCCCCAGCTGG + Exonic
1038022520 8:23562196-23562218 GGCTCCAGGCAGCGCCCTTCAGG - Intronic
1040005734 8:42619216-42619238 GGCTCGTGCCAGGACCCAGCAGG - Intergenic
1040567661 8:48582091-48582113 GGCTCCTGCCGGCTCCCGGCAGG + Intergenic
1040891996 8:52326870-52326892 GGCTGCTGCCAGCCCTGTGGTGG - Intronic
1042733441 8:71962301-71962323 GGCTCCTCCCCTCGCCCTGCAGG + Intronic
1044067893 8:87721059-87721081 GGCACCTGCCAGATGCCTGCTGG + Intergenic
1044694910 8:94913194-94913216 GTCCCCTGCCAGCCTACTGCTGG - Intronic
1044926145 8:97210300-97210322 GACTCATTCCAGACCCCTGCTGG + Intergenic
1045010990 8:97958251-97958273 GGTTCCTGCCAGACCCCTGATGG + Intronic
1045977376 8:108145027-108145049 GTCTCCTGCCACTGCCCTGCAGG - Intergenic
1047704913 8:127488627-127488649 GGCCCCTGCCAGGCCTCTGCTGG + Intergenic
1048365379 8:133733563-133733585 CGCCCCTGCCAGCCACCAGCAGG - Intergenic
1048822473 8:138392751-138392773 AGCTCCTGCTAGGACCCTGCTGG - Intronic
1048879394 8:138860135-138860157 GGTTTCTGCCAGCTTCCTGCTGG + Intronic
1049052160 8:140207055-140207077 GGCTCCTGCCTGCCTTCTCCAGG - Intronic
1049291734 8:141806916-141806938 GGCTCCTCCCAGGCCCCAGCTGG - Intergenic
1049567463 8:143348522-143348544 CCCTCCTGCCACACCCCTGCAGG - Intronic
1049740929 8:144240508-144240530 GGCTCCAGCCAGCCCTGTGAGGG + Intronic
1049775367 8:144401469-144401491 GGCTCCTGCCAGCTGCACGCTGG + Exonic
1049962593 9:750854-750876 GGCTCCTTCCAGCTCCCTCATGG - Intergenic
1050472600 9:6008161-6008183 GCCCCCTCCCAGCCCCCCGCTGG - Intergenic
1051599963 9:18862809-18862831 GGCACCTGCCAGCAGCCTGAGGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1053784863 9:41646488-41646510 GGCTCCTGCTAGCCCCGCGGCGG + Intergenic
1054173587 9:61860433-61860455 GGCTCCTGCTAGCCCCGCGGCGG + Intergenic
1054663953 9:67720348-67720370 GGCTCCTGCTAGCCCCGCGGCGG - Intergenic
1056101068 9:83301154-83301176 AGCTCCAGCCAGCACACTGCAGG - Intronic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057542739 9:95990580-95990602 GGCTCGTTTCAGCCCGCTGCTGG + Intronic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1057830242 9:98400674-98400696 GGCTCCTCCCTGCTCCCTGCAGG - Intronic
1057929252 9:99179353-99179375 ATCTACTGCCAACCCCCTGCAGG - Intergenic
1058309521 9:103483931-103483953 GGCCTCTGCCACCTCCCTGCCGG + Intergenic
1059295876 9:113270122-113270144 TACTCCTTCCAGCCCCCAGCTGG - Intronic
1059353523 9:113682900-113682922 GGTCCCTGCCTGCCCACTGCAGG - Intergenic
1059706287 9:116826419-116826441 GGCTGCAGCCACCACCCTGCTGG + Intronic
1059761855 9:117345120-117345142 GGCTCCTGGCAGTCCTCTCCTGG - Intronic
1061015892 9:127980690-127980712 AGCTCCTGGCAGCCCCCTGGGGG - Intergenic
1061162160 9:128901797-128901819 GCCACCTGCCTGCCCCCTACAGG - Intronic
1061192368 9:129089245-129089267 TGCTGCTGCCAGCCCCTGGCTGG + Exonic
1061393436 9:130330382-130330404 CTCTCCTGCCAGCGCCCTGTAGG + Intronic
1061422160 9:130478329-130478351 GGCTCCTGGGAGCCCTGTGCAGG - Intronic
1061534302 9:131238239-131238261 CGCTCCTGCCAGGCCCTGGCTGG + Intergenic
1061777486 9:132975346-132975368 GGCTGCTGTCAGCTCCCTTCAGG + Intronic
1061800183 9:133109396-133109418 GGCTCGGGGCAGCCCCCGGCGGG - Intronic
1061876901 9:133548616-133548638 GGCTTCGGCCAGCCCCCTGGGGG + Intronic
1062161881 9:135085113-135085135 TCCTCATGCCAGCCCCCTACAGG - Intronic
1062287501 9:135779569-135779591 GGCTCCTGCCGCCCTCCTGCTGG + Intronic
1062452183 9:136620427-136620449 GGCCCCTGCCAGACCCAGGCCGG + Intergenic
1062493722 9:136821862-136821884 GCCTCCTGGCTGCCCCCAGCCGG + Intronic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1190234711 X:48606503-48606525 GTCTCCTCCCAGCCCCATCCAGG + Exonic
1192922663 X:75723984-75724006 GGCACCTGCCAGATCCCAGCTGG + Intergenic
1194208429 X:91039559-91039581 GGCACCTGCCAGATGCCTGCTGG + Intergenic
1196921698 X:120591838-120591860 GGCTACTGCCAGACCCCTGCTGG - Intergenic
1198414045 X:136401861-136401883 GTCTCCTGACAGCCTCCTGGAGG + Intronic
1199728011 X:150604071-150604093 GGCTCCTGTGAGCCTCCTCCTGG - Intronic
1200787745 Y:7274432-7274454 GGCGCCTGCCTACCGCCTGCAGG + Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic