ID: 1142501104

View in Genome Browser
Species Human (GRCh38)
Location 17:333758-333780
Sequence TGTGAACCTGACTATGGAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142501104_1142501107 2 Left 1142501104 17:333758-333780 CCTTTTCCATAGTCAGGTTCACA 0: 1
1: 0
2: 0
3: 16
4: 356
Right 1142501107 17:333783-333805 CACTCAAAGCTGTCAGCTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142501104 Original CRISPR TGTGAACCTGACTATGGAAA AGG (reversed) Exonic
903292374 1:22322552-22322574 TGTGTATCTAAATATGGAAAAGG + Intergenic
908525893 1:64987046-64987068 TGTGCACCTGACTGTGGCAATGG - Intergenic
909271696 1:73629856-73629878 TGTGGAAATGACTTTGGAAATGG - Intergenic
910064809 1:83140572-83140594 TGTGGAAGTGACTTTGGAAATGG + Intergenic
910642811 1:89481709-89481731 TGTGAAAGTGACTTTGGAACTGG - Intergenic
913723877 1:121630691-121630713 TTTGAACATTTCTATGGAAAAGG - Intergenic
913740796 1:121841945-121841967 TTTGAACATTTCTATGGAAAAGG - Intergenic
913753872 1:122050500-122050522 TTTGAACATTTCTATGGAAAAGG + Intergenic
913755948 1:122074846-122074868 TTTGAACATTTCTATGGAAAAGG + Intergenic
913758740 1:122107289-122107311 TTTGAACATTTCTATGGAAAAGG + Intergenic
913766027 1:122191728-122191750 TTTGAACATTTCTATGGAAAAGG + Intergenic
913766356 1:122195461-122195483 TTTGAACATTTCTATGGAAAAGG + Intergenic
913768123 1:122215999-122216021 TTTGAACATTTCTATGGAAAAGG + Intergenic
916384741 1:164254870-164254892 TGTGAAAGTGACTTTGGAACTGG + Intergenic
917547213 1:175983600-175983622 TGTGGAACTGACTTTGGAACTGG + Intronic
917998692 1:180469084-180469106 TGTGTATCTGTTTATGGAAAAGG - Intronic
918531269 1:185524855-185524877 TGTGAAAGTGACTTTGGAACTGG - Intergenic
918619150 1:186582958-186582980 TGTGAAAGTGACTTTGGAACTGG + Intergenic
919522169 1:198601715-198601737 TGTGCAACTGACTTTGGAACTGG - Intergenic
921487796 1:215734966-215734988 TGTGGAAGTGACTTTGGAAATGG - Intronic
921899915 1:220439277-220439299 AGTGAACCTGACTCTGTAATAGG + Intergenic
922499938 1:226089478-226089500 TGTGTTCCAGCCTATGGAAAAGG - Intergenic
922530352 1:226340533-226340555 TGTGGAAGTGACTTTGGAAATGG + Intergenic
923570770 1:235112302-235112324 TGTTAACTTGACTTTTGAAATGG - Intronic
923888617 1:238186056-238186078 TATGAAACTGGCTATGCAAAAGG + Intergenic
923899948 1:238314789-238314811 TGTCAACCTGACTAGGTTAAGGG - Intergenic
924057397 1:240137640-240137662 TGTGTAGCTTACTGTGGAAAGGG + Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1065543369 10:26793287-26793309 TTTGGACCAGACTCTGGAAATGG + Intronic
1070211124 10:74323534-74323556 TGTGAAACTGACTGTGGTGATGG - Intronic
1070650036 10:78228703-78228725 GGAGAACCTGACTATGCAGACGG - Intergenic
1071155587 10:82684996-82685018 TGAGAACATGAATATGGGAAGGG + Intronic
1072963300 10:99950408-99950430 TGTGGAACTGACTTTGGAACTGG + Intronic
1074041526 10:109794116-109794138 TGTGGAAGTGACTATGGAACTGG - Intergenic
1074260381 10:111847729-111847751 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1074927281 10:118086017-118086039 TGTGAATGTGACTTTGGAACTGG - Intergenic
1075281768 10:121144806-121144828 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1075588478 10:123674701-123674723 TGAGAACTTGACTATGGAGTCGG - Intronic
1075652401 10:124137083-124137105 TGTAAACCTGTCAATAGAAAAGG + Intergenic
1076746712 10:132518190-132518212 CGTGAACCTGACCCTGGAGAGGG + Intergenic
