ID: 1142501412

View in Genome Browser
Species Human (GRCh38)
Location 17:335262-335284
Sequence CAGGGTGAACAGTGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 0, 3: 82, 4: 631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142501405_1142501412 19 Left 1142501405 17:335220-335242 CCGGGTGAGACTATCTCTATGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG 0: 1
1: 0
2: 0
3: 82
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142501412 Original CRISPR CAGGGTGAACAGTGGGAAGG AGG Intronic
900504389 1:3022034-3022056 CAGGGAGAACCGTGAGAAGATGG + Exonic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900769324 1:4528318-4528340 GGGGGTGAACAGTGGGAAGCGGG + Intergenic
901141792 1:7039231-7039253 GAGGAAGAAAAGTGGGAAGGTGG - Intronic
901810322 1:11763761-11763783 AAGGGTGACCAGTTGGGAGGTGG + Intronic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902315713 1:15617273-15617295 GAGGGGGAGGAGTGGGAAGGGGG - Intergenic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903319245 1:22532207-22532229 CAGAGTGAACAGTGGTACGAGGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906035472 1:42747947-42747969 GAGGGTGGAGAGTGGAAAGGTGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906742290 1:48194244-48194266 GAGGGTGAAGGGTGGGGAGGAGG + Intergenic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907875951 1:58488774-58488796 CAGGGGAAACAGTGAGAAGTGGG - Intronic
908494323 1:64679497-64679519 GAGGGAATACAGTGGGAAGGGGG - Intronic
908511413 1:64852679-64852701 CAGGGTTAACAATGTGAATGGGG + Intronic
909095523 1:71283027-71283049 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
909559732 1:76996697-76996719 CAGTATGTACAGTTGGAAGGAGG + Intronic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
910308940 1:85801205-85801227 TTTGTTGAACAGTGGGAAGGAGG - Intronic
910355977 1:86355673-86355695 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911548589 1:99252089-99252111 GAGGGTGAAGGGTGGGAAGAGGG + Intergenic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
912100712 1:106201320-106201342 CTGGGAGGACAGTGGGGAGGAGG - Intergenic
912151882 1:106869635-106869657 GAGGGTGAAGAATGGGAAGAGGG - Intergenic
912199444 1:107439953-107439975 CAGGGTGAGCAGTGGAAGAGGGG - Intronic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913356143 1:117924274-117924296 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915936119 1:160091276-160091298 CAGGGTGCATAGTAGGGAGGTGG - Intergenic
917149229 1:171927389-171927411 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
917312838 1:173694706-173694728 AAGGGGGAAGAGTGGGTAGGAGG - Intergenic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917697595 1:177542422-177542444 CAGGGTGGAGACTGGGAAGAGGG + Intergenic
917815486 1:178705655-178705677 CAGAGTGAAAAGTGAGAATGAGG - Intergenic
919611799 1:199754368-199754390 CAAGGTGACCAGTGGAAAGGGGG - Intergenic
920072635 1:203313550-203313572 CAGGTTGCACAGTGGATAGGTGG - Intergenic
920321065 1:205123008-205123030 CAGGGTGCACTGTGTGAATGAGG - Intergenic
920685306 1:208104656-208104678 TAGGGTGTACAGTGGGTGGGAGG + Intronic
921266604 1:213425875-213425897 GATGGTGACCAGCGGGAAGGTGG + Intergenic
921501733 1:215912798-215912820 GAGGGTGAAGGGTGGGAAGATGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1063847330 10:10145222-10145244 CATGGGGAGCAGTAGGAAGGAGG - Intergenic
1064521423 10:16206935-16206957 TAGGGGGAAGAGTGGGAGGGGGG - Intergenic
1065543081 10:26789771-26789793 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065939771 10:30553775-30553797 AAGGGGGAAGAGTGGGCAGGAGG - Intergenic
1066058765 10:31704290-31704312 AATGGGGAGCAGTGGGAAGGGGG + Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1066553417 10:36584579-36584601 AAGGATGAAAAGTAGGAAGGAGG - Intergenic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069943820 10:71972802-71972824 CAAGGGGAAAAGGGGGAAGGAGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1072505899 10:96066676-96066698 CAGTTTAAACATTGGGAAGGAGG + Intergenic
1072960162 10:99922273-99922295 TAAGGGGTACAGTGGGAAGGGGG - Intronic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1075157409 10:119989550-119989572 CAGGGTGATCTCTGGGTAGGTGG + Intergenic
1075546785 10:123361191-123361213 CAGGGTGAGCAGTGGGTCAGGGG + Intergenic
1075834067 10:125438102-125438124 GAGGGTGGTCAGTGGCAAGGAGG + Intergenic
