ID: 1142496600

View in Genome Browser
Species Human (GRCh38)
Location 17:309537-309559
Sequence TATCCCGGACCCCCAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 3, 1: 3, 2: 0, 3: 9, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142496600_1142496617 26 Left 1142496600 17:309537-309559 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496617 17:309586-309608 CTCCTGCCAGCCTCCTGCTGGGG 0: 2
1: 2
2: 6
3: 57
4: 620
1142496600_1142496606 3 Left 1142496600 17:309537-309559 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496606 17:309563-309585 CACGTCCCCTGCCCTGCCCCAGG 0: 2
1: 1
2: 6
3: 89
4: 688
1142496600_1142496616 25 Left 1142496600 17:309537-309559 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496616 17:309585-309607 GCTCCTGCCAGCCTCCTGCTGGG 0: 2
1: 2
2: 4
3: 54
4: 470
1142496600_1142496615 24 Left 1142496600 17:309537-309559 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG 0: 2
1: 2
2: 6
3: 57
4: 510
1142496600_1142496618 27 Left 1142496600 17:309537-309559 CCCCCTGCTGGGGGTCCGGGATA 0: 3
1: 3
2: 0
3: 9
4: 102
Right 1142496618 17:309587-309609 TCCTGCCAGCCTCCTGCTGGGGG 0: 2
1: 2
2: 2
3: 58
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142496600 Original CRISPR TATCCCGGACCCCCAGCAGG GGG (reversed) Intronic
900656276 1:3759698-3759720 TATCATGGACCCCCAGGAGCTGG - Intronic
901049867 1:6420646-6420668 GAACCCGGACCCCTAGCCGGTGG - Intronic
901192763 1:7422332-7422354 TCTCACCCACCCCCAGCAGGAGG - Intronic
901688747 1:10959241-10959263 CATCCCGGTTCCCCAGCAGTGGG + Intronic
902242855 1:15100315-15100337 CACCCAGGACCCTCAGCAGGAGG + Intronic
902707682 1:18217011-18217033 AATTCCAGACCCACAGCAGGGGG + Intronic
902946974 1:19848264-19848286 GATCCTGGATCCCCAGAAGGAGG + Intergenic
903147478 1:21384023-21384045 TATCCTGGTCCCCCAGCAGATGG + Intergenic
905309716 1:37041029-37041051 TGTCCCGGACACTCAGGAGGAGG + Intergenic
905371215 1:37483545-37483567 GCTCCTGGACCCCCAGCAGCTGG + Exonic
906723203 1:48024053-48024075 TATCCAGGACACCCGGCAGGTGG - Intergenic
915145679 1:153794618-153794640 GAGCCAGGACCCCCAGCAGATGG - Intergenic
918902606 1:190443724-190443746 TATCCCCCACCACCAGCAGTTGG + Intronic
920180974 1:204131512-204131534 TCTCCTGTCCCCCCAGCAGGGGG + Exonic
920347419 1:205315258-205315280 TATCCTGGACCCACAGGAGAGGG + Intronic
924076137 1:240339129-240339151 GAGCCGGGACACCCAGCAGGAGG - Intronic
1065527554 10:26638288-26638310 TATCCCCGGCCCCAAGCAGGAGG + Intergenic
1065559283 10:26946100-26946122 TATCCCCGGCCCCAAGCAGGAGG - Intergenic
1067945253 10:50684953-50684975 TGTCCCTGACCCCCAACAAGGGG + Intergenic
1069686451 10:70322152-70322174 TATCCCCCACCCCCAGAAGGTGG - Intronic
1075879605 10:125839414-125839436 GATCACAGAACCCCAGCAGGTGG - Intronic
1078720688 11:13880848-13880870 TGTCACGGACCCCCTCCAGGGGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG + Intergenic
1084592054 11:70096382-70096404 GAACCAGGCCCCCCAGCAGGAGG + Intronic
1089757086 11:120695129-120695151 GCTCCCTGACCTCCAGCAGGAGG - Intronic
1093942551 12:25070276-25070298 TGTCCCCAACCCCCAGCTGGAGG + Intronic
1101726004 12:107388620-107388642 TGGCCCAGACCTCCAGCAGGAGG - Intronic