1078488847 11:11750685-11750707 TGTGAGTTTGAATATGGAAAGGG + Intergenic
1078834799 11:15016956-15016978 TGTGAAAGTGACTTTGGAAGTGG + Intronic
1079954377 11:26844283-26844305 AGTCTACCTGAGTATGGAAAAGG + Intergenic
1080966319 11:37218458-37218480 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1083805243 11:65069631-65069653 TGAGAACCTCACTTTGGAAACGG + Intronic
1085282001 11:75337148-75337170 TCTGAAACTGACTTTGAAAAGGG - Intronic
1085875654 11:80403895-80403917 TGTGCAAGTGACTTTGGAAATGG + Intergenic
1086826844 11:91508687-91508709 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1086828761 11:91533716-91533738 TGTGGAAGTGACTATGGAACTGG + Intergenic
1087153185 11:94877063-94877085 TCTGAGCCTGAGGATGGAAATGG + Intergenic
1088084748 11:105963818-105963840 TGTGAAACTGTCTTTGGATATGG + Intronic
1088208915 11:107430261-107430283 TGTGAGCCTGTATATGGATAGGG + Intronic
1091316355 11:134616644-134616666 TGTGAAATTGACTTTGGAACTGG + Intergenic
1091501843 12:1025534-1025556 TGTGAACTTGAGTTAGGAAAAGG - Intronic
1091663827 12:2404109-2404131 TGTGTGCCACACTATGGAAAAGG + Intronic
1092141464 12:6186549-6186571 TGAGATCCTGGGTATGGAAAAGG + Intergenic
1092538939 12:9407673-9407695 TGTGAAGCATACAATGGAAAAGG - Intergenic
1093707538 12:22290909-22290931 TTTGAACATGAATATGAAAAAGG - Intronic
1095234709 12:39782643-39782665 TGTGAACTTGACATTGGAACTGG + Intronic
1097142145 12:56910622-56910644 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1097522078 12:60681831-60681853 TGTGAAGCAGACTTTGGAACTGG - Intergenic
1097654868 12:62346011-62346033 TGTGAACTTGACTATTGATATGG - Intronic
1098660627 12:73088566-73088588 TGTGAAAGTGACTTTGGAACAGG - Intergenic
1099302792 12:80918901-80918923 TGTGTATCTGAATATAGAAAAGG - Intronic
1099900052 12:88696280-88696302 TGTGAAATTGACTTTGGAACTGG - Intergenic
1099996592 12:89785812-89785834 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1103082256 12:118034475-118034497 TGTAACCCTGACTGTGGAAATGG + Intronic
1104240635 12:126985627-126985649 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1105269171 13:18854807-18854829 TGTGGACCTTCCCATGGAAAAGG - Intergenic
1105316002 13:19264123-19264145 TGTTAACCAAATTATGGAAAGGG + Intergenic
1108612313 13:52096270-52096292 TGTGAAAGTGACTTTGGAACTGG + Intronic
1108944481 13:56003743-56003765 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1109496302 13:63177268-63177290 TGTGGAAGTGACTATGGAACTGG + Intergenic
1109811986 13:67525365-67525387 TGTGGACATGACTTTGGAACTGG + Intergenic
1111323798 13:86664783-86664805 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1111385369 13:87520671-87520693 TGTGGAAGTGACTTTGGAAATGG + Intergenic
1111463581 13:88578107-88578129 TGAGAAGCTGAATATGCAAATGG + Intergenic
1111551335 13:89817458-89817480 TGTGGAGGTGACTTTGGAAATGG + Intergenic
1112861355 13:103832148-103832170 TGTGGAAGTGACTATGGAACTGG - Intergenic
1114942058 14:27624595-27624617 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1114987771 14:28251733-28251755 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1115065788 14:29257901-29257923 TGTGGACGTGATTTTGGAAATGG - Intergenic
1115068958 14:29297894-29297916 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1115936689 14:38560487-38560509 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1116165856 14:41333151-41333173 TGTGGACTTGACTTTGGAACTGG - Intergenic
