ID: 1142501677

View in Genome Browser
Species Human (GRCh38)
Location 17:336592-336614
Sequence CTGTACGTGAAGAGGGGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142501677_1142501684 9 Left 1142501677 17:336592-336614 CCGTTGCCCCTCTTCACGTACAG 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1142501684 17:336624-336646 CCATCCTTACAGCCCAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1142501677_1142501682 4 Left 1142501677 17:336592-336614 CCGTTGCCCCTCTTCACGTACAG 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1142501682 17:336619-336641 AGAGACCATCCTTACAGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142501677 Original CRISPR CTGTACGTGAAGAGGGGCAA CGG (reversed) Intronic
900189834 1:1348696-1348718 CTGTCCGTGGAGCGGGGCGATGG - Intronic
901556114 1:10032796-10032818 CCGGACGTGGGGAGGGGCAAAGG - Intergenic
908450018 1:64244769-64244791 CTGTTCATGAAGAGGGACCAGGG + Intronic
909802042 1:79822131-79822153 CTGCCCGTGAAGAGGGTCAAGGG - Intergenic
910053702 1:83006754-83006776 CTGTAAGTGGAAAAGGGCAAAGG + Intergenic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
916572431 1:166039392-166039414 CTGGATGTGATGAGAGGCAATGG + Intergenic
919712386 1:200740054-200740076 CTGTACGAGAAGACAGGCACGGG - Intronic
923803588 1:237234215-237234237 CTGTAGGAGAAAAGGTGCAATGG - Intronic
1063035851 10:2286103-2286125 CTGTACGTGTGCAGGGGCAGGGG - Intergenic
1067658336 10:48214514-48214536 CTGTGCATGTAGAGGGGCAAGGG + Intronic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1071009199 10:80917736-80917758 GTGCATGTGAAGAGTGGCAAGGG + Intergenic
1071203377 10:83246312-83246334 CTGTACTTGAAAAGGGGGATAGG - Intergenic
1074177972 10:111030135-111030157 CTGGAGGTCAAGAGGGGCAGAGG - Intergenic
1075517705 10:123121943-123121965 CTATAAGTGAAGTGGGGCACAGG - Intergenic
1076249159 10:128971541-128971563 CTGTAGGTGAGGAGTGGCACAGG - Intergenic
1078083941 11:8222711-8222733 ATGTGCGAGAAGAGAGGCAAAGG - Intergenic
1081026412 11:38019963-38019985 CTGTTCTTGAAGAGGGGGCAAGG - Intergenic
1082626945 11:55497454-55497476 CTGCACGTGAAGGAGGTCAAGGG + Intergenic
1086882087 11:92161110-92161132 CTGAAAGGAAAGAGGGGCAAGGG + Intergenic
1087141389 11:94768719-94768741 CTGGACCTGGAGCGGGGCAAGGG - Intronic
1088184024 11:107143401-107143423 CTGTACATTAGGAAGGGCAAGGG + Intergenic
1088834271 11:113564540-113564562 CTGCATGTGAAGAGGGACACTGG + Intergenic
1089003529 11:115071543-115071565 CTGGAGCTGAAGAGGGGCACAGG - Intergenic
1093523469 12:20077072-20077094 CTGTCGGTGGTGAGGGGCAAGGG + Intergenic
1106930509 13:34658964-34658986 CTGTATGTGTAGAAGGGCAATGG - Intergenic
1111340863 13:86883564-86883586 CTGTACTTGATGGGGGCCAATGG + Intergenic
1114170024 14:20262872-20262894 CTAAACGTGAGGAAGGGCAAAGG + Intronic
1114548089 14:23516997-23517019 CTGTCCAAGAAGAGGGGGAAAGG - Intergenic
1114548775 14:23521701-23521723 GTGTCTGTGAAGATGGGCAAGGG + Exonic
1114997199 14:28369441-28369463 GTGTTTGTGAAGAGGGGAAAAGG - Intergenic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121712298 14:96047797-96047819 CTGTGCATGAACAGGGGCAGAGG - Intronic