1076201197 10:128559611-128559633 CATGGTGGACATTGGGATGGAGG - Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1077499937 11:2904743-2904765 CAGGGGCTGCAGTGGGAAGGGGG + Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078289139 11:9989288-9989310 TGGGGTGAAGAGTGGGAGGGAGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078701125 11:13684061-13684083 CATGGTGAACATTGTGAATGAGG + Intronic
1079503885 11:21132761-21132783 CATGGTGAGCAGTGGGGTGGGGG + Intronic
1079993895 11:27274953-27274975 GATGGTCAAGAGTGGGAAGGTGG - Intergenic
1080818684 11:35784013-35784035 GAGGGTGAACAGTGAGACAGAGG + Intronic
1081252603 11:40853740-40853762 CAGGGTGAACTGTGTTATGGAGG + Intronic
1081710285 11:45211714-45211736 TGGGGGGAAGAGTGGGAAGGGGG - Intronic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1082004888 11:47414022-47414044 CAGGGGGAACAGTGTGAGGTGGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082651574 11:55800332-55800354 CAGGGTGAAGGTTGGGAAGAGGG + Intergenic
1082921314 11:58497705-58497727 GAGGGTGAAGGGTGAGAAGGAGG + Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083365810 11:62140876-62140898 CAGGGTCAGAAGTGGGCAGGCGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083879561 11:65541331-65541353 CAGGGTGGACAGGGCCAAGGGGG - Intronic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084715729 11:70872375-70872397 CGGGGTGCACAGTGGAAAGGAGG + Intronic
1084899789 11:72300926-72300948 CAAGGTAAACAGTGGTATGGGGG + Intronic
1084933372 11:72574257-72574279 CATGGTGACCAGTGGGTCGGGGG - Intergenic
1084996943 11:72989940-72989962 AAGGGTGAATAGTGTGGAGGAGG + Intronic
1085423220 11:76381116-76381138 CAGGGTGCATTGTGGGAAGGAGG - Intergenic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1087449405 11:98299411-98299433 AAGGGGGAAGAGTGGGAATGGGG - Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087614616 11:100473570-100473592 CAGGGTTAAAAGTTGGAAAGTGG - Intergenic
1087692116 11:101332766-101332788 GAGGGTGGAAGGTGGGAAGGAGG + Intergenic
1087729540 11:101762684-101762706 AAGGGTGGAGAGTGGGAAGAGGG - Intronic
1088151401 11:106749755-106749777 GAGAGTGAAGAGTGAGAAGGAGG - Intronic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089865701 11:121629315-121629337 CAGGAGGGACAGTGGGAAGCTGG + Intronic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094075273 12:26465561-26465583 GAGGGAGAACAGAGGGAAAGTGG + Intronic
1094487476 12:30936536-30936558 CAGGGAGAAGAGTGGAATGGTGG + Intronic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095247571 12:39940859-39940881 GAGGGGGAAGAGTGGGATGGGGG - Intronic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1098475903 12:70902729-70902751 CAGGGAGAAGAGTGGGAGGGGGG + Intronic
1098818359 12:75197249-75197271 GAGGGTGGAAATTGGGAAGGAGG - Intronic
1099240503 12:80132848-80132870 CAGGTTGAACATTATGAAGGTGG + Intergenic
1099516951 12:83608693-83608715 TAGGGTGAAGACTGGGAGGGGGG + Intergenic
1099525755 12:83717945-83717967 CAGGTTCACCAGTGGGAATGTGG - Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099927647 12:89037758-89037780 CAGGGTGAAGAGGTGGGAGGCGG - Intergenic
1101232446 12:102755268-102755290 CAGGGTGAGAAGTGGAGAGGTGG - Intergenic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1101850354 12:108397008-108397030 AATGGTGAACAGTGGAAATGGGG + Intergenic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1102873254 12:116430495-116430517 CAGTGAGAAAAGTGGGCAGGAGG - Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1105049367 12:133035032-133035054 CAGGGTGCACACTGTGAAGGGGG - Intergenic
1105423392 13:20272817-20272839 CAAGGAGAACAGTGGGGTGGAGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106655642 13:31743588-31743610 GAGTCAGAACAGTGGGAAGGGGG - Intronic
1106682966 13:32027427-32027449 CTGGGTGGTCAATGGGAAGGAGG - Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108151299 13:47537521-47537543 CAGGGAGAAGGGTGGGAGGGAGG + Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1109759720 13:66812066-66812088 TAGGGGGAAGAGTGGGAAGGGGG - Intronic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1111586690 13:90291392-90291414 CTGTGTGAACAGTGGAACGGGGG + Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115013273 14:28577013-28577035 CAGGGGGAAAGGTGGGAGGGAGG + Intergenic