1116275141 14:42823606-42823628 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1116559587 14:46360751-46360773 TGTGCAACTGACTTTGGAACTGG - Intergenic
1116642635 14:47485046-47485068 TGTGAAAATGACTTTGGAACTGG + Intronic
1118362130 14:65065596-65065618 TGTGAATCTAAACATGGAAAAGG + Intronic
1120270564 14:82308837-82308859 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1120457678 14:84753737-84753759 TGTGAAATTGACTTTGGAACTGG + Intergenic
1120693881 14:87622448-87622470 TGTGGACGTGACTTTGGAACTGG - Intergenic
1121336210 14:93078931-93078953 TGTGAACCGCACAATGGGAAAGG + Intronic
1122022062 14:98846308-98846330 TGTGCACATGACTATGGGATTGG + Intergenic
1123795488 15:23766363-23766385 TGTGAAGGTGACTTTGGAACTGG + Intergenic
1123999402 15:25742247-25742269 TGTGAAGCTGACTCTGAAAGAGG - Intronic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124896400 15:33781182-33781204 TGTGATCCTGCCTAAGGATAAGG + Intronic
1126399985 15:48258637-48258659 TGTGAAAGTGACTTTGGAACTGG - Intronic
1130517753 15:84639209-84639231 GGTGAAACTGACTATGGTATTGG - Intergenic
1131604846 15:93891342-93891364 TATGAACCTACCTATTGAAAAGG + Intergenic
1132280989 15:100615006-100615028 TGTGTACCTAACCATAGAAAAGG - Intronic
1134847883 16:17456180-17456202 TGTGAAACTGACTGTGGACGTGG - Intronic
1138278051 16:55750560-55750582 TTTGGATCTGCCTATGGAAATGG + Intergenic
1138730252 16:59186194-59186216 TGTGGAAGTGACTATGGAACTGG - Intergenic
1139084001 16:63562026-63562048 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1140207260 16:72943627-72943649 TGTCAATCTGACAATGAAAATGG + Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1144114444 17:12073709-12073731 TGTTAACTTGACTATGGTGATGG - Intronic
1144940017 17:18932462-18932484 TGTGAACCTGTCCCTAGAAATGG + Intergenic
1145022466 17:19442437-19442459 TGTGGAAGTGACTTTGGAAATGG + Intergenic
1147326494 17:39672223-39672245 TGGGAACCTGGCTAGGGCAATGG + Exonic
1149029364 17:52066198-52066220 TGTGAAAGTGACTTTGGAACTGG + Intronic
1149079002 17:52631874-52631896 TGTGGACGTGACTTTGGAACTGG + Intergenic
1149247166 17:54723462-54723484 TCTGAATCCGACTGTGGAAAGGG - Intergenic
1149341020 17:55686616-55686638 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1149683990 17:58525014-58525036 TGTGTACCTGTGTATGGAGAAGG + Intronic
1151249694 17:72824506-72824528 TGTGGACGTGACTTTGGAACTGG + Intronic
1151587881 17:75021989-75022011 TTTGAGCCGGGCTATGGAAAAGG + Intergenic
1153697487 18:7659014-7659036 TGAAGACCTGAATATGGAAATGG - Intronic
1154018162 18:10638370-10638392 TGAGAACCTGGCTAGGGAAGAGG + Intergenic
1154186708 18:12191212-12191234 TGAGAACCTGGCTAGGGAAGAGG - Intergenic
1155773144 18:29725451-29725473 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1156437599 18:37149620-37149642 TGTGTACCTGAATATAGAAAAGG + Intronic
1157811861 18:50703056-50703078 TCTGACCCTGACTTTGGGAAAGG - Intronic
1159637739 18:70825921-70825943 TGGGAACCTGAATACGCAAATGG - Intergenic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163222445 19:15931224-15931246 TGTGTCCCTGCGTATGGAAAGGG + Intronic
1164871668 19:31650603-31650625 TGTGCACGTGACTATGGAGAAGG - Intergenic
1166224757 19:41388031-41388053 TGAGCGCCTGGCTATGGAAAGGG - Intronic
1166442298 19:42825434-42825456 TGTGAGCCAGACAATGGAGATGG - Intronic
