ID: 1142506704

View in Genome Browser
Species Human (GRCh38)
Location 17:368764-368786
Sequence GTATAACAATAATAGCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 10, 2: 68, 3: 150, 4: 541}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142506704_1142506705 -9 Left 1142506704 17:368764-368786 CCTTTGTGCTATTATTGTTATAC 0: 1
1: 10
2: 68
3: 150
4: 541
Right 1142506705 17:368778-368800 TTGTTATACAAATTATATCTTGG 0: 1
1: 0
2: 3
3: 44
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142506704 Original CRISPR GTATAACAATAATAGCACAA AGG (reversed) Intronic
902832253 1:19023519-19023541 GTATGACAACAATAGCATAAAGG + Intergenic
903411130 1:23143991-23144013 GTATAACAATCAAAGCATATTGG - Intronic
903584145 1:24396057-24396079 GTTTAACAACAATAACATAAAGG + Intronic
903588253 1:24433786-24433808 CTGTGACAATAATAGCATAATGG + Intronic
903638269 1:24835607-24835629 ACATAACAATAATAGCATATAGG + Intronic
903699336 1:25234799-25234821 TTATAAAAACAATATCACAAAGG + Intergenic
904366820 1:30016544-30016566 GCATGACAGTAATAGCACAAAGG - Intergenic
904399381 1:30245863-30245885 GTATAAGAAGAAAAGCACACAGG - Intergenic
905032243 1:34893623-34893645 ATATGACAGTAATAGCAAAAAGG + Intronic
905116701 1:35647381-35647403 GTAGAATAACAAAAGCACAAAGG + Intergenic
905984657 1:42268632-42268654 GTATGACAACAATAGCAAAAAGG + Intronic
906682105 1:47734860-47734882 GTAAAACAATAAAAGTTCAAAGG - Intergenic
906697748 1:47836009-47836031 GTATGACAATAATGGCACAAAGG + Intronic
906885642 1:49644033-49644055 ATATGACAAAAATAGCACAAAGG + Intronic
906909347 1:49929822-49929844 GTTTCATAACAATAGCACAAAGG + Intronic
907856115 1:58305503-58305525 GACTAACAATAATAGGTCAATGG - Intronic
908057253 1:60302173-60302195 GTATGACAATAAAAGCACAAAGG - Intergenic
908072658 1:60480019-60480041 TTTCAACAATAATAGCACAAAGG + Intergenic
908799836 1:67868051-67868073 AGATGACAATAATAGCACAAAGG + Intergenic
909239101 1:73190286-73190308 GTGTGACACAAATAGCACAAAGG + Intergenic
909456168 1:75851794-75851816 ATGTTACAATAATAGCATAATGG - Intronic
909723657 1:78808367-78808389 TTATAACAATATTAGCAAAATGG + Intergenic
910030355 1:82713693-82713715 ATATGGCAATAATAGCAGAAAGG - Intergenic
910164711 1:84314160-84314182 ATATAACAATAATAAAACAATGG + Intronic
910184358 1:84520926-84520948 GTATAACCATAATAATACACAGG - Intergenic
910212654 1:84809427-84809449 TTGTACAAATAATAGCACAACGG - Intergenic
910375209 1:86561246-86561268 GTATAACTAAAAGGGCACAAAGG - Intronic
910786558 1:91004677-91004699 GTATGGCAATAACAGCACGAAGG + Intronic
911413806 1:97545324-97545346 GAATAACAATATTAGAACAAAGG - Intronic
911491299 1:98570411-98570433 GTATGACAAACTTAGCACAAAGG + Intergenic
911506892 1:98763998-98764020 CTATGATAATAATAGCACACTGG - Intergenic
911643275 1:100311762-100311784 GCATGACAACAGTAGCACAAAGG + Intergenic
911791540 1:102021827-102021849 GTATTATAATAATAGTACAAAGG - Intergenic
