ID: 1142496810

View in Genome Browser
Species Human (GRCh38)
Location 17:310376-310398
Sequence CACACACACGCGCCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142496810_1142496812 -6 Left 1142496810 17:310376-310398 CCTGCTGGGGGCGCGTGTGTGTG 0: 1
1: 0
2: 1
3: 31
4: 390
Right 1142496812 17:310393-310415 TGTGTGCCCAGGAGCACCTGAGG 0: 1
1: 1
2: 3
3: 35
4: 322
1142496810_1142496817 20 Left 1142496810 17:310376-310398 CCTGCTGGGGGCGCGTGTGTGTG 0: 1
1: 0
2: 1
3: 31
4: 390
Right 1142496817 17:310419-310441 TGTCCTCCCCAACCATGCCTGGG 0: 1
1: 0
2: 2
3: 30
4: 461
1142496810_1142496816 19 Left 1142496810 17:310376-310398 CCTGCTGGGGGCGCGTGTGTGTG 0: 1
1: 0
2: 1
3: 31
4: 390
Right 1142496816 17:310418-310440 CTGTCCTCCCCAACCATGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 363
1142496810_1142496819 25 Left 1142496810 17:310376-310398 CCTGCTGGGGGCGCGTGTGTGTG 0: 1
1: 0
2: 1
3: 31
4: 390
Right 1142496819 17:310424-310446 TCCCCAACCATGCCTGGGCCTGG 0: 1
1: 0
2: 0
3: 37
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142496810 Original CRISPR CACACACACGCGCCCCCAGC AGG (reversed) Intronic
900334756 1:2156908-2156930 CACACACACGTGCACACAACTGG - Intronic
900335301 1:2160227-2160249 CACACACACACGCACACTGCTGG - Intronic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
901373239 1:8817974-8817996 CACAAAGACGCGCCCGCGGCGGG - Intergenic
903604153 1:24562772-24562794 CCCCCACACCCACCCCCAGCTGG + Intronic
903965563 1:27087059-27087081 CACACACACACACACACAGCAGG + Intergenic
904339583 1:29826241-29826263 CACACACACGCACATGCAGCAGG + Intergenic
904384590 1:30132947-30132969 CACTCACATGTGCACCCAGCAGG - Intergenic
905797182 1:40822409-40822431 CACCCACCCCCACCCCCAGCAGG - Intronic
907995515 1:59627493-59627515 CACACACACACACACACAGCTGG + Intronic
910277431 1:85464603-85464625 CACACACACTCGCCCCCCGACGG + Intronic
910814593 1:91277499-91277521 CACACACACACACACCCACCAGG - Intronic
911660186 1:100492836-100492858 CACACACACACACACACAGCAGG - Intronic
912796428 1:112696245-112696267 CACACACACTCCCCACCTGCCGG - Exonic
915270902 1:154752723-154752745 CACACAGACATGCCCCCTGCTGG + Intronic
915307000 1:154986015-154986037 CACACACACACACACACAGCCGG - Intronic
916428018 1:164700170-164700192 CACACACATGCTCCCACAGAGGG - Intronic
917450924 1:175146737-175146759 CGGACACACGCGCCCTCTGCTGG - Intronic
917687223 1:177429409-177429431 CACACACACAAGTCACCAGCAGG + Intergenic
918575731 1:186057050-186057072 CACACACACACACACACAGCTGG + Intronic
919487169 1:198159012-198159034 CACACACACCGGCCCCGAGAAGG - Intronic
919810244 1:201404895-201404917 CACACACACGCTCCTCCCCCAGG + Exonic
919886626 1:201939756-201939778 CACACACACACACACACAGCAGG - Intronic
921023061 1:211254309-211254331 CACACACACTCACACCCTGCTGG + Intergenic
922118559 1:222638533-222638555 CACACACACACACACACAGCTGG + Intronic
923427413 1:233885114-233885136 CACGCACACCCTCCCCCAACAGG - Intergenic
923499419 1:234551878-234551900 CAGACACACGCCACCACAGCAGG + Intergenic
924608066 1:245552115-245552137 CACACACACACACACCCTGCTGG - Intronic
1063127246 10:3146448-3146470 CACTCACACTCGCTCCCAGGCGG - Intronic
1063488812 10:6444715-6444737 CACACACACACGCACGCAGAAGG + Intronic
1063531366 10:6834534-6834556 CACACACACACACACACAGCAGG - Intergenic
1063751879 10:8958510-8958532 CACACACACACACACACAGCTGG + Intergenic
1064836669 10:19539846-19539868 CACACACACACGCACAAAGCTGG - Intronic
1064934805 10:20667840-20667862 CACACACACACACACACAGCTGG - Intergenic
1065164409 10:22960164-22960186 CACACCCTCACGCCCACAGCAGG + Intronic
1067141895 10:43665015-43665037 CACACACACACACTCCCATCAGG - Intergenic
1067299638 10:44996805-44996827 CACACACACGCTGTCTCAGCAGG - Intergenic
1067717513 10:48700669-48700691 CACACACTCCCACCCCCAGGTGG - Intronic
1068998271 10:63233772-63233794 CACACACACACACCACCACCAGG + Intronic