1166479025 19:43153701-43153723 TGTGAGCCAGACAATGGAGATGG - Intronic
1166501693 19:43346041-43346063 TGTGAGCCAGACAATGGAGATGG - Intergenic
1166508422 19:43387417-43387439 TGTGAGCCAGACAATGGAGATGG + Intergenic
925094647 2:1186363-1186385 TGTGAAAGTGACTTTGGAACTGG - Intronic
925931088 2:8708584-8708606 TGTGAGCCTTCATATGGAAAAGG - Intergenic
926952022 2:18253382-18253404 TGTGGAAGTGACTTTGGAAATGG + Intronic
928725881 2:34172707-34172729 TGTGAAAGTGACTTTGGAACTGG - Intergenic
929819937 2:45264847-45264869 TGTGAACCTCAATATATAAAGGG - Intergenic
929896982 2:45969236-45969258 TGGGAAACTCTCTATGGAAATGG - Intronic
930172663 2:48267343-48267365 TGTCAACCTGGCTATGTTAAGGG - Intergenic
932781040 2:74558659-74558681 TGTGAACCTGAGCATGGATATGG + Exonic
934469927 2:94514347-94514369 TGTGAAGCTTTCGATGGAAACGG - Intergenic
935385321 2:102493230-102493252 TGTGAAAGTGACTTTGGAACTGG - Intronic
935576860 2:104719925-104719947 TGTGAAAGTGACTTTGGAACTGG + Intergenic
936811341 2:116406870-116406892 TGTGGAACTGACTTTGGAACTGG + Intergenic
937454171 2:122026917-122026939 TGTCAACTTGACTAGGTAAAGGG - Intergenic
937525602 2:122765203-122765225 AGTGAAGCTGTCTATGGAACTGG - Intergenic
937561102 2:123224601-123224623 TGTGAAAATGACTTTGGAACTGG - Intergenic
937670477 2:124532742-124532764 TGTGATCCTGATTTTGCAAAAGG - Intronic
939364558 2:141215439-141215461 TGTGAAAGTGACTTTGGAACTGG + Intronic
940105161 2:150091390-150091412 TTTGATACTGACTATGGGAAAGG - Intergenic
940394737 2:153174895-153174917 TGTGAAAGTGACTTTGGAATTGG - Intergenic
940405300 2:153294262-153294284 TGGGAACCTGAGTATTGAGAAGG - Intergenic
940834975 2:158511019-158511041 TGTGAGCCTGAGTATGGTGAAGG + Intronic
940959076 2:159761950-159761972 TCTGAACCTGACAATTTAAAGGG - Intronic
941588135 2:167385041-167385063 TCTGCACCTGACTGTGGTAAAGG - Intergenic
943615388 2:190086433-190086455 TTTGAACCTAATTATGGAATAGG - Intronic
943732334 2:191315671-191315693 TGTGAGACTGACTATGTGAAGGG + Intronic
944891820 2:204125448-204125470 TGTGAGCCTGTGTTTGGAAACGG - Intergenic
945166743 2:206954601-206954623 TGTGGACATGACTTTGGAACTGG - Intronic
945403301 2:209414983-209415005 TGTCAACCTGACTGGGGTAAGGG - Intergenic
946206622 2:218113645-218113667 TGGGAACCTGATTTTGGGAAAGG + Intergenic
946988517 2:225301997-225302019 TGTGAACATAACTTTGGAACTGG + Intergenic
948104134 2:235399493-235399515 TGTGAACGTGACTTTGAAACTGG + Intergenic
1169417886 20:5433133-5433155 TGTCAACCTGACTAGGCTAAGGG - Intergenic
1169694716 20:8374450-8374472 GGGGAACCTGAAGATGGAAAAGG - Intronic
1170911841 20:20579723-20579745 TCTGAAACTGACTTTGGACATGG + Intronic
1174519885 20:51121256-51121278 TGAGAACCTGAATGTGCAAAGGG + Intergenic
1177918829 21:27124873-27124895 TGTGAAAGTGACTTTGAAAATGG - Intergenic
1178558819 21:33618562-33618584 TGGAAACCTGAATCTGGAAATGG + Intronic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1180631629 22:17234014-17234036 TGTGAACCTGTCTCCGGAAATGG - Intergenic
1180911643 22:19455041-19455063 TCTGTACCTGTCTATGGAGAGGG + Intronic
1181000045 22:19983787-19983809 TGTGGACCTGGCTAGGAAAAGGG + Intronic
1182879302 22:33719844-33719866 TGTGTACCTAAACATGGAAAAGG - Intronic
1184161768 22:42701269-42701291 TCTGAACCTGTCTGTGGACAGGG + Intronic
950169252 3:10826122-10826144 ATTGAACCTGTCTATGGACATGG + Intronic
951865030 3:27298565-27298587 TGTGAAAGTGACTTTGGAACTGG + Intronic