1102196450 12:111028862-111028884 CATCCCGGACCTGAAGCAGGAGG + Intergenic
1105624887 13:22103195-22103217 AATCCCAGGGCCCCAGCAGGGGG - Intergenic
1105857814 13:24387582-24387604 TATCCCCGATCCCCAGGTGGGGG - Intergenic
1117817673 14:59614203-59614225 GATCCCGGATCCCCAAAAGGAGG - Intronic
1123109953 14:105862235-105862257 TCTCCGGCACCCACAGCAGGTGG - Intergenic
1123119159 14:105908999-105909021 TTGCCCGGGCCCCCTGCAGGAGG - Intergenic
1123965590 15:25453793-25453815 CATCCCTCACCCCCAGTAGGAGG + Intergenic
1126112243 15:45182165-45182187 CATCCCTGACCCCCACCACGGGG + Intronic
1126442389 15:48703493-48703515 GATCCCGAAACCCCAGTAGGTGG - Intergenic
1128351366 15:66892540-66892562 GATCCTGGATCCCCAGCAGGAGG + Intergenic
1128640625 15:69333649-69333671 GATCCTGGATCCCCAACAGGAGG - Intronic
1128980850 15:72184458-72184480 TTTCCCGGGAGCCCAGCAGGTGG - Intronic
1130892992 15:88149301-88149323 TACCCTGCACCCCCAGCATGAGG - Intronic
1138709994 16:58960664-58960686 TATCATGGCCCCCCACCAGGTGG + Intergenic
1142496555 17:309422-309444 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496575 17:309477-309499 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496600 17:309537-309559 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496622 17:309596-309618 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142496641 17:309650-309672 TATCCCAGACCCCCAGCAGGGGG - Intronic
1142496662 17:309709-309731 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142496683 17:309769-309791 CATCCCGGACCCCTGGCAGGGGG - Intronic
1142872259 17:2828591-2828613 TTTCCCCGTCCGCCAGCAGGTGG + Intronic
1144331549 17:14228705-14228727 TAGCCCGGGACCCCAGCGGGGGG - Intergenic
1148455137 17:47807452-47807474 TGTGGTGGACCCCCAGCAGGGGG + Exonic
1149639598 17:58194046-58194068 TCGGCTGGACCCCCAGCAGGAGG + Exonic
1150764558 17:67993281-67993303 TCTCCCAGTCCCCCAGGAGGTGG + Intronic
1151094220 17:71477792-71477814 TATCCTTGGCCCCAAGCAGGAGG + Intergenic
1151692367 17:75694431-75694453 CAGCCCAGACCCTCAGCAGGAGG + Intronic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1154173522 18:12067519-12067541 TACACGGGACCCCCAGGAGGAGG - Intergenic
1155057807 18:22200476-22200498 TATCCCCTGCCCCCAGCAAGTGG - Intronic
1157569441 18:48702929-48702951 AAACCATGACCCCCAGCAGGAGG + Intronic
1161030150 19:2054251-2054273 TCTCCCACAGCCCCAGCAGGTGG + Intergenic
1161067499 19:2245944-2245966 CCTCCCGGACCCTCAGCAGTGGG + Intronic
1161118471 19:2512425-2512447 TCTCCCGGACCCCAGGGAGGTGG - Exonic
1161620310 19:5293775-5293797 TCCCCTGGACCCCCAGCGGGAGG - Intronic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
925947282 2:8877554-8877576 TATCCAGGCCCTGCAGCAGGTGG - Intronic
926202459 2:10811993-10812015 TCTCCTGAACCCCCAGGAGGCGG - Intronic
926238740 2:11069135-11069157 AAGCCAGGACACCCAGCAGGAGG + Intergenic
928304332 2:30154143-30154165 AATCCCAGACCCCTAGCTGGAGG + Intronic
934767101 2:96885701-96885723 TCTCCCTGACCCCCACCAGCAGG - Intronic
935784192 2:106534000-106534022 TATGTAGGACTCCCAGCAGGAGG - Intergenic
938483425 2:131680462-131680484 TCACCCGGACCCTCAGCAGAAGG + Intergenic
947340898 2:229138194-229138216 TCTCCTGGACCCTCAGAAGGGGG + Intronic