1115435077 14:33362965-33362987 CATGGTTCACAGTGGGAAGGTGG - Intronic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118305455 14:64651367-64651389 CAGGGTGAATAGCTGGAAAGTGG + Intergenic
1118768879 14:68928693-68928715 CTCAGTGAACAGTGGGGAGGAGG + Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1121438628 14:93934961-93934983 AGGGGTGAACAATGGGAAGGTGG - Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122804747 14:104250643-104250665 GGGGGTGAAAAGGGGGAAGGAGG + Intergenic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1125067744 15:35510629-35510651 CAAGGTGAAGAGTGGGGAGTTGG - Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125600512 15:40912969-40912991 AAGGGGGAACAGGGAGAAGGAGG + Intergenic
1126442502 15:48705106-48705128 GAGGGTGAAGAGTGGGAAAAGGG + Intergenic
1126906920 15:53377954-53377976 TAGGGTGGGCAGTGGGGAGGGGG - Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1129188383 15:73923981-73924003 CAGGGTGAACCTTGTGCAGGGGG - Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1129934333 15:79437177-79437199 AAGACTGAACAGTGGTAAGGAGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130515957 15:84625927-84625949 CAGGGTGAACAGGGGCACTGAGG - Intronic
1130562609 15:84970452-84970474 CAGGAAGAAAAGTGGGAAGTAGG + Intergenic
1131027597 15:89157902-89157924 CAGGGTGAATAGTGAGTATGTGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131619999 15:94058010-94058032 CAGGGGCAACGGTGGGCAGGAGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132414558 15:101611047-101611069 CTGGAGGAACAGTGGGGAGGAGG - Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132685266 16:1159444-1159466 CAGGGTGGGCCGTGGGGAGGAGG + Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133548087 16:6827640-6827662 AAGGGTGAGGAGGGGGAAGGAGG - Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135399530 16:22156599-22156621 CATGGTGAACAGTGAGCAGGCGG + Exonic
1136033913 16:27524135-27524157 CAGGCTATACAGTGGGAAGCGGG + Intronic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138132287 16:54490801-54490823 CAGGTTGCACACTGGGAAGAAGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1138544215 16:57706383-57706405 ATGGGAGAACAGTGGGTAGGAGG - Intronic
1138544324 16:57706741-57706763 ATGGGAGAACAGTGGGTAGGAGG - Intronic
1138619369 16:58198605-58198627 CAGGGTCCAGAGGGGGAAGGAGG - Intergenic
1138948576 16:61882721-61882743 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139640457 16:68287868-68287890 CAGGGTAAGTGGTGGGAAGGGGG + Exonic
1139641693 16:68296350-68296372 CATGGTGCACTGTGGGAAAGGGG - Exonic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140656474 16:77145479-77145501 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1141303187 16:82837147-82837169 GAGGGTGAATGGTGGGAAGTGGG + Intronic
1141476087 16:84274411-84274433 CTGGGTGACGAATGGGAAGGTGG - Intergenic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142510460 17:389588-389610 TCTGGTCAACAGTGGGAAGGAGG - Intergenic
1142510489 17:389686-389708 CCTGGTCAAGAGTGGGAAGGGGG - Intergenic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142923198 17:3209180-3209202 CGGGGGGAAGAGTGCGAAGGGGG - Intergenic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143856833 17:9857582-9857604 CAGTGTAAACAGTGGGGAAGGGG - Intronic
1144738728 17:17569354-17569376 CAGGGTGCACTGTGGGAGAGAGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146490647 17:33279173-33279195 AAGGGTGAAGAGTGAGAAGCAGG + Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150213167 17:63452635-63452657 TAGGGAGAAAAGTGGGGAGGTGG - Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150875624 17:68967169-68967191 AAGGGGGAAAGGTGGGAAGGGGG - Intergenic
1150885456 17:69080671-69080693 GAGGGATAAAAGTGGGAAGGAGG + Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1150962393 17:69928596-69928618 CAGGGTGAACAATTGGAACAAGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151508273 17:74543275-74543297 CAGGGTGACCTGGGGGAATGGGG + Intronic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1154004548 18:10515863-10515885 CATGGGGCACAGTGGGAAAGTGG + Intergenic
1154310877 18:13265417-13265439 CAGGCAGCACAGTGGGAAGGGGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155657249 18:28206609-28206631 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1156284657 18:35679957-35679979 CATGGTGAACAGATGGGAGGGGG - Intronic