911824052 1:102458482-102458504 GTATAGCATTAATAATACAAAGG - Intergenic
911980980 1:104565703-104565725 CAATTACAATAATAGCATAAAGG + Intergenic
912706137 1:111914968-111914990 ATATGACAATTATATCACAAAGG + Intronic
913104874 1:115604391-115604413 GCATGACAACAATAGCACATAGG + Intergenic
913502707 1:119486226-119486248 GCATTAAAATAAAAGCACAATGG - Intergenic
914402078 1:147330993-147331015 GTATGACAACAATAGCACAAGGG + Intergenic
914424701 1:147564812-147564834 GTATAAAGATAAAAGAACAAGGG - Intronic
914893213 1:151646965-151646987 GTATGACAACAATAGCACAAAGG - Intronic
915676647 1:157538273-157538295 GTAAAACAATAATACCACCTTGG - Intronic
915777347 1:158504552-158504574 CTATCACAAGAACAGCACAAAGG + Intergenic
915819549 1:159007308-159007330 ACTTAACAATATTAGCACAAGGG - Intronic
916268037 1:162911437-162911459 GTAGAACAATAACATCACAAAGG - Intergenic
916376529 1:164159947-164159969 GTATGACAATAATAGCCTAAAGG - Intergenic
916598552 1:166270440-166270462 GTATAATAATAATAAAAAAAAGG + Intergenic
916622399 1:166513858-166513880 GTATAACAAGAACAGCACAAAGG - Intergenic
916756916 1:167779661-167779683 GTATGACAACAGTAGTACAAAGG + Intronic
917155445 1:171993011-171993033 GTATGACAATAATAGCACATAGG - Intronic
917232113 1:172848905-172848927 GCATTAAAATAAAAGCACAATGG - Intergenic
917271810 1:173283849-173283871 GAATGACAATAATAGTACATAGG + Intergenic
917494299 1:175526036-175526058 TTATAAAAATAAAAGCAAAATGG - Intronic
917577632 1:176340570-176340592 GATTAACAATAATAGCAATAAGG + Intergenic
917688376 1:177441923-177441945 TTATAACAATAATGGGAGAAAGG + Intergenic
917907966 1:179607694-179607716 GTATCACAATAAGAGCACAAAGG - Intronic
918357842 1:183723022-183723044 ACATGACAACAATAGCACAAAGG + Intronic
918391728 1:184071473-184071495 ATATGACAATAATAGCATAAAGG + Intronic
918641542 1:186846981-186847003 ATACAACAATAATTGCAAAAAGG - Intronic
918834554 1:189444783-189444805 GTATAATAATAATAAAAGAATGG + Intergenic
919414067 1:197284810-197284832 TTAAAAAAATAATAGAACAAAGG + Intronic
919449211 1:197750176-197750198 GTATGACAGCAATAGCACAAAGG + Intronic
920114676 1:203611838-203611860 GTATAATAATAATAAAAAAAAGG - Intergenic
920734573 1:208519652-208519674 GTATGAAAACAATAGGACAAAGG - Intergenic
920769858 1:208872860-208872882 CTATGACAATAATAGCACAAAGG - Intergenic
922529537 1:226333792-226333814 GTCTTAAAACAATAGCACAAAGG - Intergenic
922970637 1:229734370-229734392 GTATTACAATAATAGTACAAAGG + Intergenic
923351418 1:233110719-233110741 ATATGACAATAATAGCACAAAGG + Intronic
923379615 1:233402995-233403017 GTATAACAATGATAGTGCAAAGG + Intergenic
923631694 1:235653140-235653162 ATATAACAAAAATAATACAAAGG - Intergenic
924821966 1:247501682-247501704 GTAACACAAGGATAGCACAATGG - Intergenic
924855335 1:247869825-247869847 GTCTAACATTCATAGCACAGTGG + Intronic
1062778527 10:177913-177935 ATATAACAACCAAAGCACAAAGG - Intronic
1063332214 10:5171701-5171723 GCATTAAAATAAAAGCACAATGG - Intergenic