948901143 2:240957499-240957521 CGCCCCGGCCCCCCAGCAGGCGG - Intronic
1169082621 20:2806438-2806460 GTTCCCCCACCCCCAGCAGGAGG + Intergenic
1169213175 20:3778756-3778778 TGTCCCGGACCCCCAGGGAGGGG - Exonic
1174094659 20:48078741-48078763 GGTCCTGGAGCCCCAGCAGGTGG - Intergenic
1174128470 20:48325812-48325834 GACCCTGGACCTCCAGCAGGAGG + Intergenic
1174800223 20:53557182-53557204 TGCCCCCGACCCCCAGGAGGAGG - Intergenic
1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG + Intergenic
1182765051 22:32752718-32752740 GAGCCAGGACCCCCAGAAGGAGG - Intronic
1184229683 22:43151823-43151845 CCTCCCGAACCCCCAGCCGGAGG - Intronic
1184448958 22:44571501-44571523 TAGCCAGGACTCCCAGCAGCAGG - Intergenic
1185409545 22:50674683-50674705 CATCCCGGACCTGCAGCAGACGG + Intergenic
951039082 3:17968121-17968143 TATCCCTGCACCCCATCAGGGGG - Intronic
952082882 3:29782017-29782039 TATCCCTGCCCCCCACCTGGTGG + Intronic
961360875 3:126366326-126366348 CATCCCTGACACTCAGCAGGTGG - Intergenic
961869458 3:129977108-129977130 CATCCAGGAGCCCCAGCAGAAGG - Exonic
968553774 4:1237334-1237356 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553785 4:1237369-1237391 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553840 4:1237579-1237601 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553880 4:1237719-1237741 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553909 4:1237824-1237846 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968704674 4:2072354-2072376 CCTCCCAGACCCCAAGCAGGGGG + Intronic
968948162 4:3676378-3676400 TGTCCCTGAGGCCCAGCAGGTGG - Intergenic
970018416 4:11539036-11539058 GACCCAGGACCCCCAGCTGGAGG + Intergenic
981783551 4:148452657-148452679 TCTCCCTGACTCCCAGCAGAAGG - Intergenic
984878463 4:184390125-184390147 AAGCGCAGACCCCCAGCAGGTGG + Intronic
1001419112 5:171573645-171573667 TACCCCAGACCCCCAGAAGAGGG + Intergenic
1001710104 5:173771654-173771676 TTTCCCGAGCCCCTAGCAGGTGG + Intergenic
1002884484 6:1281483-1281505 CCTCCTGGACCCCCAGCAGCAGG - Intergenic
1003192350 6:3885792-3885814 CCTCCAGGTCCCCCAGCAGGTGG + Intergenic
1005548402 6:26892372-26892394 TATACCTGACCTCTAGCAGGAGG - Intergenic
1018344696 6:162888355-162888377 TTTCCTGGAGCTCCAGCAGGAGG - Intronic
1021352015 7:19605615-19605637 TATCCCCCACCCCCAGCCAGGGG + Intergenic
1021852404 7:24821524-24821546 TATGCCAGGCCTCCAGCAGGAGG + Intronic
1026947628 7:74326486-74326508 TCTCCTGGATCCCCAGCATGAGG - Intronic
1028178499 7:87686220-87686242 TATCCTGGGCCCCCAGCACAGGG - Intronic
1029381352 7:100217278-100217300 TGTCCTGGACGGCCAGCAGGGGG - Intronic
1029400782 7:100344588-100344610 TGTCCTGGACGGCCAGCAGGGGG - Intronic
1037319637 8:17630866-17630888 TCTCCTGGACCCTCAGCTGGAGG + Intronic
1042268784 8:66935362-66935384 AAACCTGGACCCCCACCAGGTGG - Intergenic
1046239692 8:111475015-111475037 CATCAGGGACCCCCAGCCGGGGG + Intergenic
1053005119 9:34599188-34599210 TCTCCCAGGCCCCCAGCAGCTGG + Intergenic
1062104114 9:134743480-134743502 GATCCAGGCCCCCCAGCAGGTGG - Intronic
1186408372 X:9323884-9323906 AATCCCGTATCCCCAGCATGAGG + Intergenic
1188389349 X:29600678-29600700 TATCCCTGCCCCCCACCTGGTGG - Intronic