1156446542 18:37241356-37241378 AAGGGTACACAGTGGGGAGGTGG + Intergenic
1157804090 18:50645092-50645114 CAGGGAGAACTGGTGGAAGGCGG + Intronic
1157972221 18:52283772-52283794 CAAGGTGAACAGTGGATAGGGGG - Intergenic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1160052987 18:75454761-75454783 CAGGGTGCATAGTGGGCAGCCGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160411092 18:78675949-78675971 CTGAGTGAACGGTGGGCAGGTGG - Intergenic
1160910998 19:1473786-1473808 CAGGGTGGAAGGTGGGGAGGGGG - Exonic
1161249866 19:3274812-3274834 CAGGGTGGAGAGTGTGAAAGGGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161927627 19:7312986-7313008 CCGGGTAAAGACTGGGAAGGCGG - Intergenic
1162020410 19:7865651-7865673 CAGGGAGGACAGTGAGTAGGGGG + Intergenic
1162115856 19:8428993-8429015 TAGGGAGAAAAGTGGGAGGGAGG + Intronic
1162800113 19:13105468-13105490 CAGGGTGAGTGGTGGTAAGGTGG - Exonic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163148989 19:15400109-15400131 GAGGAGGAAGAGTGGGAAGGGGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1164152641 19:22568524-22568546 CAAGGTGCTCAGTGGGCAGGAGG - Intergenic
1164298712 19:23939115-23939137 GGGGGGGAAGAGTGGGAAGGGGG - Intronic
1164501371 19:28823167-28823189 CAGGGAGAAGAGTGGAGAGGGGG + Intergenic
1164596964 19:29536606-29536628 TAGGGAGAACTGTGGGAAGGAGG - Intronic
1165472804 19:36013309-36013331 CAGGGTGCAGAGGGTGAAGGAGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165949255 19:39464772-39464794 CAGGGTGAGCCGGTGGAAGGAGG - Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1166852257 19:45766534-45766556 CAGGTTCAATAGTGGGGAGGTGG + Exonic
1167669925 19:50844888-50844910 AAGTGTGAAAAGTGTGAAGGGGG - Intergenic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
1168501882 19:56899780-56899802 CATGGTGCACAGTGGGGAGCCGG + Intergenic
1168701449 19:58442011-58442033 CAGAGGGAACAATGGAAAGGCGG - Intergenic
925036993 2:695255-695277 CATGGAGCCCAGTGGGAAGGTGG - Intergenic
925162060 2:1692468-1692490 CAGGGTCAACAGTGGATAGGCGG + Intronic
925465918 2:4107295-4107317 AAGGGTGCAAAGTGGGAAAGTGG + Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925961721 2:9023399-9023421 CAGGGAGAAGGGTGGGAGGGGGG + Intergenic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926611214 2:14950159-14950181 CAGGGGGAAGAGTGGAAGGGAGG - Intergenic
926915475 2:17887262-17887284 CAGGGGGAAGAGTGGGAGTGGGG - Intronic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
928644594 2:33338835-33338857 CAGAGTGCAAATTGGGAAGGAGG + Intronic
928798782 2:35060240-35060262 CAGGTGAAAAAGTGGGAAGGGGG + Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
931055351 2:58463437-58463459 TAGGGGGAAGAGTGGGAGGGAGG - Intergenic
931075800 2:58710195-58710217 CAGGGTAAAAAGTGAGAATGTGG - Intergenic
931326455 2:61230428-61230450 CAGGGAGAACTGTGTGAAGCCGG + Intronic
931524595 2:63138847-63138869 TGGGGGGAAGAGTGGGAAGGGGG - Intronic
931944664 2:67292298-67292320 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
932142783 2:69294384-69294406 CAGAGTGAACACTGGGATTGAGG - Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933097747 2:78209120-78209142 AAGGGAGAAGAGTTGGAAGGGGG + Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933481362 2:82861154-82861176 AAGGCTGAAAAATGGGAAGGAGG - Intergenic
933775192 2:85767441-85767463 GAGGGTGAACGGTGGGGAAGAGG - Intronic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935283753 2:101545138-101545160 AAGGGGAAAGAGTGGGAAGGAGG - Intergenic
935303896 2:101718544-101718566 CAGGGCTGACAGTGGGAAGGTGG + Intronic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936605254 2:113945785-113945807 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937075791 2:119105489-119105511 CAGGGAGAGAACTGGGAAGGAGG - Intergenic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
937361145 2:121231037-121231059 CAGGTTGAACAGTGGGTAAGGGG - Intronic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
939358180 2:141131982-141132004 CTGGGGCAAGAGTGGGAAGGGGG - Intronic
939419006 2:141941654-141941676 CACGTGGAACAGTGGGAAGCTGG + Intronic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
940791769 2:158036798-158036820 AATGGTGAACAGTTGAAAGGGGG + Intronic
940803434 2:158157682-158157704 CAGGGAGAACACTGGGAGTGGGG - Intergenic