1064046151 10:12017740-12017762 GTATAATAATAATAAAAAAATGG - Intronic
1064267363 10:13835911-13835933 GAATAAAAATAATAATACAATGG - Intronic
1064405446 10:15058502-15058524 GTTTTACAAAAGTAGCACAAAGG - Intronic
1064975910 10:21115203-21115225 CTGTGACAATAGTAGCACAAAGG - Intronic
1065089284 10:22214138-22214160 GTATAAGACTAACAGCAAAATGG - Intergenic
1065130968 10:22619923-22619945 GAATGAGAATAAAAGCACAAAGG + Intronic
1065392254 10:25194778-25194800 TTATAACTATAATAAAACAATGG - Intronic
1065774476 10:29106701-29106723 TTATAACAGTAATACCAGAAAGG - Intergenic
1067263735 10:44717976-44717998 ATATAAAAGCAATAGCACAAAGG - Intergenic
1067709946 10:48640953-48640975 CCAAAACAATAGTAGCACAAAGG + Intronic
1067798702 10:49341077-49341099 ATATGTCAACAATAGCACAAGGG + Intergenic
1067991833 10:51222677-51222699 ATATAAGAATTATAGCACAGGGG + Intronic
1068029299 10:51687324-51687346 GTATAACAAGAATAGTTCAAAGG - Intronic
1068045583 10:51882199-51882221 TTCTAACAATAATAGCAGATGGG - Intronic
1068163917 10:53303802-53303824 GAACAACAACAATAACACAAGGG - Intergenic
1068419571 10:56772506-56772528 GTGTGACAATAATAGTAGAAAGG + Intergenic
1068824589 10:61421008-61421030 GTATAAAAATAACAGCAAAAAGG + Intronic
1069217495 10:65840419-65840441 GAATGACAGTAATACCACAAGGG + Intergenic
1069225087 10:65933144-65933166 ATATAATGATAATAGCACAATGG + Intronic
1070677977 10:78426683-78426705 ATGTGACAATAACAGCACAAAGG - Intergenic
1071094057 10:81952661-81952683 GTGTCACAATAATAGCTGAATGG + Intronic
1071119201 10:82258523-82258545 AAATAACAATCATTGCACAAAGG + Intronic
1071383032 10:85089143-85089165 GTATAGTGATAAAAGCACAAAGG + Intergenic
1071665237 10:87548768-87548790 GTAAAACAATAATAAGACAAGGG - Intronic
1071934017 10:90506665-90506687 ACATAATATTAATAGCACAAAGG + Intergenic
1071989738 10:91089678-91089700 ATATAACAATAATAAAACAATGG - Intergenic
1072045923 10:91655075-91655097 GTGCAACAACAATAGCATAAAGG - Intergenic
1072515467 10:96177540-96177562 GTATGACAACAGTAGCACAAAGG + Intronic
1072835788 10:98710331-98710353 GTATATTAATAATATCACATTGG + Intronic
1072837193 10:98728260-98728282 TTAGAATAATAATAGCACAAAGG + Intronic
1073162468 10:101410854-101410876 GTATGACAATAATAACACAAAGG - Intronic
1075210160 10:120484201-120484223 CAATAACAATATTAGCAAAAGGG + Intronic
1077845731 11:6022426-6022448 CTGTAACAATGATAGCACAGTGG - Intergenic
1078871849 11:15354341-15354363 GGATAAAAATAATGGCACAAAGG - Intergenic
1078948876 11:16105246-16105268 GCATTACATTAATAGAACAAAGG + Intronic
1080507213 11:32926997-32927019 GTCTGACAATACTATCACAATGG - Intronic
1081697100 11:45120861-45120883 ATATGACAATAATAGCACAAAGG + Intronic
1082887323 11:58100411-58100433 ATATGACAATTATAGCACAAAGG - Intronic
1083536753 11:63476152-63476174 ATATAATAGTAATAGCACAAAGG - Intronic
1084467273 11:69333153-69333175 GTATGAAAACAATAGTACAAAGG - Intronic
1086237755 11:84652736-84652758 GTCTAACAATAATAGTTAAAAGG - Intronic