1069834924 10:71302353-71302375 CACACACACGCTCGCTCAGGTGG - Exonic
1070557924 10:77544146-77544168 CACACACACACACACACAGCTGG - Intronic
1071239500 10:83688878-83688900 CACACACACACACCCCCAGAGGG + Intergenic
1071302265 10:84264853-84264875 CCCACCCACGCGGCCTCAGCAGG - Intergenic
1071399615 10:85256603-85256625 TGCACACAGGCGCTCCCAGCAGG - Intergenic
1073044170 10:100626426-100626448 CACACACACGCACACGCAGAAGG - Intergenic
1073224345 10:101904335-101904357 CACACACACATTCCCTCAGCAGG + Intronic
1073405576 10:103294272-103294294 CACACACACGCACGCAGAGCTGG + Intergenic
1074527028 10:114271626-114271648 CACACACACACACACACAGCAGG + Intronic
1075955722 10:126521063-126521085 CCCACACCAGCGCCCCCAACAGG + Intronic
1076786246 10:132751448-132751470 CACAGACAGGCGGCCCCACCAGG - Intronic
1076809698 10:132880086-132880108 CACACACACGTGCGCACAGCAGG - Intronic
1077209012 11:1359709-1359731 CACACACACGCTTCCCCTGAAGG - Intergenic
1078147228 11:8730292-8730314 CTCACACTCGCGCCCCCTGCCGG + Exonic
1079128088 11:17732882-17732904 CACACACACACACACACAGCTGG - Intergenic
1079597776 11:22272329-22272351 CACACACACACACACACAGCTGG + Intronic
1079969034 11:27013461-27013483 CACACACACACACTCCAAGCTGG - Intergenic
1081428965 11:42955270-42955292 CACACACACAAGCCCACACCTGG + Intergenic
1081482601 11:43503621-43503643 CACACACACACGCCCCCTATTGG - Intergenic
1081635872 11:44721619-44721641 CACACACACACACACCCTGCAGG - Intergenic
1081667321 11:44924087-44924109 CACACACACACAACCCCAGAAGG - Intronic
1082834953 11:57645004-57645026 CACACACACCCCCACCCACCCGG - Intergenic
1083592988 11:63906127-63906149 CACACACACACACACACAGCGGG - Intronic
1083624960 11:64067636-64067658 CACACACAGGGTCCCCAAGCAGG + Intronic
1083685611 11:64373307-64373329 CACACACACACACACCCCGCAGG - Intergenic
1083707104 11:64524322-64524344 CACACCCAACCTCCCCCAGCAGG + Intergenic
1083990004 11:66241063-66241085 CACACACATACACGCCCAGCAGG - Intronic
1084329396 11:68421772-68421794 CACACACACACACCCCCAGATGG - Intronic
1085284570 11:75351546-75351568 CGCCCCCACGCGCCCCCCGCCGG + Intronic
1086382338 11:86269316-86269338 CACACACACACACACCCAGATGG - Intronic
1087196106 11:95305655-95305677 CACACACACAAGCCTCCAGCTGG - Intergenic
1087681883 11:101227973-101227995 CACACACACACACACCCAACAGG + Intergenic
1088164714 11:106920160-106920182 CACACACACACGCACACACCAGG + Intronic
1089374675 11:117986142-117986164 CACACACACGTACCCACGGCCGG + Intergenic
1089654289 11:119935690-119935712 CTCACACCCGCTCCCCCACCAGG + Intergenic
1090439176 11:126712251-126712273 CACACACACTCGCCCTTATCTGG - Intronic
1091383168 12:76123-76145 CACACACACAAGGCCTCAGCAGG + Intronic
1091658051 12:2360188-2360210 CACACACACCCCACCCCACCAGG + Intronic
1092546274 12:9454262-9454284 CACACACACACACACCCTGCTGG - Intergenic
1092759836 12:11799743-11799765 CACACACACGCACACACATCAGG - Intronic
1092997245 12:13962113-13962135 CACACACACGTGCACGAAGCTGG + Intronic
1093677530 12:21961359-21961381 CACACACACACACACACAGCTGG + Intergenic
1094506670 12:31067808-31067830 CACACACACACACACCCTGCTGG + Intergenic
1095050369 12:37548692-37548714 CACACACACGCACACACAGACGG - Intergenic
1096466883 12:51851561-51851583 CACATGCATGCGCCCGCAGCAGG - Intergenic
1096717216 12:53498904-53498926 CACACACACACACACACAGCAGG - Intronic
1096750401 12:53755299-53755321 CACACACACACACCCCAAACAGG - Intergenic
1100613344 12:96210586-96210608 CACACACACACACCCCGAGTGGG + Intronic
1100985797 12:100200527-100200549 CACACACACACACACGCAGCCGG + Exonic
1102230568 12:111259027-111259049 CACACACACACACACACAGCTGG - Intronic
1102535525 12:113577767-113577789 CACACACACCCCCACCCACCTGG + Intergenic
1102866040 12:116374700-116374722 CACACACACACACACACAGCTGG + Intergenic
1103629471 12:122248056-122248078 CACACACACACACACACAGCTGG - Intronic
1105475000 13:20721505-20721527 CGCACGCACGCGCCCGCAGGCGG + Intronic