942934831 2:181542148-181542170 AAGTGTGGACAGTGAGAAGGGGG + Intronic
943560873 2:189460428-189460450 GAGGGTGTGGAGTGGGAAGGAGG - Intronic
943758410 2:191583221-191583243 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
945556384 2:211281523-211281545 CAGAGGGTACAGTGAGAAGGTGG - Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
945976787 2:216277336-216277358 TAGGGTGCACAGTGGAGAGGAGG + Intronic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947257696 2:228183336-228183358 CAGGGGAAAGTGTGGGAAGGGGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
1168806186 20:673642-673664 CTGAGTGAATAGTGGGAAGCAGG - Intronic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1169415926 20:5416214-5416236 CATGGATAACAGTGCGAAGGGGG + Intergenic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170533724 20:17319668-17319690 GGGGGTGAACACTGGGAGGGGGG + Intronic
1170782423 20:19437812-19437834 CAGGGGGAACAGGGTGGAGGAGG - Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1171164402 20:22957582-22957604 AAGGGTGAAGAGTGGGAGAGGGG - Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172477627 20:35250745-35250767 CAGGGGGAAGAGTGAGAAGGGGG + Intronic
1172765964 20:37351048-37351070 CAGGCTGTACTGTGGGAAGGAGG - Intronic
1173521810 20:43705431-43705453 CTGGTGGAACAGTGGGGAGGGGG + Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173911566 20:46674561-46674583 CAGGGGAGACAGTGGGTAGGTGG + Intronic
1174298500 20:49565891-49565913 AAGGGTCAACAGTGGGTAGTGGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175010112 20:55726308-55726330 GAGGGTGAGCAATGGGGAGGTGG + Intergenic
1175144596 20:56886097-56886119 GAGGGTGATAAGGGGGAAGGAGG + Intergenic
1175304327 20:57965567-57965589 CTGGGAAAACCGTGGGAAGGTGG + Intergenic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177154263 21:17485628-17485650 GACGGTGAGGAGTGGGAAGGAGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1179068106 21:38045320-38045342 CAGGGGGCACACTGGGATGGTGG + Intronic
1179591028 21:42408106-42408128 CTGGGTGAACCCTGGAAAGGGGG + Intronic
1181099599 22:20530577-20530599 CAGGGGGAGCAGTGGTAAAGAGG + Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181455250 22:23055879-23055901 CATGGAGAACAGTGGGAGGGAGG + Intergenic
1181868625 22:25879864-25879886 CAGGAGGAAGAGTGAGAAGGGGG + Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182988674 22:34745301-34745323 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1183168637 22:36167123-36167145 AAAGGTAAAGAGTGGGAAGGAGG + Intergenic
1183174844 22:36215616-36215638 AAGGGAGAACAGTGGGCAGGAGG - Intergenic
1183346680 22:37312006-37312028 CAGGCAGAACTGTGGGGAGGTGG - Exonic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184505801 22:44901290-44901312 CTGGGAGAACACTGGGAATGTGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1184889322 22:47369845-47369867 AAGGGTGGACAGGGAGAAGGAGG - Intergenic
1185024275 22:48398726-48398748 AAGGCTGAGCAGTGGGCAGGAGG - Intergenic
1185347040 22:50314982-50315004 CTGGGTGAACGGTGGGAGAGCGG - Intronic
1185393061 22:50573074-50573096 CAGGGTAAGCAGTGGGCACGTGG + Intronic
949321534 3:2816422-2816444 TAGGGGGAAGAGTGGGAAGTGGG + Intronic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950151212 3:10688940-10688962 CAGGGTGGACATTGGCCAGGTGG - Intronic
950214253 3:11147131-11147153 CAGTGTGAAAAGTGGGACTGTGG - Intronic
950924646 3:16728416-16728438 GAGGGTGAAAAGGGGGCAGGCGG + Intergenic
951350805 3:21604727-21604749 CTGAGTGAACAGTGAGTAGGTGG + Intronic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953280164 3:41547488-41547510 AAGGGTCCACAGTGGGAATGTGG - Intronic
953494742 3:43376326-43376348 CATGGAGAACAGTGGGCTGGGGG + Intronic
953827003 3:46262046-46262068 CATGGGGCAGAGTGGGAAGGGGG - Intronic
954285572 3:49616700-49616722 CCTGGTGCACAGTGGGAAGGAGG - Intronic
954493159 3:50926850-50926872 CAGGGAGACCAGTTAGAAGGTGG - Intronic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956773839 3:72549089-72549111 GAAGGGAAACAGTGGGAAGGAGG - Intergenic
957671731 3:83313592-83313614 TAGGGGGAAGAGTGGGAGGGGGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958092657 3:88896038-88896060 AAGGGTGAACAGTAGAAGGGGGG - Intergenic
959766657 3:110039075-110039097 CAGGGAGAAGTTTGGGAAGGGGG - Intergenic
959919911 3:111859121-111859143 CGGGGCGAACTGTCGGAAGGAGG + Intronic