1086480558 11:87232677-87232699 GGATGACAATAATAGCACAAAGG + Intronic
1086629546 11:89000232-89000254 GTATAACAATAATTAAAAAACGG + Intronic
1087069007 11:94056639-94056661 GATAATCAATAATAGCACAAAGG - Intronic
1087168695 11:95028581-95028603 GTATCACAAGAATAGCACTATGG - Intergenic
1087469639 11:98555814-98555836 GTATGACAATAATAGCACAAAGG - Intergenic
1087580767 11:100049269-100049291 GTATGAAAAGAATGGCACAAAGG + Intronic
1087834368 11:102857445-102857467 GTATGACAACAATAGCACAAAGG - Intergenic
1088279594 11:108122575-108122597 GAATAACATTACTTGCACAAGGG + Intronic
1088536660 11:110868832-110868854 TTATAAGAATAACAGCAGAAAGG + Intergenic
1089687062 11:120159042-120159064 CTATGACAACAATATCACAAAGG - Intronic
1090303463 11:125669015-125669037 ATATGACAATAATAGCACAAAGG - Intronic
1090351034 11:126108371-126108393 GTATAACAATAAAAAAAGAAAGG + Intergenic
1090723695 11:129501372-129501394 ATATGACAATAATAACTCAAAGG + Intergenic
1091069338 11:132548559-132548581 AAATAACAATATTAGCACAATGG + Intronic
1091310350 11:134570795-134570817 GTATAACAATAACAGCACAGAGG + Intergenic
1092803192 12:12192128-12192150 AAATGACAATAATAGCAGAAAGG + Intronic
1093053056 12:14525818-14525840 ATATGACAACAATAGCACAAAGG + Intronic
1093495321 12:19750355-19750377 ATATAAGAATAACAGCTCAATGG - Intergenic
1093566497 12:20611960-20611982 ATATAAAAACAATAACACAAAGG - Intronic
1094257319 12:28447000-28447022 TTCTAACAATAACAGGACAACGG - Intronic
1094296046 12:28906556-28906578 GTATGATAATAATAACTCAAAGG + Intergenic
1096035161 12:48460634-48460656 TGACAACAATAATAGCACAAAGG + Intergenic
1096187581 12:49592067-49592089 GTATGACAACAGTAGGACAAAGG + Intronic
1096658900 12:53109927-53109949 GCATTAAAATAAAAGCACAATGG - Intronic
1096733956 12:53637786-53637808 GTATGACAATAACTGCATAAAGG - Intronic
1096764763 12:53875696-53875718 GTATGACGATAATAGCACAAAGG + Intergenic
1097002634 12:55890574-55890596 GTATGACAACAATAGCAAAAAGG + Intergenic
1097011980 12:55959500-55959522 GAATAAAAATAACAGCACTAGGG + Intronic
1097643319 12:62207149-62207171 GTAAGACAATTATAACACAATGG - Intronic
1097740676 12:63238617-63238639 CTATGACTATAATAGCACAAAGG - Intergenic
1097813838 12:64049509-64049531 GTATCACAAGAATAGCATGAGGG + Intronic
1097846221 12:64369615-64369637 GTATGACAGTAATAGCACAAAGG + Intronic
1098133071 12:67371370-67371392 ATATGACTACAATAGCACAAAGG - Intergenic
1098413265 12:70203856-70203878 ATATGACAATAATAGCACTAAGG + Intergenic
1098975528 12:76898128-76898150 GCATGACAATAATAGTACAAAGG + Intergenic
1098988441 12:77037494-77037516 GTTTGACAACAATGGCACAAAGG + Intronic
1099208135 12:79751752-79751774 GTATGATAGCAATAGCACAAGGG + Intergenic
1099299645 12:80876032-80876054 GTATAAAAATAATAAAACCAAGG - Intronic
1099406719 12:82272860-82272882 GTATAATAATAATAAAAAAAAGG - Intronic
1099628257 12:85105472-85105494 GTAAAACAATTTTTGCACAAAGG - Intronic
1100872707 12:98927616-98927638 CTATGACAATAATAACACAAAGG + Intronic