1105918601 13:24940292-24940314 CACACACACCCGACCCTAGATGG - Intergenic
1106104020 13:26718280-26718302 CACACACACACACCCCAAGAGGG + Intergenic
1106453271 13:29903884-29903906 GCCACACACCCGCACCCAGCTGG + Intergenic
1108543972 13:51472417-51472439 CACACACACACACACACAGCTGG - Intergenic
1108592175 13:51921900-51921922 CACACACACACGCACACAGTGGG - Intergenic
1110766774 13:79288725-79288747 CACACCCACCAGCCCCGAGCAGG + Intergenic
1110985086 13:81956813-81956835 CACACACACTGGTCCCCAGTTGG - Intergenic
1112008273 13:95272968-95272990 CACACACACACACCCCCTACAGG + Intronic
1112646130 13:101334189-101334211 CACACACACACACTCCCAGACGG + Intronic
1112858476 13:103800775-103800797 CACACACACACACCCCCACGTGG - Intergenic
1113617738 13:111693034-111693056 CACAAACACCTGCCCCCAGAGGG + Intergenic
1113671970 13:112181688-112181710 CACACACACGCGGACCCACGGGG - Intergenic
1113755979 13:112811275-112811297 CACACACACCCTCCCTCTGCCGG + Intronic
1113874035 13:113583581-113583603 CCCACACTCGCGCACACAGCCGG + Intergenic
1113951884 13:114076579-114076601 CACACACACGCGGCACACGCAGG + Intronic
1114724305 14:24918485-24918507 CACACACACACACACACAGCAGG + Intronic
1115545690 14:34462929-34462951 CACACACACACACCCCTAGACGG + Intergenic
1115573868 14:34692350-34692372 CACACACACACACACCCCGCTGG + Intergenic
1116186691 14:41607513-41607535 CACACACACACGCAGCTAGCTGG - Intergenic
1117334908 14:54748909-54748931 CACATACCTGCGCCTCCAGCTGG - Exonic
1118300809 14:64614333-64614355 CACACACACACACACACAGCAGG - Intergenic
1119477694 14:74940593-74940615 CACACACACACACCCCTTGCAGG + Intergenic
1121485378 14:94310529-94310551 CACAGACTCCCACCCCCAGCAGG + Intronic
1121796348 14:96739060-96739082 CACACACACACACACACAGCCGG - Intergenic
1122072108 14:99211626-99211648 CACACACACCCCCCTCCACCTGG + Intronic
1122201455 14:100125097-100125119 CACACACACCTGCCCCAAGGCGG + Intronic
1122201468 14:100125187-100125209 CACACACACCTGCCCCAAGACGG + Intronic
1122796030 14:104206686-104206708 CACACACATGCACACACAGCAGG - Intergenic
1122969171 14:105145500-105145522 GACAAACAGGCACCCCCAGCTGG + Intronic
1124687650 15:31796129-31796151 CACACACACGCACCCCTTACTGG - Intronic
1125756262 15:42067178-42067200 CACACACACCTGGCCCCAGGTGG - Intronic
1126403589 15:48300188-48300210 CACACACACGCTACCTCACCAGG - Intronic
1128804419 15:70519949-70519971 CACACACACACACCCCAATCTGG + Intergenic
1128916864 15:71570998-71571020 CACACACCCTAGCCCCAAGCAGG - Intronic
1129236186 15:74225106-74225128 CACACACACACGCCTCCAGGAGG - Intergenic
1129918931 15:79301963-79301985 CACACACACACTCCCCCACCTGG - Intergenic
1130073008 15:80664932-80664954 CACACACACACACACACAGCAGG + Intergenic
1130101908 15:80900576-80900598 CACACACACACACCCCTACCTGG - Intronic
1130509938 15:84581208-84581230 CACACACACATGCACACAGCAGG - Intergenic
1131381265 15:91965714-91965736 CACACACACACACACCCTGCTGG - Intronic
1131431957 15:92394696-92394718 CAGGCACACGCGCCTCCCGCCGG + Intronic
1131929417 15:97423214-97423236 CACACACACGCACACACAGAAGG + Intergenic
1132006619 15:98233272-98233294 CACACACACACACACACAGCTGG - Intergenic
1132240759 15:100255625-100255647 CACACACACACACACACAGCTGG + Intronic
1132285296 15:100658133-100658155 CACACACACACACACACAGCAGG - Intergenic
1132882567 16:2168872-2168894 CACACACCCCCACCCCCTGCTGG - Intronic
1133757879 16:8776291-8776313 CACACACATGCACACCCTGCAGG - Intronic
1133983753 16:10652548-10652570 CACACACACACACCCCCTCCAGG + Intronic
1134680847 16:16124373-16124395 CACACACACACACACACAGCCGG - Intronic
1135222029 16:20622189-20622211 CACACACACACACACCCACCAGG - Intronic
1135396851 16:22138287-22138309 CACACACACACACACACAGCAGG - Intronic
1135423937 16:22323026-22323048 CTCACACACCCGCCTCCACCTGG - Intronic
1136579426 16:31142732-31142754 CTCACCCCCGCGGCCCCAGCGGG + Exonic
1136775608 16:32870284-32870306 CACACACAGACGTCTCCAGCAGG - Intergenic
1136895009 16:33991228-33991250 CACACACAGACGTCTCCAGCAGG + Intergenic