952185340 3:30961967-30961989 TGTGAAAGTGACTTTGGAACTGG - Intergenic
953397336 3:42583573-42583595 TGTCAACCTGACTAGGTTAAGGG + Intronic
953621552 3:44537045-44537067 TGTCAACTTGACTAGGCAAAGGG - Intergenic
955867934 3:63405205-63405227 TCTGTAGCTGTCTATGGAAAGGG + Intronic
956320064 3:67986590-67986612 TGTGAGCCAGATTCTGGAAATGG + Intergenic
959299525 3:104579613-104579635 TGTGAAAGTGACTTTGGAACTGG - Intergenic
959318996 3:104847494-104847516 TGTGAAAGTGACTTTGGAACTGG + Intergenic
959368383 3:105491899-105491921 TGTGAAAGTGACTTTGGAACTGG - Intronic
960938585 3:122918911-122918933 TGTGTCTCTGACTGTGGAAATGG + Intronic
961008084 3:123418214-123418236 TGTGAACTTGACTAGGCTAAGGG + Intronic
962651302 3:137495879-137495901 TGTGCACAAGACCATGGAAAAGG - Intergenic
963011779 3:140776693-140776715 TGTGAAAGTGACTTTGGAACTGG - Intergenic
963754485 3:149219740-149219762 TGTGAAAGTGACTTTGGAATTGG + Intronic
964508450 3:157424421-157424443 TGTGGACGTGACTTTGGAACTGG + Intronic
964545534 3:157829505-157829527 TGTGGAAGTGACTTTGGAAATGG - Intergenic
964897110 3:161612023-161612045 TGTGAAATTGACTTTGGAACTGG + Intergenic
965358307 3:167705982-167706004 TGTAAACCTAAGTAAGGAAATGG - Intronic
966314932 3:178634215-178634237 TGTGAAAGTGACTTTGGAACTGG - Intronic
967110399 3:186288452-186288474 TGAGAACCAGAATCTGGAAAGGG - Intronic
967324016 3:188220932-188220954 TTGGAAACTGACCATGGAAAGGG + Intronic
967748080 3:193082355-193082377 TGTCAACATGACTATGCCAAAGG + Intergenic
967845476 3:194039347-194039369 AGTGAACTTGGCTTTGGAAATGG + Intergenic
969011312 4:4064890-4064912 TGTGAAAGTGACTTTGGAACTGG - Intergenic
969650204 4:8462059-8462081 TGTGAACCTGTATATGAAACAGG + Intronic
970240273 4:14001850-14001872 TGTGGAGGTGACTATGGAACTGG + Intergenic
970788385 4:19827839-19827861 TATGAAAGTGACTTTGGAAATGG + Intergenic
970980816 4:22094959-22094981 TATGGAACTTACTATGGAAATGG - Intergenic
971797084 4:31242125-31242147 TGTGAAAATGACTTTGGAACTGG + Intergenic
971831948 4:31705704-31705726 TGTGGAAGTGACTTTGGAAATGG - Intergenic
972137262 4:35907835-35907857 TGTGGAAGTGACTATGGAACTGG + Intergenic
972301128 4:37786689-37786711 TGTGAAAGTGACTTTGGAACTGG + Intergenic
972484999 4:39532623-39532645 TGTGAAAGTGACTTTGGAACTGG + Intergenic
972980474 4:44694149-44694171 GGTGAACCTGACAAAGAAAATGG - Intronic
973182824 4:47290493-47290515 TGTGGAACTGACTTTGGAACTGG + Intronic
974475971 4:62380783-62380805 CTGGAACCTAACTATGGAAAAGG + Intergenic
975952245 4:79788231-79788253 TGTGAAAGTGACTTTGGAACTGG + Intergenic
976050633 4:81008457-81008479 TGTGGACGTGACTTTGGAACTGG + Intergenic
976270300 4:83223786-83223808 TTTGTTCCTGACCATGGAAAAGG - Intergenic
976797914 4:88955525-88955547 TGTGAATGTGACTTTGGAATTGG + Intronic
976814882 4:89136629-89136651 TGAGAACCTGACTTTGAAAGAGG + Intergenic
977021347 4:91764549-91764571 TGTGGAACTGACTTTGGAACTGG + Intergenic
977198763 4:94090211-94090233 TGTGGAAGTGACTTTGGAAATGG - Intergenic
978318932 4:107471928-107471950 TGTGAACATACCTATGGAAGTGG + Intergenic
980282862 4:130742822-130742844 TGTGAAAGTGACTTTGGAACTGG + Intergenic
980985344 4:139689730-139689752 TGTGAACCTGGCATTAGAAATGG + Intronic
981224984 4:142283648-142283670 TGTGTACCTAAACATGGAAAAGG + Intronic
981321422 4:143396166-143396188 AGTGACCCTGACTCTGGACAAGG + Intronic
981816901 4:148841048-148841070 TGTGGACCTGACTGTGAGAAAGG + Intergenic