960524933 3:118698885-118698907 TGGGGCGAAGAGTGGGAAGGGGG + Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
961384928 3:126517934-126517956 CAGGCTTCACAGTGGGGAGGGGG + Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962857637 3:139363276-139363298 GAGGGTGAGCAGTGGGTGGGTGG + Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
964553791 3:157913601-157913623 AAGGGTGAATGGTGGGGAGGAGG + Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965111218 3:164425957-164425979 TAGGGGGAAGAGTGGGAGGGGGG - Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966716916 3:183021963-183021985 GAAGGTGGACAGTAGGAAGGTGG - Intronic
966763748 3:183439892-183439914 GAGGGTGAACTGTGGGAAAAGGG + Intergenic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
968647951 4:1749332-1749354 GAGGGGGCACAGTGGGGAGGGGG - Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969542925 4:7804946-7804968 CACTGCGAAGAGTGGGAAGGAGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
971850459 4:31979211-31979233 CAGTGAGATAAGTGGGAAGGAGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972155802 4:36160007-36160029 GAGGAAGAACAGTGAGAAGGCGG + Intronic
972273254 4:37532958-37532980 TGGGGGGAACAGTGGGAGGGGGG + Intronic
973088197 4:46095966-46095988 CTGGGTGGGGAGTGGGAAGGAGG - Intronic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
973632234 4:52830309-52830331 AAGGGAGAACAGTGGGGAAGTGG + Intergenic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
974544375 4:63281136-63281158 GAGGCTGAAATGTGGGAAGGAGG + Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
976687450 4:87830578-87830600 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
977682961 4:99815506-99815528 CCGGGTGAACAGTGGTAATAGGG + Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979223907 4:118263794-118263816 CTGGGAGTAGAGTGGGAAGGTGG - Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
981825335 4:148934250-148934272 TAGGGGGAAGAGTGGGAGGGTGG + Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982711483 4:158762432-158762454 CAGGCAGAACTGTGGGATGGGGG + Intergenic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984277568 4:177628215-177628237 AAGGGTGGAAAGTGGGAAGAGGG - Intergenic
984763876 4:183384857-183384879 CATGGTGAGAAGTGGGCAGGGGG - Intergenic
985782908 5:1880374-1880396 CAGTGTGGACACTCGGAAGGAGG + Intronic
986785065 5:11106679-11106701 CAGGGTGTGCAGTGAGTAGGGGG - Intronic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987229497 5:15878817-15878839 CAGCTTGAAAAGTGAGAAGGAGG - Intronic
987297728 5:16568687-16568709 AAGGGGGAACAGGGGAAAGGGGG + Intronic
987333627 5:16878826-16878848 CAGGGAGAAGGGTGGGAGGGTGG + Intronic
987725927 5:21699559-21699581 GAGGGTGAAGAGTGGGAGAGTGG - Intergenic
988984203 5:36600925-36600947 CAGGGTGAACGGTGGAAACTGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989690287 5:44135403-44135425 CTGGGGAAAGAGTGGGAAGGGGG - Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990854696 5:60251350-60251372 GAAGATGGACAGTGGGAAGGGGG - Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991836456 5:70761661-70761683 CAAAGTAAACAGTGGTAAGGTGG - Intergenic
993408706 5:87547231-87547253 CAGGGTGAAGAGTGAGCATGGGG - Intergenic
993939947 5:94046436-94046458 GAGGGGGAACAGTGGGGTGGGGG + Intronic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994373485 5:98992926-98992948 AAGGGTGGAGGGTGGGAAGGAGG + Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
994777670 5:104055506-104055528 CAGGGAGAAGGGTGGGAGGGAGG - Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995012623 5:107274750-107274772 CAGGGAGAAAAGGGAGAAGGGGG + Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995651644 5:114376419-114376441 CAAGGTGATCAGTGTGATGGAGG + Intronic
995745503 5:115398421-115398443 AAGGGTGGAGAGTGGGAAGAGGG - Intergenic
995853167 5:116568152-116568174 CAGGGTCCAGAGTGGGAAAGAGG + Intronic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996369827 5:122741425-122741447 CAAGGTGAATAGTAGGATGGAGG - Intergenic
996749299 5:126872953-126872975 CAGGGCCAACAGCGGGAAAGAGG + Intronic
997197857 5:131991602-131991624 ACGGGTGCAGAGTGGGAAGGTGG + Intronic
997599545 5:135130042-135130064 CATGGGGAACAAAGGGAAGGAGG - Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
998389265 5:141776760-141776782 CGAGGTGGACAGTGAGAAGGGGG - Intergenic
