ID: 1142496555

View in Genome Browser
Species Human (GRCh38)
Location 17:309422-309444
Sequence TATCCCGGACCCCCAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 3, 1: 3, 2: 0, 3: 9, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142496555_1142496561 -3 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496561 17:309442-309464 ATACGGCACATCCCTTGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1142496555_1142496573 29 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496573 17:309474-309496 AGCCCCCCTGCTGGGGGTCCGGG 0: 2
1: 0
2: 3
3: 22
4: 304
1142496555_1142496572 28 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496572 17:309473-309495 CAGCCCCCCTGCTGGGGGTCCGG 0: 2
1: 0
2: 1
3: 44
4: 394
1142496555_1142496566 20 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496566 17:309465-309487 GCTCCTGCCAGCCCCCCTGCTGG 0: 2
1: 1
2: 3
3: 47
4: 463
1142496555_1142496567 21 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496567 17:309466-309488 CTCCTGCCAGCCCCCCTGCTGGG 0: 2
1: 1
2: 5
3: 50
4: 529
1142496555_1142496562 -2 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496562 17:309443-309465 TACGGCACATCCCTTGTCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 65
1142496555_1142496570 23 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496570 17:309468-309490 CCTGCCAGCCCCCCTGCTGGGGG 0: 2
1: 0
2: 4
3: 52
4: 417
1142496555_1142496568 22 Left 1142496555 17:309422-309444 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496568 17:309467-309489 TCCTGCCAGCCCCCCTGCTGGGG 0: 2
1: 0
2: 12
3: 60
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142496555 Original CRISPR TATCCCGGACCCCCAGCAGG GGG (reversed) Intronic