982389255 4:154847061-154847083 TGTGGACGTGACTTTGGAACTGG + Intergenic
983255987 4:165401247-165401269 AGTGAGCCTGTCTATGGAAAAGG - Intronic
983322794 4:166214595-166214617 TGTGAACATGACTTTGGAACCGG - Intergenic
983825035 4:172249024-172249046 TGTGAAAGTGACTTTGGAACTGG + Intronic
983952683 4:173661221-173661243 TGTGGAAGTGACTTTGGAAATGG + Intergenic
983967198 4:173827233-173827255 TGTATAACTGATTATGGAAATGG - Intergenic
984721452 4:182977008-182977030 TGTGGAAGTGACTTTGGAAATGG + Intergenic
985074158 4:186196106-186196128 TGTAAAGCTGTCTATAGAAATGG + Intronic
985090399 4:186357073-186357095 TGGGAACCTAAGTAGGGAAAAGG + Intergenic
985785952 5:1894754-1894776 TGTGAAAGTGACTTTGGAACTGG + Intergenic
986014570 5:3746794-3746816 TGTGAAAGTGACTTTGGAACTGG + Intergenic
986987259 5:13513823-13513845 TGTGAAAGTGACTTTGGAACTGG + Intergenic
987560310 5:19511383-19511405 TGTGAAATTGACTTTGGAACTGG + Intronic
987632565 5:20493878-20493900 TGGGAGACTGAGTATGGAAATGG - Intronic
987983995 5:25122554-25122576 TGTGAAAGTGACTTTGGAACTGG - Intergenic
988060995 5:26170532-26170554 TGTCAACCTGACTAGGATAAAGG - Intergenic
990093530 5:52084011-52084033 TGTGAATGTGACTTTGGAACTGG - Intergenic
990498202 5:56369534-56369556 CTTGACCCTGACTATGTAAAGGG + Intergenic
992633751 5:78707553-78707575 TATGAAAGTGACTATGAAAATGG + Intronic
993251142 5:85524605-85524627 TGTGGACATGACTTTGGAACTGG + Intergenic
993481700 5:88431808-88431830 TGTGAAAGTGACTTTGGAACTGG - Intergenic
994849585 5:105036793-105036815 TGTGGAAGTGACTTTGGAAAAGG - Intergenic
995626521 5:114083498-114083520 TGTTAACCTGATTTTGGAAGTGG + Intergenic
996120939 5:119671420-119671442 TGTGAAAGTGACTTTGGAACTGG + Intergenic
996236983 5:121142349-121142371 TGTGAAAGTGACTTTGGAACTGG - Intergenic
996641530 5:125760978-125761000 TGTGGAAGTGACTTTGGAAATGG + Intergenic
998294350 5:140952651-140952673 TGTGAAAGTGACTTTGGAACTGG - Intronic
999145098 5:149387298-149387320 TGGGAACCAGACTTTGGAAATGG - Intronic
999316517 5:150587783-150587805 TGTGAAACAGCCTCTGGAAAAGG + Intergenic
1004039345 6:11960483-11960505 TGAGAGTCTGACTATAGAAATGG + Intergenic
1008273163 6:49513450-49513472 TCTGAATCTGAATATTGAAAGGG + Intronic
1009199586 6:60727353-60727375 TTTCAACCAGATTATGGAAAAGG + Intergenic
1009300191 6:62009003-62009025 TGTGGAAGTGACTTTGGAAATGG + Intronic
1009725975 6:67536530-67536552 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1009824217 6:68845870-68845892 TGTGGAACTGACTTTGGAACTGG + Intronic
1010061146 6:71624664-71624686 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1010555466 6:77274152-77274174 TGTGGAACTGACTTTGGAACTGG + Intergenic
1010802791 6:80197521-80197543 TGGCAACCTGACAAAGGAAATGG + Intronic
1010810523 6:80294083-80294105 TGTGGAACTGACTTTGGAATTGG - Intronic
1010868105 6:81005574-81005596 TGTGAATGTGACTTTGGAACTGG + Intergenic
1011779907 6:90776410-90776432 TGTAATGGTGACTATGGAAAAGG - Intergenic
1012029115 6:94036243-94036265 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1012653216 6:101783552-101783574 TGTGAAAGTGACTTTGGAACTGG + Intronic
1012745254 6:103078827-103078849 TGTGAAAATGACTTTGGAACTGG - Intergenic
1013317643 6:108957458-108957480 TGTGACTGTGACTATAGAAAGGG + Intronic
1013471573 6:110471177-110471199 TGTGTACCTAAACATGGAAAGGG - Intronic