1136996666 16:35195496-35195518 TACGCCCAGGCGCCCCCAGCTGG + Intergenic
1137556775 16:49475210-49475232 CACACACACGAGCACACACCAGG - Intergenic
1137992372 16:53171885-53171907 CACACACACACACACACAGCAGG + Intronic
1141622765 16:85245865-85245887 CACACACACGCACACGCAGGAGG - Intergenic
1142253076 16:89001669-89001691 GACACACACGGACCCCCACCTGG - Intergenic
1142259501 16:89036210-89036232 CACACACAGGCAGCCCCACCAGG + Intergenic
1203078026 16_KI270728v1_random:1132393-1132415 CACACACAGACGTCTCCAGCAGG - Intergenic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1143321046 17:6069379-6069401 CACACACACACGCACCGAGGTGG - Intronic
1144176677 17:12714350-12714372 CACACACACACACCCCGATCTGG + Intronic
1145305659 17:21673692-21673714 CACACACACGCACACACAGACGG + Intergenic
1145370993 17:22305789-22305811 CACACACACGCACACACAGACGG - Intergenic
1145765302 17:27455119-27455141 CACACACACACACCCTCGGCTGG + Intergenic
1146407451 17:32551575-32551597 CACACACACACGCATCCAGGTGG + Intronic
1147251197 17:39153327-39153349 CACACACACACACACCCTGCAGG - Intronic
1147395614 17:40140413-40140435 CACACACACACACACACAGCGGG + Exonic
1147419671 17:40316227-40316249 CACACAAACCCACCCCCCGCAGG - Intronic
1147589053 17:41669533-41669555 CAGCCACACCAGCCCCCAGCTGG - Intergenic
1148129864 17:45256228-45256250 CACACACACACCCCCTCACCGGG - Intronic
1148249649 17:46065113-46065135 TACACACGCTCGCCCACAGCAGG + Intronic
1148253345 17:46105938-46105960 CACACACACACCCCCCCAGAAGG + Intronic
1148744157 17:49909210-49909232 CACACACACGCACCCTGAGCTGG + Intergenic
1149865795 17:60150295-60150317 CGTGCACACGCTCCCCCAGCCGG - Intronic
1151595379 17:75075224-75075246 CACACACACACACACACAGCCGG + Intergenic
1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG + Intergenic
1152290641 17:79438113-79438135 CACACACACACGTCACCACCAGG + Intronic
1152601557 17:81264815-81264837 CTCAGACACGAGCCACCAGCGGG - Intronic
1152769253 17:82157379-82157401 CACGCAGACGCCCCCTCAGCAGG + Intronic
1152818322 17:82422230-82422252 GACACACAGGCCCACCCAGCAGG + Intronic
1152865348 17:82719255-82719277 CCCTCACACCAGCCCCCAGCTGG + Intronic
1152946428 17:83200090-83200112 CTCACCCACGCGCCCCAAGAGGG - Intergenic
1153495580 18:5695202-5695224 CACACACACGCTCCCTCCTCTGG - Intergenic
1153526092 18:5995979-5996001 CAGCCACACACGCCTCCAGCTGG - Intronic
1153775619 18:8451005-8451027 CACACACATGCACGCCAAGCTGG + Intergenic
1154052090 18:10970687-10970709 CACACACACACACACACAGCTGG + Intronic
1154078341 18:11228100-11228122 CACACACACACACACACAGCAGG + Intergenic
1154988715 18:21579825-21579847 CACACACACACACACACAGCAGG + Intronic
1158543556 18:58377636-58377658 CACACATACCTGCCCCCACCGGG + Intronic
1158909109 18:62041633-62041655 CACACACACACACACCCGGCGGG - Intergenic
1160035528 18:75298188-75298210 CACACACACACACCCCAAGAAGG - Intergenic
1161353892 19:3808718-3808740 AACACACACATGCTCCCAGCAGG - Intronic
1161522042 19:4730105-4730127 CACCCACACCCCTCCCCAGCGGG + Intergenic
1161816931 19:6504913-6504935 CACACATCCCCGCCCCCATCTGG - Intergenic
1161944948 19:7429687-7429709 CCCACAGACGCCCCCCAAGCTGG + Intronic
1162336207 19:10062043-10062065 CACACACACACTCCCCCGTCGGG - Intergenic
1163720522 19:18896221-18896243 CCCCCAGCCGCGCCCCCAGCGGG - Intronic
1163778263 19:19230879-19230901 CACACACACACACACACAGCCGG - Intronic
1164147596 19:22521597-22521619 CACACACACACACACACAGCTGG + Intronic
1164159013 19:22614502-22614524 CACACACACACACACACAGCTGG - Intergenic
1165255605 19:34575942-34575964 CACACACACACACACACAGCAGG - Intergenic
1165351808 19:35279705-35279727 CACACACACACACCCCCAAAGGG - Exonic
1165861620 19:38912089-38912111 CGCACTCACCCGCCCCCAGCAGG + Exonic
1167524872 19:49977385-49977407 CACACCCACGCGCTCCCTGGAGG - Intronic
1167717410 19:51152705-51152727 CACACACAGAGGGCCCCAGCAGG + Intronic