1100969025 12:100046719-100046741 GTATAATAATAATAATAAAAAGG + Intronic
1101183357 12:102244775-102244797 GTGTGACAATAATAACATAAAGG - Intergenic
1101191181 12:102334538-102334560 CTGTAACAACAATAGCACTAAGG - Intergenic
1101313391 12:103606280-103606302 ACATAACAATAATAGCACCAAGG - Intronic
1102264325 12:111469749-111469771 TTATAATAATAAAAGCATAAAGG - Intronic
1102851541 12:116250904-116250926 GTATGACAACAATAGCACAAAGG + Intronic
1102945263 12:116981552-116981574 GTATGACAGTAATAGCACAAAGG + Intronic
1104197600 12:126555918-126555940 GTATAACAATTATAACATAGAGG - Intergenic
1104245009 12:127030574-127030596 TTATAAAAATAACAGGACAAAGG + Intergenic
1104538144 12:129637884-129637906 CTATCACAAGAATAGCACCAAGG + Intronic
1104701922 12:130911762-130911784 GTATAATGGTAATAGTACAAAGG + Intergenic
1105047588 12:133018087-133018109 GTCTACCAATAACACCACAAAGG + Exonic
1105391036 13:19978342-19978364 CTATGACAATAATATTACAAAGG - Intronic
1105480079 13:20766897-20766919 GTATGACAACAATAACACAAAGG - Intronic
1105644373 13:22301677-22301699 GGATAACAATAGGAACACAAAGG - Intergenic
1105693177 13:22861806-22861828 GTATAATAATAATAAAAAAAAGG - Intergenic
1105933652 13:25077070-25077092 GTATGACAACAGTAGCACAAAGG + Intergenic
1106114635 13:26806515-26806537 GTATGTCAATCATAGCACAAAGG + Intergenic
1106204275 13:27575253-27575275 GTATAATAATAATAGCACACAGG + Intronic
1106209595 13:27629342-27629364 GGATAACAATAATACCATATAGG + Intronic
1106881209 13:34132699-34132721 ATATAACAAAAATAGCACAAGGG - Intergenic
1107161563 13:37235282-37235304 ATATAACAATATTAGCACAAAGG + Intergenic
1107360960 13:39617473-39617495 GTATAACAATGATAACATTAGGG + Intergenic
1107594283 13:41946499-41946521 GTATGACAATAATAGCACTGAGG + Intronic
1107665307 13:42682664-42682686 CTATAAGAATAAGAGTACAAAGG - Intergenic
1107839707 13:44443758-44443780 GTATGACAAAGATAGAACAACGG + Intronic
1108136892 13:47374139-47374161 GTATGAAAATAACAGCACAAAGG - Intergenic
1108142035 13:47433834-47433856 GTATAATAATAATTGAAAAAAGG - Intergenic
1108234688 13:48391253-48391275 GTATGACAACAACAGCCCAAAGG - Intronic
1108828784 13:54451858-54451880 CTATCACAAGAATAGCATAAGGG + Intergenic
1109088310 13:58005825-58005847 GTATAATAATAATAAAAAAATGG - Intergenic
1109299225 13:60573858-60573880 GTAAAACAATAATAGCACAATGG - Exonic
1109578758 13:64298064-64298086 GTATAACAATATTAGGTAAAAGG - Intergenic
1110069256 13:71152695-71152717 GGATTTCAATCATAGCACAAAGG + Intergenic
1110129344 13:71987715-71987737 GAATAACAGTAATAGCAGAGAGG + Intergenic
1110341019 13:74390072-74390094 GTATGAAAATAATAGTCCAAAGG - Intergenic
1110478622 13:75947495-75947517 GAAGAAAAATAATTGCACAAAGG + Intergenic
1111357900 13:87133870-87133892 GTACAATGATACTAGCACAAAGG + Intergenic
1111570556 13:90078684-90078706 GTATAAAAATAATAGATAAAAGG - Intergenic
1111743619 13:92236764-92236786 TTATAATAAAATTAGCACAAAGG + Intronic