1013910599 6:115271847-115271869 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1014115941 6:117669257-117669279 TGTGAAACCGACTTTGGAACTGG + Intergenic
1014397807 6:120948034-120948056 TGTGAATCTGATTAAGGAAGGGG - Intergenic
1014407359 6:121068341-121068363 TGTGAAAGTGACTTTGGAATTGG + Intergenic
1014621790 6:123675774-123675796 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1015053691 6:128874494-128874516 TGTGAAAATGACTTTGGAACTGG + Intergenic
1016587621 6:145707840-145707862 TGTGAAAGTGACTTTGGAACAGG + Intronic
1016721451 6:147303570-147303592 TGTGGAAGTGACTATGGAACTGG + Intronic
1020755151 7:12191999-12192021 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1020974647 7:14989530-14989552 TGAGAACCTGATTAAGGAAGTGG + Intergenic
1022759956 7:33337903-33337925 TTGGAACATTACTATGGAAAGGG - Intronic
1023363806 7:39443042-39443064 TGTGAGAGAGACTATGGAAATGG - Intronic
1024667159 7:51558577-51558599 TGTGGACATGACTTTGGAACAGG + Intergenic
1024936463 7:54716830-54716852 TCTGAACATGACTATGGATGAGG - Intergenic
1025721499 7:64019898-64019920 TGTGGAAGTGACTTTGGAAATGG + Intergenic
1025743524 7:64222698-64222720 TGTGGAAGTGACTTTGGAAATGG + Intronic
1027279302 7:76594177-76594199 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1027739262 7:81979320-81979342 TGTGACACTGACTACAGAAATGG + Intronic
1030507500 7:110443398-110443420 TGTGAACCTGAAAATTGGAAGGG + Intergenic
1031249212 7:119357803-119357825 TGTGAACGTGACTTTGGAACTGG - Intergenic
1031521971 7:122777933-122777955 TGTGAACTTGACTTTGGAACTGG + Intronic
1034359816 7:150484914-150484936 TGTAAACTTGACTTTGGAACTGG - Intergenic
1034371756 7:150604417-150604439 TGTAAACTTGACTTTGGAACTGG - Intergenic
1034379427 7:150677688-150677710 TGTAAACTTGACTTTGGAACTGG - Intergenic
1034742759 7:153494092-153494114 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1034751737 7:153575349-153575371 TGTGAAGGTGACTTTGGAACTGG + Intergenic
1036364653 8:8109964-8109986 TGTGGAACTGACTTTGGAACTGG + Intergenic
1037471298 8:19213855-19213877 TGTGAGCAGGACTTTGGAAATGG - Intergenic
1039642840 8:39242307-39242329 TGTGAAAGTGACTTTGGAACTGG - Intronic
1040098003 8:43466994-43467016 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1040678593 8:49782101-49782123 TGTCAACCTGACTAGAGTAAGGG + Intergenic
1041709237 8:60877555-60877577 TGAGACCCTCACTATGCAAATGG - Intergenic
1041823731 8:62068118-62068140 TGTGAAAATGACTTTGGAACTGG + Intergenic
1042754902 8:72200395-72200417 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1043518459 8:81018858-81018880 TGTGGAACTGACTTTGGAACTGG + Intronic
1044140375 8:88644129-88644151 TGTGAAGCTAACTAGGGAACTGG - Intergenic
1044194151 8:89354126-89354148 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1044517489 8:93156027-93156049 TGTTAATATGACTATGGACATGG + Intronic
1044888291 8:96803817-96803839 TGTGAGCCTGATTATGGCAAGGG + Intronic
1046366568 8:113239631-113239653 TGTTAACATGGCTTTGGAAATGG + Intronic
1046607483 8:116387987-116388009 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1047029362 8:120860352-120860374 TGTGAACTTGACACTGGAAAAGG - Intergenic
1047768925 8:128014754-128014776 ACTGAACCTGACTAAGAAAAGGG + Intergenic
1048069692 8:131008666-131008688 TGTGGACGTGACTTTGGAACTGG + Intronic
1048660816 8:136599216-136599238 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1048697770 8:137047591-137047613 TGTAAAACTGACTTTGGAACTGG - Intergenic