1167767327 19:51492173-51492195 CACACACAGGAGGCCTCAGCAGG - Intronic
1168046054 19:53795096-53795118 CACACACACACGCACACACCAGG - Intronic
1168075705 19:53980042-53980064 CACACACGTGCGCGCCCAGGTGG - Intronic
1168191298 19:54740489-54740511 CACACACACACTCCCCCAGTGGG + Intronic
1168203997 19:54836061-54836083 CACACACACACTCCCCCAGTGGG + Intronic
1168216970 19:54933539-54933561 CACACACACACACACCCAGCAGG + Intronic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
1168390714 19:56005633-56005655 CACACACACACGCGCGCAGGTGG + Intronic
925035428 2:681557-681579 CACACACACACACACACAGCTGG - Intergenic
926134111 2:10324717-10324739 CAAACACCCCCTCCCCCAGCAGG - Intronic
926547082 2:14255373-14255395 CAAGCACACGCACACCCAGCTGG + Intergenic
927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG + Intergenic
927684937 2:25163984-25164006 CACACACACACACCCCCCACAGG + Intronic
930949662 2:57124642-57124664 CACACACATGCACACACAGCAGG - Intergenic
932793248 2:74673804-74673826 CACACACACGGGCCACCCGTGGG - Exonic
933455009 2:82508732-82508754 CAGACACAGGTGCCCACAGCAGG + Intergenic
933759946 2:85666192-85666214 CACACACACAGCACCCCAGCTGG - Intronic
933759969 2:85666379-85666401 CACACACACAGTACCCCAGCTGG - Intronic
933759975 2:85666411-85666433 CACACACACAACACCCCAGCTGG - Intronic
935177886 2:100665119-100665141 CACACACACTCACACCCTGCTGG + Intergenic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG + Intergenic
936126297 2:109791513-109791535 CACACACAGCGGCCCCCAGCAGG + Intergenic
936218396 2:110579955-110579977 CACACACAGCGGCCCCCAGCAGG - Intergenic
936321981 2:111474892-111474914 CACACACACGCCCCTGCAGGTGG + Intergenic
936684676 2:114813975-114813997 CACACACACACACCACGAGCTGG + Intronic
937581326 2:123492386-123492408 CACACACACACACACCCAGTTGG - Intergenic
939299895 2:140322016-140322038 CACACACAAGTGGCCCCAGAAGG + Exonic
939802505 2:146727890-146727912 CACACACACACGTCACCAGTAGG + Intergenic
942124130 2:172806011-172806033 CACACACACACACACACAGCCGG - Intronic
942574568 2:177349823-177349845 TACACACACACCACCCCAGCTGG - Intronic
942574597 2:177350095-177350117 TACACACACACCACCCCAGCTGG - Intronic
942574638 2:177350423-177350445 TACACACACACCACCCCAGCTGG - Intronic
943447609 2:188007579-188007601 CACACACACACGCTCAGAGCAGG + Intergenic
943608880 2:190008757-190008779 CACACACACACACACCCACCTGG + Intronic
943643903 2:190387624-190387646 CACACACACCCACTGCCAGCAGG + Intergenic
944114446 2:196171697-196171719 CCCGCACACGCGCCCCCGGCCGG - Intronic
945033168 2:205683546-205683568 CACACACACACACTCCTAGCAGG - Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
945649264 2:212538612-212538634 CACCCCCACGCGCGCCCGGCTGG - Exonic
946076032 2:217074415-217074437 CACACACACCTGCCCCTGGCAGG + Intergenic
946372015 2:219286612-219286634 CACACACACGCCCCCGCGGGTGG - Exonic
948121779 2:235536162-235536184 CACACACACACACACACAGCAGG + Intronic
948121796 2:235536260-235536282 CACACACACACACACACAGCAGG + Intronic
948121813 2:235536358-235536380 CACACACACACACACACAGCAGG + Intronic
948121822 2:235536420-235536442 CACACACACACACACACAGCAGG + Intronic
948130591 2:235597675-235597697 CACACAGACAGGGCCCCAGCGGG - Intronic
948181892 2:235988857-235988879 CACTCACATGGTCCCCCAGCAGG + Intronic
948193503 2:236078146-236078168 CACACACACACACCCCCGGCTGG - Intronic
948202171 2:236137074-236137096 CACACACACACACCACTAGCAGG + Intergenic
948316567 2:237031881-237031903 CTCACACACACACCGCCAGCAGG + Intergenic
949040156 2:241844250-241844272 CCCACCCACGCGCCCCAGGCGGG - Intergenic
1169867432 20:10217301-10217323 CACACACACACATCCCTAGCTGG - Intergenic
1170847736 20:19976053-19976075 CACACACACGTTACCACAGCAGG - Intronic
1171544876 20:25992209-25992231 CACACACACGCACACACAGACGG - Intergenic
1172776619 20:37411154-37411176 CACACACACACACACCCTGCTGG - Intergenic
1174250676 20:49217281-49217303 CTCTCACATGCGCCCCCTGCTGG + Intergenic