1111934409 13:94544913-94544935 GTATAACAATTATAGCAGCTCGG + Intergenic
1112641768 13:101283317-101283339 GGATAACAATAATAACAATAAGG - Intronic
1112987755 13:105472251-105472273 GTAAAACAAAAATATCAAAATGG - Intronic
1113321988 13:109242924-109242946 GTAAAAGAATAATAGCAGTAAGG + Intergenic
1113855343 13:113441542-113441564 GTACAACAACAATAGCACGAAGG - Intronic
1113898394 13:113781225-113781247 GCATTAAAATAAAAGCACAATGG - Intronic
1114005568 14:18309612-18309634 GTATGAGAAAAATAGAACAAAGG - Intergenic
1114865790 14:26595212-26595234 GTACAACAATTATAGGAAAAAGG + Intronic
1115128652 14:30026429-30026451 GGATAACAATAAATGCAGAATGG + Intronic
1115311784 14:31985616-31985638 ATATGACAAGAATAGCACAAAGG - Intergenic
1115910480 14:38251235-38251257 GACTAACAGGAATAGCACAAAGG + Intergenic
1116547399 14:46186109-46186131 GTAGAAATATAAAAGCACAAGGG + Intergenic
1116580354 14:46633419-46633441 AACTAACAATCATAGCACAAGGG - Intergenic
1117125658 14:52621614-52621636 ATATAACAACCATAGCATAAAGG + Intronic
1117757799 14:58993871-58993893 ATATGACAATGATATCACAAAGG - Intergenic
1118082404 14:62375920-62375942 ATATGAAAACAATAGCACAAAGG - Intergenic
1118516684 14:66537529-66537551 ATATGAAAAAAATAGCACAAAGG - Intronic
1118724183 14:68616079-68616101 TTATAGCAGCAATAGCACAAAGG - Intronic
1118863677 14:69685327-69685349 GAATAATATTAGTAGCACAATGG - Intronic
1119413030 14:74447847-74447869 GTATGACAACAATAGCATAAAGG + Intergenic
1120114688 14:80600847-80600869 GTATCACAATAACAATACAAAGG + Intronic
1120215092 14:81673010-81673032 ATATAATAACAATAGCACAAAGG - Intergenic
1120439202 14:84513579-84513601 GTATAACAATAAAAGAAACATGG - Intergenic
1120609014 14:86616704-86616726 TAATAATAATAATAACACAAAGG + Intergenic
1120657552 14:87211850-87211872 GTATGACAATAATAGGTCAAAGG - Intergenic
1121057656 14:90873443-90873465 TTATAACAATAAGTGCACAGGGG - Intronic
1121167482 14:91819741-91819763 GTATTACATCAATAGCACAAAGG + Intronic
1122385709 14:101345117-101345139 GCATAACAGCAATAGCACAAAGG + Intergenic
1122432138 14:101659076-101659098 GTATGACAACAATAGCACAAAGG - Intergenic
1124127937 15:26955029-26955051 GTATAACAATACTATCACCTTGG + Intergenic
1124213808 15:27789010-27789032 ATATTAAAATAATAGCATAAAGG - Intronic
1125091325 15:35796146-35796168 GTATGACAACAATGGCATAAGGG - Intergenic
1125823404 15:42653913-42653935 ATATGAAAATAACAGCACAAGGG + Intronic
1126709998 15:51444424-51444446 GTATGACAACAGCAGCACAAAGG - Intergenic
1127040102 15:54965736-54965758 ATATGACAACAATAGCACTAAGG - Intergenic
1127168701 15:56275627-56275649 ATATAACAATAATAGCACAAAGG - Intronic
1127172596 15:56318824-56318846 GTGTGACAATAATAGCACAAAGG - Intronic
1127912057 15:63424907-63424929 CTATAACAACAATACTACAAAGG - Intergenic
1127976930 15:64004673-64004695 GCATAACAATAATTCCACAGTGG + Intronic
1128041634 15:64579757-64579779 GTATGACAATAATAGCACAAAGG - Intronic