998941358 5:147286269-147286291 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
999199305 5:149804751-149804773 GCGACTGAACAGTGGGAAGGTGG + Intronic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999338033 5:150740894-150740916 CAGGGGGAAAGCTGGGAAGGGGG + Intronic
1000235930 5:159360561-159360583 CAGAGGGAAGAGTGGGAGGGAGG + Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1003389978 6:5705505-5705527 CAGGGTGAATCGAGGTAAGGAGG - Intronic
1004150228 6:13112019-13112041 GAGGGTGAAGGATGGGAAGGCGG - Intronic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1005675933 6:28154859-28154881 CACAGTGTACAGTGGGGAGGTGG - Exonic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1006250787 6:32781915-32781937 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1006996268 6:38264225-38264247 CAGGGCCAACAGTGACAAGGAGG + Intronic
1007127542 6:39440116-39440138 GACGATGAACAGTGAGAAGGGGG + Intronic
1007825660 6:44598886-44598908 CAGGGAGGCCTGTGGGAAGGAGG + Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008136471 6:47783261-47783283 TTGGGTGACCAGTGTGAAGGTGG + Intronic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010116446 6:72317090-72317112 CATGGGGAGCAGTGGGGAGGAGG - Intronic
1010164508 6:72899796-72899818 TGGGGTGAAGGGTGGGAAGGGGG - Intronic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017928130 6:158928120-158928142 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018320224 6:162600756-162600778 CAGGAGGAAGAGTGAGAAGGGGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019483577 7:1277285-1277307 GAGGGAGAAGAGAGGGAAGGAGG - Intergenic
1019491247 7:1314597-1314619 CAGGGAGAGCAGTGGGGAAGAGG - Intergenic
1019557750 7:1641103-1641125 GAGGGGGACCAGTGGGCAGGTGG - Intergenic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1021389716 7:20076941-20076963 TAGAGTGAACACTGGGAAGCTGG + Intergenic
1022095819 7:27140595-27140617 CCGGGTGAAGAGTGGGGAAGGGG + Intronic
1022251199 7:28610224-28610246 CTGGGTGAACAGTGGGGAGCTGG + Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022957954 7:35398712-35398734 CAAGGTAAACGGTGGGAAGAAGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1024172907 7:46808958-46808980 GAGGGTGAAGGGTGGGGAGGAGG + Intergenic
1024543176 7:50495948-50495970 CATGATAAACAGTGGGAAAGAGG + Intronic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024690458 7:51796058-51796080 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1025110743 7:56214104-56214126 CAAGGGGAAGAGTGGGAAGGGGG - Intergenic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1027703212 7:81494989-81495011 GATGGAGAACAGTGGGAAAGAGG - Intergenic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028210563 7:88069170-88069192 CAGGGAGAAGAGAGGGAAAGAGG - Intronic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1029699771 7:102238710-102238732 CAGAGTGAAAAGTGGGGTGGGGG - Intronic
1030539302 7:110809880-110809902 AAGGGTGAGCAGTGGCAAAGAGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031871237 7:127091656-127091678 GAGGATGATCAGTGGGATGGTGG - Intronic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1034937735 7:155210568-155210590 CTGGGAGCACAGTGGGGAGGAGG - Intergenic
1035339430 7:158151061-158151083 CAGGGGCAAGAGTGGAAAGGCGG - Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1035926274 8:3731209-3731231 GAAGGAGGACAGTGGGAAGGTGG - Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036795660 8:11754678-11754700 TGGGGTGAGGAGTGGGAAGGAGG - Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037055273 8:14432523-14432545 CAGGGTAAAGGGTGAGAAGGGGG + Intronic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1038006300 8:23433210-23433232 AAGGGTGCACAGGGGGACGGCGG + Intronic
1038459636 8:27705091-27705113 CAGGGTGGAAAGTGTGAGGGAGG - Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038463529 8:27738108-27738130 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039846576 8:41329901-41329923 CAAGGGGAAAGGTGGGAAGGTGG - Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041577839 8:59420398-59420420 GAGGGTGAAGGGTGGGAAGAAGG + Intergenic
1041796916 8:61754514-61754536 AATGGTGAACAGTCAGAAGGAGG + Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042354531 8:67812005-67812027 GATGGTGAAAAGTGGGAAGAGGG - Intergenic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1044872254 8:96630931-96630953 CAGGGCCAACACTGGGCAGGAGG - Intergenic