1124077289 15:26458249-26458271 CTGTACCTGAAGAGAGGCTAAGG + Intergenic
1125428725 15:39575566-39575588 CTGCACGTGACGAGGAGAAAGGG + Intergenic
1125686948 15:41569030-41569052 TTGTAGGTGGAGAGGGGCAGAGG + Intronic
1125901659 15:43353780-43353802 CTGTACCTGAAGAGGGTAGAGGG + Exonic
1130521583 15:84665522-84665544 CAGTACCTTAACAGGGGCAATGG - Intergenic
1131460788 15:92616276-92616298 CTGTAGGAGAAGAGGGGTAGGGG - Intergenic
1136026395 16:27471678-27471700 CTGTCTGTAAAGAGGAGCAAAGG - Intronic
1136123142 16:28154401-28154423 CTGTACCAGAAGGTGGGCAAGGG - Intronic
1138387370 16:56644756-56644778 CTGCACCTGAAAAGGGGCATTGG + Intronic
1139598153 16:67969730-67969752 CTCTACGTGAGCAGGGGCGAGGG - Intergenic
1141022600 16:80511467-80511489 ATGTACATGAACAGGGGAAAGGG + Intergenic
1141095169 16:81158129-81158151 CTATAGGGGAAGAGGGACAAAGG - Intergenic
1142501677 17:336592-336614 CTGTACGTGAAGAGGGGCAACGG - Intronic
1149914693 17:60598415-60598437 CTGTACTTGAAAAGTTGCAAGGG + Intergenic
1152851107 17:82636515-82636537 CTGCAGCTGAAGAGGGGGAAAGG + Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1155776189 18:29765099-29765121 CTGAACGTGCAGAAGAGCAAGGG - Intergenic
1156973935 18:43193450-43193472 CTTTACGTGAACAGTGGCATCGG - Intergenic
1160841148 19:1147553-1147575 CTGTATGTGCAGCGGGGCCATGG - Intronic
1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG + Exonic
1166289272 19:41851323-41851345 CTGTATGTGAAGGGGAGCCAGGG + Intronic
1167412968 19:49355886-49355908 CTGTCCCTGAGGAGGGGCAGAGG - Intronic
928926468 2:36584840-36584862 CTGCACGTGAGAAGGGCCAAGGG + Intronic
930723477 2:54659913-54659935 CTGTTAGGGAAGAGGGGAAAAGG - Intronic
934579780 2:95428609-95428631 CTGCAAGTGAAGATGGGAAAGGG + Intergenic
934599667 2:95648116-95648138 CTGCAAGTGAAGATGGGAAAGGG - Intergenic
936533009 2:113290119-113290141 CTGCAAGTGAAGATGGGAAAGGG - Intergenic
938690398 2:133783145-133783167 CTATACATGAACAAGGGCAAGGG + Intergenic
942963894 2:181866114-181866136 CTGTACGTGCAAAGGGGCAAAGG + Intergenic
945769402 2:214021943-214021965 CTTTAGGTGATGAGGGGAAAAGG - Intronic
1169256340 20:4102678-4102700 CTATACGGCAAGAGGGGAAAAGG + Intergenic
1173961274 20:47074254-47074276 GTGGACGTGGAGAGGGGCGAAGG - Exonic
1176264282 20:64200715-64200737 CTGTTTGTGAAGTGGGGAAACGG + Intronic
1177201652 21:17963454-17963476 CTGAAGGTGAAGAGGGGCAAAGG + Intronic
1179335270 21:40445557-40445579 CTGAAAGTGATGATGGGCAAGGG - Intronic
1180069715 21:45430225-45430247 CTGTATGTGAAGTGGGGTCATGG + Intronic
1184510818 22:44932184-44932206 CTGTTCTTTAAGAGGGGCCATGG + Intronic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
950545628 3:13636422-13636444 CTGGGGGAGAAGAGGGGCAATGG - Intronic
958001984 3:87762000-87762022 CTAGACGTCAAGAGGCGCAAAGG - Intergenic
959901327 3:111664816-111664838 CTGTACTAGAAGGGGGGAAATGG + Intronic
961935171 3:130575445-130575467 CTGAAAGTGATGAGGGGCAAAGG - Intronic
962292420 3:134147662-134147684 CTGTGGGTGCAGAGGCGCAAAGG - Intronic
965488985 3:169313695-169313717 CTGACAGTGAAGAGGGGAAAAGG + Intronic