1174985805 20:55450407-55450429 CACACACACACACCCCCAAAAGG - Intergenic
1175488410 20:59362434-59362456 CACACACACACACACGCAGCAGG - Intergenic
1176180279 20:63746641-63746663 CACACACCCGCACCACCTGCTGG + Exonic
1176282013 20:64318666-64318688 CACACACACAAGGCCTCAGCAGG - Intergenic
1176918339 21:14653852-14653874 CACACACACACACACACAGCAGG + Intronic
1176954392 21:15084458-15084480 CACACACACACACCCCCCTCTGG - Intergenic
1177712188 21:24791970-24791992 CACACACACTCTTACCCAGCAGG - Intergenic
1179565229 21:42243434-42243456 CACACACACGCGCACACACACGG - Intronic
1180105026 21:45612887-45612909 CAGACACGCAGGCCCCCAGCTGG - Intergenic
1180105074 21:45613123-45613145 CAGACACTCAGGCCCCCAGCTGG - Intergenic
1180785341 22:18543959-18543981 CACACACCCCCGCACACAGCAGG - Intergenic
1180959479 22:19756114-19756136 CACCCTCACGCCCACCCAGCAGG - Intergenic
1181128923 22:20718000-20718022 CACACACCCCCGCACACAGCAGG - Intronic
1181242245 22:21483312-21483334 CACACACCCCCGCCCACAGCAGG - Intergenic
1181688371 22:24544263-24544285 CACACACACACCCCCCCCACCGG - Intronic
1182308191 22:29386071-29386093 CTCAGACACAGGCCCCCAGCAGG + Intronic
1182623299 22:31629556-31629578 TACACGCACGCGCCCCCTACAGG - Intronic
1182841547 22:33394691-33394713 CACACACACACGCTCCCAGGAGG - Intronic
1184162125 22:42703053-42703075 CACACACACACACACACAGCAGG - Intronic
1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG + Intronic
1184757351 22:46524530-46524552 CACACACACACGCACACAACGGG - Intronic
1184760007 22:46538497-46538519 CACACACCCCCGCCTCCTGCGGG + Intergenic
1184776026 22:46623314-46623336 CACACAGACGCCCCCTCAACCGG - Intronic
1185033226 22:48456735-48456757 GACACACACGAGCCCACAACCGG + Intergenic
1185099591 22:48830603-48830625 CAAAGACAAGAGCCCCCAGCAGG + Intronic
949108428 3:228486-228508 CACACACACACACACACAGCAGG + Intronic
950453321 3:13078027-13078049 CACTCATCCGCGGCCCCAGCAGG - Intergenic
950611099 3:14127118-14127140 CACACACACGCACACACAGACGG - Intronic
951038171 3:17956956-17956978 CACACACACACGCTCCCATGGGG - Intronic
952089054 3:29862597-29862619 CACACACACACCCCTCCATCTGG - Intronic
952269491 3:31817555-31817577 CACCCACACCCACACCCAGCAGG + Intronic
952963937 3:38609652-38609674 CCCACACACGCGTCACCAGAGGG - Intronic
954300273 3:49697448-49697470 CACCCTCACTCACCCCCAGCAGG - Exonic
954502215 3:51029457-51029479 CACACCCACGAGGCCCCAGTGGG + Intronic
954574461 3:51668061-51668083 CACACACACACACACACAGCTGG - Exonic
956831649 3:73055404-73055426 CACACACACGCTACCCCACTAGG - Intronic
959123361 3:102259754-102259776 CACACACACACACACACAGCAGG - Intronic
959440352 3:106366722-106366744 CACACACACACACCCCAAACTGG - Intergenic
962318858 3:134374897-134374919 CACACACACACACACACAGCCGG - Intronic
962476597 3:135760532-135760554 CACACACACACACCCCCAATAGG + Intergenic
966773919 3:183527684-183527706 CACACACGCACACCCCTAGCTGG - Intronic
967863146 3:194168489-194168511 CACACACACACACCCCAAACAGG - Intergenic
967910084 3:194535470-194535492 CAGACACACGCCACCACAGCTGG + Intergenic
969155421 4:5205690-5205712 CACACACACGCGCGCGCGCCTGG - Intronic
969526878 4:7708366-7708388 CACCCACCCGGGACCCCAGCTGG - Intronic
970741427 4:19242408-19242430 CATACACACTTGCACCCAGCTGG + Intergenic
970908635 4:21247992-21248014 CACACACACACACCCCCCACAGG + Intronic
971876275 4:32312943-32312965 CACACACACACACACCCTGCTGG + Intergenic
972740826 4:41884606-41884628 CACACACAAGCAGCCCCTGCTGG + Intergenic
977410901 4:96661717-96661739 CACACACACACACCCCCACAGGG + Intergenic
977908192 4:102501257-102501279 GACACACGCGCGCACGCAGCGGG - Intergenic
978151113 4:105436229-105436251 CACACACACACACACCCCGCAGG + Intronic
979051641 4:115942230-115942252 CACACACACACACCCCCCACTGG + Intergenic
983349446 4:166569425-166569447 CACACACACACACACCCTGCAGG + Intergenic
983819167 4:172171695-172171717 CACAGACACGTGCCACCACCCGG - Intronic