1050055783 9:1652502-1652524 GGTGAACCAGAGCATGGAAAGGG + Intergenic
1050953457 9:11626548-11626570 TGTGGAAGTGACTTTGGAAATGG + Intergenic
1051744123 9:20278776-20278798 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1051815844 9:21104581-21104603 TGTGAACATGAGCATGTAAATGG + Intergenic
1052070875 9:24080284-24080306 TGTGGACATGACTTTGGAACTGG + Intergenic
1052518288 9:29511067-29511089 TGTGCAAGTGACTTTGGAAATGG - Intergenic
1052977073 9:34419243-34419265 TCTGAATCTGAATATGAAAAGGG - Intronic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1053713382 9:40850648-40850670 TGTGAAGCTTTCGATGGAAACGG + Intergenic
1054423769 9:64980996-64981018 TGTGAAGCTTTCGATGGAAACGG + Intergenic
1054918466 9:70518148-70518170 TGTGAACCTGAGAATTGAACTGG + Intergenic
1055271954 9:74570837-74570859 TGTGAAGGTGACTAAGCAAATGG + Intronic
1055843392 9:80532301-80532323 TGTGGACATGACTTTGGAACTGG - Intergenic
1058147613 9:101429618-101429640 TGGGAAGATGACGATGGAAAAGG + Intronic
1058308902 9:103476094-103476116 TGTGAACCTAATTCTGGTAAAGG + Intergenic
1202799759 9_KI270719v1_random:164556-164578 TGTGAAGCTGAGTCTGGAGATGG + Intergenic
1186608753 X:11118059-11118081 TGTCAACCTGACTATGCCACAGG - Intronic
1186998039 X:15144658-15144680 TTTGTACGTGGCTATGGAAACGG - Intergenic
1187083384 X:16015327-16015349 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1189605272 X:42671297-42671319 TGTGGCCTTGGCTATGGAAATGG + Intergenic
1190588096 X:51967526-51967548 TGTTCCTCTGACTATGGAAAGGG - Intergenic
1190703738 X:53007773-53007795 TGTGAAAATGACTCTGGAACTGG - Intergenic
1191202792 X:57802764-57802786 TGTGGACGTGACTTTGGAACTGG + Intergenic
1192967686 X:76196329-76196351 TGTGGAAGTGACTTTGGAAATGG - Intergenic
1193176462 X:78400567-78400589 AGTCAACCTAACTGTGGAAATGG - Intergenic
1193460628 X:81787312-81787334 TGTGAAAATGACTTTGGAACTGG - Intergenic
1193473326 X:81933536-81933558 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1193585606 X:83318194-83318216 TGTGGAAATGACTTTGGAAATGG + Intergenic
1193795192 X:85865555-85865577 TGTGGAAGTGACTATGGAATTGG + Intronic
1193865738 X:86727944-86727966 TGTGAAGCTGACTTTAGAACTGG + Intronic
1194453750 X:94077294-94077316 TGTGAAAGTGACTTTGGAACTGG + Intergenic
1194985115 X:100481731-100481753 TGTCAACTTGACTATGTTAAGGG - Intergenic
1195545117 X:106105393-106105415 TGTGGACGTGACTTTGGAACTGG + Intergenic
1195650201 X:107275661-107275683 TTTGAAACTGTCTATGGAACAGG + Intergenic
1196015336 X:110933941-110933963 GGTGCACCTGACTGAGGAAAGGG - Intergenic
1197349894 X:125370615-125370637 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1197480208 X:126974540-126974562 TGTGAAAGTGACTTTGGAACTGG - Intergenic
1197560629 X:128015827-128015849 TGTGAAAATGACTTTGGAACTGG - Intergenic
1197910880 X:131481636-131481658 TGTGAAACTGACTTTAGAACTGG + Intergenic
1198707117 X:139461538-139461560 TGTGGAACTGACTTTGGAACTGG + Intergenic
1198913499 X:141639279-141639301 TGTGAAAGTGACTTTGGAACTGG - Intronic
1199134376 X:144233517-144233539 TGTGGAACTGACTTTTGAAATGG + Intergenic
1199458811 X:148060141-148060163 TGTGGAACTGACTTTGGAACTGG - Intergenic
1199465954 X:148137461-148137483 TGTCAACTTGACTAGGCAAAGGG + Intergenic
1199931950 X:152531791-152531813 TGTGAAAGTGACTGTGGAACTGG - Intergenic