967095879 3:186176840-186176862 CTGGAGGTGCAAAGGGGCAAAGG + Intronic
967366639 3:188694263-188694285 CTGTACCTAAAGGTGGGCAAAGG - Intronic
967507606 3:190270758-190270780 CTGTCGGTGAAGTGGGGAAAGGG - Intergenic
967587470 3:191232961-191232983 CTATACGTGTAGATGGGAAAGGG - Intronic
967700151 3:192582964-192582986 CTATATGTGATGAGGGGGAAGGG - Intronic
968737309 4:2304123-2304145 CTGTGTGTGAGGAGGGGCAGGGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
978286907 4:107089773-107089795 ATGTAGGTTAAGAGAGGCAAGGG + Intronic
978829194 4:113062773-113062795 CTGTGCTTGAAAAGGTGCAAGGG - Intronic
980713205 4:136597205-136597227 CTGTACTTAAGGATGGGCAAAGG + Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
982504142 4:156196854-156196876 CTGGACGTGGAGAGGAGCAGAGG + Intergenic
983588646 4:169383240-169383262 CTGGACGTCAAGAGGAGCAAAGG - Intergenic
983645548 4:169987385-169987407 GGGTACGTGAAGAGCGGTAAAGG + Exonic
984836268 4:184024732-184024754 CTGAGCGTGAAGATGGGCAGGGG - Intergenic
991943920 5:71881738-71881760 CTGTACTGGAGGAGAGGCAATGG - Intergenic
998025022 5:138808885-138808907 CTGTAAGAAAAGAGTGGCAATGG + Intronic
998358697 5:141565289-141565311 CTTTACTGGAAAAGGGGCAAGGG - Intronic
999624396 5:153505023-153505045 CTATACCTGAAGAGGGGACAGGG + Intronic
1001539008 5:172524009-172524031 CTGTACCTGAAGAAGGGCCATGG - Intergenic
1001971203 5:175956429-175956451 CTGGACGTGAAGATGGTCAGGGG - Intronic
1002246239 5:177887348-177887370 CTGGACGTGAAGATGGTCAGGGG + Intergenic
1006967756 6:38006801-38006823 CTGGACTGGAAGAGGGGCAGGGG - Intronic
1014985201 6:127998014-127998036 CAGTAAGTGAAGGGTGGCAAAGG + Intronic
1015401544 6:132793959-132793981 CTCTAAGTGAATAGGGACAAAGG - Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1018170678 6:161140725-161140747 CTGGCCGTGAGGAGGGGCCAGGG + Intronic
1018749227 6:166788680-166788702 CTGTCCGGGGTGAGGGGCAAGGG + Intronic
1018936485 6:168277152-168277174 CTGAAAGTGAGGAGGGGGAAAGG - Intergenic
1019624952 7:2011308-2011330 CTGCACATGAAGTGTGGCAAGGG - Intronic
1024122319 7:46257277-46257299 CTGTACAAGAAGAAGGGCACTGG + Intergenic
1024813763 7:53244042-53244064 CTGGAGGTGAATAGTGGCAATGG - Intergenic
1026449978 7:70519835-70519857 CTGGCCATGAGGAGGGGCAAAGG + Intronic
1027827217 7:83131323-83131345 CTGTACCTGAGGAGTGCCAACGG - Intronic
1029625612 7:101718608-101718630 CTGCCCGGGAAGAGGGGCAATGG + Intergenic
1031218831 7:118935999-118936021 GTGTAAGTGAAGAGGAGGAAAGG - Intergenic
1035974527 8:4292991-4293013 CTTCAGGTGCAGAGGGGCAAGGG + Intronic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1044344129 8:91083401-91083423 CAGTTAATGAAGAGGGGCAATGG - Intronic
1045447352 8:102281104-102281126 TTTTAAGTGAAGAGTGGCAATGG + Intronic
1049772662 8:144390943-144390965 CTCTACGTGAAGCTGGGCCAGGG + Exonic
1049870719 8:144973370-144973392 CTGTATGAAAAGAGGGGCAAAGG - Intergenic
1057744470 9:97740325-97740347 CTGTATGGAAAGAGGAGCAAGGG + Intergenic
1194493172 X:94576881-94576903 CAGTATGTGATGTGGGGCAAGGG + Intergenic
1199713977 X:150492820-150492842 CTGTAGATGAAGAGGCCCAATGG - Intronic