1128523775 15:68393896-68393918 ATATGACAAAAATAACACAAAGG + Intronic
1128540864 15:68531139-68531161 GTATGACAATAATAGCATAAAGG - Intergenic
1128962729 15:72024675-72024697 GCATAACAATTACAGGACAAAGG + Intronic
1129571238 15:76687143-76687165 AAATAACAATAATAGCATATTGG + Intronic
1130760979 15:86819481-86819503 ATATACCAATAATAGAAAAATGG + Intronic
1130776221 15:86986530-86986552 CTACAAAAATAATAGCAAAAAGG + Intronic
1130780932 15:87040190-87040212 GTATGCTAACAATAGCACAAAGG + Intergenic
1131901655 15:97094492-97094514 GTATGACAAGAATAGCATGAGGG - Intergenic
1132159347 15:99523703-99523725 ATATGACAACCATAGCACAAAGG - Intergenic
1134365639 16:13575941-13575963 ATATGACAAAAGTAGCACAAAGG + Intergenic
1134464777 16:14465473-14465495 TATTAACACTAATAGCACAAAGG + Intronic
1135462620 16:22658430-22658452 GTATAACAACAATGGCACAAGGG - Intergenic
1135926733 16:26701396-26701418 ATTTCACAATAACAGCACAAAGG + Intergenic
1137437498 16:48468572-48468594 GTATGACAATACTAGCACAAAGG - Intergenic
1138252690 16:55515700-55515722 GTATAATAATAATAGCAAATAGG + Intronic
1138628290 16:58270947-58270969 ATTTGACAGTAATAGCACAAAGG - Intronic
1138720278 16:59071964-59071986 ATATGACAACACTAGCACAAGGG + Intergenic
1138769564 16:59647944-59647966 CTATCACAAGAATAGCACAGGGG + Intergenic
1139080485 16:63512942-63512964 CTATGACAATTATAACACAATGG + Intergenic
1139870578 16:70105397-70105419 ATATGACAACAGTAGCACAAAGG + Intergenic
1140324206 16:73985152-73985174 ACATAAAAATAACAGCACAAAGG + Intergenic
1140341149 16:74163982-74164004 ACATGACAATAGTAGCACAAGGG + Intergenic
1140384869 16:74527162-74527184 ATATGACAACAGTAGCACAAAGG - Intronic
1140422200 16:74829538-74829560 GTAAGACAATAATGACACAAAGG + Intergenic
1142506704 17:368764-368786 GTATAACAATAATAGCACAAAGG - Intronic
1142589423 17:995483-995505 GTTTAACAACAATAACAAAAAGG + Intergenic
1143581293 17:7828507-7828529 GTGGTACAATCATAGCACAATGG + Intronic
1144470001 17:15530438-15530460 GTATGATGATAATAGCACAAAGG - Intronic
1144926343 17:18813213-18813235 GTATGATGATAATAGCACAAAGG + Intergenic
1146026796 17:29328480-29328502 GAATAAAAATAGTAGTACAAGGG - Intergenic
1147151207 17:38515370-38515392 GTATGACAATAATGGCATGAAGG + Intergenic
1149306601 17:55353403-55353425 TTATAACAGTAATAGCACAAAGG + Intergenic
1149586790 17:57794220-57794242 GTATGACAACTATAGCACAAAGG + Intergenic
1149877020 17:60245050-60245072 GAGTGACAACAATAGCACAAAGG - Intronic
1150628727 17:66861152-66861174 ATTTGACAATAACAGCACAAAGG + Intronic
1150797975 17:68254804-68254826 GAATTACACTAATAGCACATGGG - Intronic
1152939295 17:83159079-83159101 GTATGACAATAATAGCAAAAAGG - Intergenic
1153086154 18:1290242-1290264 GTTTGATAATAATAGCACAAGGG - Intergenic
1153161767 18:2213761-2213783 ATAAAACAACAATAGCATAATGG + Intergenic
1153177031 18:2387375-2387397 ATATAAAAATAGTAGAACAAAGG + Intergenic
1153253229 18:3143564-3143586 GTATGACAATAACAGCACCAAGG + Intronic