1045554927 8:103206754-103206776 CTGGGAGAAGAGTGTGAAGGAGG + Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045723944 8:105148791-105148813 GATAGTGGACAGTGGGAAGGAGG - Intronic
1046342956 8:112882532-112882554 AAGGGAAAAGAGTGGGAAGGAGG - Intronic
1048545450 8:135382462-135382484 GAGGGTGGAGGGTGGGAAGGAGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049733213 8:144189706-144189728 CAGGGAGAACAATGGCAGGGCGG - Intronic
1049791531 8:144474729-144474751 CACAGGGAACAGTGGGGAGGAGG - Exonic
1049824812 8:144661864-144661886 CAAGGTGAATAGTGGGGAGAGGG - Intergenic
1050039679 9:1476088-1476110 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1050147890 9:2589499-2589521 GGGGGTGGAGAGTGGGAAGGGGG + Intergenic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1051385016 9:16498511-16498533 TAGGGGGAAGAGTGGGAGGGGGG + Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052584959 9:30415011-30415033 CAGGATGTGCTGTGGGAAGGAGG + Intergenic
1053014676 9:34655041-34655063 CTGGGTATACAGTGGGAAAGGGG + Intronic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055711832 9:79071742-79071764 CAGGGTAAATGGTGGGAGGGGGG + Intergenic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056300063 9:85231445-85231467 TGGGGTGAACAGTAGGAGGGGGG + Intergenic
1056466975 9:86866922-86866944 AAGGGTGAAAACTGGGGAGGAGG - Intergenic
1056552545 9:87663805-87663827 GAGGCTGAACACTGGGGAGGAGG - Intronic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1059499773 9:114741643-114741665 TAGGGGGAAGAGTGGGAAGGGGG + Intergenic
1059533038 9:115055389-115055411 GAGGGTGAAAAGTGGGTAGCGGG + Intronic
1059716578 9:116918635-116918657 CAAGGCAAACAGTGGAAAGGAGG - Intronic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060556753 9:124511903-124511925 CAGGCTGCAGAGTGGAAAGGTGG + Intergenic
1061296947 9:129681996-129682018 CAGCCTGTACCGTGGGAAGGTGG - Intronic
1061328547 9:129878568-129878590 CAGGGTGAACAGAGAGCATGGGG + Intronic
1061375376 9:130220870-130220892 CAGAGTGGACTGTGGGGAGGAGG + Intronic
1061561983 9:131410425-131410447 CAGGGAGTACCGTGGGCAGGTGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062347257 9:136120698-136120720 GCGGGTGCACAGTGGGAAGCAGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1062565526 9:137162419-137162441 CAAGGTGAACAGCGAGGAGGAGG + Exonic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186372602 X:8962567-8962589 AAGGGAGAAGGGTGGGAAGGGGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187989702 X:24856207-24856229 CAGAGTTAGGAGTGGGAAGGAGG - Intronic
1188072086 X:25729483-25729505 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189453133 X:41158305-41158327 CAGAGAGAACAATTGGAAGGTGG + Intronic
1189695766 X:43660276-43660298 AAGGGTGGCCACTGGGAAGGGGG - Intronic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1190449438 X:50563722-50563744 TGGGGGGAAGAGTGGGAAGGGGG + Intergenic
1191965619 X:66754013-66754035 CAAGGGGAAGGGTGGGAAGGGGG - Intergenic
1192509309 X:71712574-71712596 GAGGGTGGAAAGTGGGAAAGAGG - Intergenic
1192517388 X:71768979-71769001 GAGGGTGGAAAGTGGGAAAGAGG + Intergenic
1192973804 X:76261477-76261499 GAGGGTGAACTGAGGCAAGGCGG - Intergenic
1193515463 X:82456448-82456470 GAGGGTGAAGGGTGGGAAGTGGG + Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193702415 X:84779569-84779591 CAGGGTGTACAATGGGAGTGTGG + Intergenic
1193917585 X:87383919-87383941 CAAGGGGAAGGGTGGGAAGGAGG + Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1195384419 X:104300311-104300333 CAGGGATAACAGTGGAAAGGAGG - Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196711733 X:118770240-118770262 CAGGGTGCACGATGGGCAGGCGG - Intronic
1196738090 X:118998453-118998475 TGGGGGGAAAAGTGGGAAGGGGG + Intronic
1197070311 X:122288957-122288979 TAGGGGGAAGAGTGGGAAGGAGG + Intergenic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197721058 X:129744957-129744979 CAGTGTGAACAGTGTGGGGGCGG + Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199407546 X:147480166-147480188 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1199928190 X:152491613-152491635 CAGGGAGAAAGGTGGGAAGCGGG - Intergenic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201985892 Y:19964828-19964850 CTCGGGGAACAGTGGGATGGGGG - Intergenic