984272499 4:177564693-177564715 CACACACACACACCCCCATACGG - Intergenic
985893173 5:2732029-2732051 CACACACATGCTTCCCCTGCAGG - Intergenic
987481725 5:18467481-18467503 CACACACACACGCACACACCTGG - Intergenic
992365454 5:76084729-76084751 CACACACGCGCGCTCCCAGACGG - Intronic
992504991 5:77378037-77378059 CACACACACACACCCCCTGTTGG + Intronic
994153595 5:96477311-96477333 CACACACACACACACACAGCTGG + Intergenic
994260871 5:97657036-97657058 CACACACACACACACACAGCTGG + Intergenic
997233426 5:132259133-132259155 CACACACACACACACACAGCAGG - Intronic
998150662 5:139755631-139755653 CACACACACACACACACAGCAGG - Intergenic
998370061 5:141655247-141655269 CACACACACACACCCCCTGATGG + Intronic
998879852 5:146634771-146634793 CACACACACACACCCCCTACTGG + Intronic
999902641 5:156101898-156101920 CACACACACACACACACAGCTGG - Intronic
1000811583 5:165869567-165869589 CACACACACCAGCCTCCAGAAGG - Intergenic
1001000619 5:168003336-168003358 CACACACACACCCCCAAAGCTGG + Intronic
1001381849 5:171310745-171310767 CACACACACGCGCACACACACGG + Intronic
1002584414 5:180233058-180233080 CACACACACACACACACAGCTGG + Intergenic
1003605272 6:7554112-7554134 CACACACACACACACCCAGTTGG + Intronic
1003670259 6:8150747-8150769 CACACACACACACCCCCTACTGG - Intergenic
1003708755 6:8565357-8565379 CACACACACACACCCCTACCAGG - Intergenic
1005608889 6:27504183-27504205 GGCATACACGAGCCCCCAGCTGG - Intergenic
1007041032 6:38722570-38722592 CACACACACCCCCACCCACCTGG - Intronic
1007120920 6:39380558-39380580 CACACACACACGCACACACCCGG + Intronic
1007738431 6:43996428-43996450 CACACACACACACACACAGCTGG - Intergenic
1009808728 6:68635063-68635085 CACCCGCCCGCGCCCCCGGCAGG + Intergenic
1010349179 6:74851297-74851319 CACACACACGCACACCCCACAGG + Intergenic
1011610640 6:89146710-89146732 CACACACACCTGCCCCGGGCGGG - Intronic
1011959226 6:93066823-93066845 CACACACACACACACACAGCAGG - Intergenic
1012975992 6:105781431-105781453 CACCCACTCCCGCCCCCAGTTGG + Intergenic
1013534863 6:111054704-111054726 CACACACACACACACACAGCAGG + Intergenic
1013836732 6:114342927-114342949 CACACACACGCGCACACAGCTGG - Exonic
1014626856 6:123736986-123737008 CACACACACGCACACCCCCCAGG + Intergenic
1015149180 6:130019636-130019658 CACACACACGGACCCGCGGCGGG + Intronic
1015149318 6:130020141-130020163 CACACACACGCGGCGCGAGGCGG - Intronic
1015306777 6:131717342-131717364 CACACACACACACCCCCCGCAGG - Intronic
1016293484 6:142549473-142549495 CACACACACACACCCCAAGCTGG - Intergenic
1017361587 6:153579067-153579089 CACACACACACACGGCCAGCAGG + Intergenic
1017725496 6:157273857-157273879 CCCACACTCGCCCTCCCAGCGGG + Intergenic
1018148773 6:160919278-160919300 CACACACACACACACACAGCTGG - Intergenic
1018521956 6:164659194-164659216 CACACACACACACACCCAGTAGG + Intergenic
1018579527 6:165296685-165296707 AACACACTCGCTCCACCAGCAGG - Intronic
1022093179 7:27121209-27121231 CACACACACACGCACACAGTGGG - Intronic
1023995683 7:45157774-45157796 CCCCCAGCCGCGCCCCCAGCGGG + Exonic
1025296276 7:57777274-57777296 CACACACACGCACACACAGACGG - Intergenic
1028532401 7:91852023-91852045 CACACACATCAGCCCCCAGCTGG - Intronic
1029683122 7:102126173-102126195 CACACACACACACACACAGCCGG - Intronic
1029696839 7:102219186-102219208 CACACACACACACCCTCTGCAGG - Intronic
1032373021 7:131378857-131378879 CACACACACGCACGCAAAGCTGG + Intronic
1033600810 7:142887189-142887211 CACACACACACTCCCCTGGCTGG - Intergenic
1035012978 7:155737232-155737254 CACACACACGCGCACCTAGATGG - Intronic
1035050627 7:155996903-155996925 CAGACACACGAGCCTCCAGAAGG - Intergenic
1036665625 8:10735274-10735296 CACACACACACACACCGAGCAGG + Intronic
1036753166 8:11455924-11455946 CACATTCACGCACACCCAGCAGG - Intronic
1037949622 8:23010426-23010448 CACACCCAGGCTCCCCCAGACGG - Intronic
1038251384 8:25908178-25908200 CACACACAGCTGCCCACAGCAGG - Intronic
1038395552 8:27243150-27243172 CAGACACACGGGCCCCAAGGCGG - Intronic
1041078926 8:54196025-54196047 CACACACACACACACACAGCTGG - Intergenic
1041275489 8:56153227-56153249 CACACACACACACCCCTACCTGG + Intergenic
1041613631 8:59880973-59880995 CACACACACACACCCCCATGGGG + Intergenic
1041664615 8:60430510-60430532 CACACACACGCTCCCCTGGAAGG + Intergenic
1042452697 8:68967289-68967311 CACACACACACAGCTCCAGCAGG + Intergenic
1042847106 8:73179288-73179310 CACACACACACACCCCTACCTGG - Intergenic
1043136059 8:76526726-76526748 CACACACACACACACCCCGCAGG - Intergenic
1043614472 8:82108547-82108569 CACACACACACACACACAGCAGG + Intergenic
1044368320 8:91377192-91377214 CACACATACCAGCCCCCATCAGG + Intronic
1044555522 8:93558268-93558290 CACACACACACACACACAGCAGG + Intergenic
1044616415 8:94147313-94147335 CACACACACCCCTCCCAAGCTGG + Intronic
1045753811 8:105517730-105517752 CACACACACACACCCCTAGTTGG + Intronic
1047040971 8:120995303-120995325 CACACACACACACACACAGCAGG - Intergenic
1049090460 8:140510627-140510649 CGCACCCACGCCCTCCCAGCCGG + Intergenic
1049707153 8:144048261-144048283 CACACACTCCCGCCGTCAGCTGG - Intergenic
1049836487 8:144738799-144738821 CACAAACAGGTGCCCCCAGGAGG - Intronic
1050821915 9:9889781-9889803 CACACACACACACACTCAGCAGG - Intronic
1053488759 9:38483657-38483679 CTCACACACACGCACCCTGCAGG - Intergenic
1053570051 9:39295503-39295525 CACACACACACACTCTCAGCCGG - Intergenic
1053836003 9:42136452-42136474 CACACACACACACACACAGCCGG - Intergenic
1054091681 9:60854505-60854527 CACACACACACACTCTCAGCCGG - Intergenic
1054113096 9:61130089-61130111 CACACACACACACTCTCAGCCGG - Intergenic
1054127097 9:61323513-61323535 CACACACACACACTCTCAGCCGG + Intergenic
1054594616 9:67052076-67052098 CACACACACACACACACAGCCGG + Intergenic
1056428762 9:86505848-86505870 CACACACACACACCCCCAGAGGG - Intergenic
1058322822 9:103656130-103656152 CACACACACGCACACACAACGGG + Intergenic
1060145743 9:121250863-121250885 CACACACACACACCCCAAGCAGG - Intronic
1060527039 9:124326588-124326610 CACACACACGCGCCCGGGTCAGG + Intronic
1060792018 9:126492125-126492147 CACACACACACACGCTCAGCAGG + Intronic
1061235380 9:129339270-129339292 CACACACACGCACACGCAGAGGG - Intergenic
1062511921 9:136910979-136911001 CACAGACACGGGCCCCAGGCAGG - Intronic
1185938544 X:4286465-4286487 CACACACACACACACCCATCCGG + Intergenic
1186443908 X:9609402-9609424 CACACACACACACCCCTACCTGG - Intronic
1186785834 X:12955269-12955291 CACACACACACACCCTCAACGGG - Intergenic
1187830624 X:23377566-23377588 CACACACACACACCCCTAGGAGG - Intronic
1188948327 X:36336298-36336320 CACTCACATTCTCCCCCAGCTGG + Intronic
1189054143 X:37680823-37680845 CACACACACTCGCACACAGAGGG - Intronic
1189310606 X:40014856-40014878 CACACACACACGCCGCCCGCAGG + Intergenic
1189323055 X:40097708-40097730 CACACACACCCAGCCCGAGCGGG - Intronic
1189349192 X:40264319-40264341 CACACACACACACCTCTAGCAGG - Intergenic
1189688962 X:43595449-43595471 TACACACACGCACACACAGCGGG + Intergenic
1190265634 X:48826197-48826219 CACACACACACACCACCAACAGG + Intergenic
1190708662 X:53049924-53049946 CACACACACACCCGGCCAGCAGG - Intronic
1193276121 X:79590169-79590191 CACACACACACACCAGCAGCAGG + Intergenic
1195178067 X:102329725-102329747 CACACACACACACCCCTTGCTGG + Intergenic
1195180797 X:102357368-102357390 CACACACACACACCCCTTGCTGG - Intergenic
1195716694 X:107825712-107825734 CACACACACGCACACCCGTCCGG + Intergenic
1199207130 X:145161822-145161844 CACACACACACACCCCGAGAGGG + Intergenic
1199299150 X:146192864-146192886 CACACACACACACCCCAAGAGGG - Intergenic
1200104300 X:153703768-153703790 CACACACAGACGCCTCCAGCAGG + Intronic
1200215938 X:154368314-154368336 CACACACACACGATGCCAGCAGG + Intronic
1201490873 Y:14540092-14540114 CACACACACACACACCAAGCTGG - Intronic
1201755871 Y:17484764-17484786 CACACACACCCACTCCCAGTTGG + Intergenic
1201845681 Y:18421221-18421243 CACACACACCCACTCCCAGTTGG - Intergenic