1153511534 18:5859459-5859481 GTATAATAATAATAATAAAATGG + Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153899050 18:9599185-9599207 GTATGACTATAATAGCACAAAGG + Intronic
1154050198 18:10947799-10947821 ATATGTCATTAATAGCACAAAGG + Intronic
1154531862 18:15354262-15354284 GTATGAGAAAAATAGAACAAAGG + Intergenic
1155428646 18:25732511-25732533 GTATAACAATAACAGCACAAGGG + Intergenic
1155577313 18:27261912-27261934 TTATGACAGTAATAGAACAAAGG - Intergenic
1155589222 18:27406032-27406054 ATATAAGAATGATAGCACAAAGG + Intergenic
1156612638 18:38744034-38744056 GTTTGACAACAATAGCACAAAGG + Intergenic
1157144249 18:45145173-45145195 GTAAAAAAAAAATAGCAAAATGG + Intergenic
1157315281 18:46582255-46582277 ATATTACAATAATAGCATGAAGG + Intronic
1157956366 18:52101902-52101924 GAATAACAAAAATACCAAAATGG - Intergenic
1158270611 18:55710971-55710993 ATATGACAACAATAACACAAAGG - Intergenic
1158930630 18:62322446-62322468 GTATGACTATGGTAGCACAAAGG + Intergenic
1160138003 18:76290136-76290158 ATATAAGAACAATAGCACAAAGG + Intergenic
1160615743 18:80126247-80126269 GTATAACAACAACAGAACAAAGG - Intronic
1161930361 19:7335674-7335696 CTGTCACAAGAATAGCACAAAGG + Intergenic
1162711705 19:12599915-12599937 ATATTAAAATAAAAGCACAACGG + Intronic
1164665328 19:30028700-30028722 ATATTACAATAATAGGACAAAGG - Intergenic
1164993600 19:32702925-32702947 GTATGACAACAATAGCATAAAGG - Intronic
1165054695 19:33167275-33167297 ATATTACATTAATAGAACAAAGG + Intronic
1165971296 19:39632979-39633001 GTATAATAATAATAAAAAAAAGG - Intergenic
1166023854 19:40060623-40060645 ATATTACTATGATAGCACAAAGG + Intergenic
1167136244 19:47617867-47617889 TAATAACAATAATAATACAATGG - Intronic
925101864 2:1253909-1253931 GTATCACAAGAATAGAACCATGG + Intronic
925618823 2:5770216-5770238 ATATATCAGTAATAGCAAAAAGG - Intergenic
925621915 2:5802563-5802585 CTATTACAAGAATAGCATAAGGG - Intergenic
926397803 2:12462628-12462650 ATATGACAATAATAGAACAAAGG + Intergenic
926450837 2:13001848-13001870 GTATAACTAAAATAACACATAGG + Intergenic
927005928 2:18848606-18848628 ATAAAACAATAATAGCATGAAGG - Intergenic
927619737 2:24641243-24641265 ATATTACAATAATAGCACAAAGG - Intronic
927648322 2:24894547-24894569 GTATGACAAAAATAGCACAAAGG - Intronic
928227577 2:29465925-29465947 GTATTACAATAATAGCACAAAGG + Intronic
928418215 2:31114662-31114684 GAATAACAATAATCCCAGAAGGG + Intronic
928790615 2:34948049-34948071 ATATAGCAATAATAGCTAAAAGG + Intergenic
929350555 2:40947810-40947832 GTATGACAACAATGGCACACAGG - Intergenic
929951755 2:46416129-46416151 ATATGACAAGAATAGCACAAAGG + Intergenic
929965586 2:46532965-46532987 CTATAACAATAATAACAAAAGGG - Intronic
930760918 2:55034837-55034859 TTATGACAATAAAAGCACAAAGG + Intronic
931029171 2:58152389-58152411 GTATAACAACAATAGCACAAAGG - Intronic
931165523 2:59743306-59743328 CTATAACTATAAAAGCAAAAAGG - Intergenic
931679452 2:64732234-64732256 GTGAAACAATGATAGCAAAAAGG + Intronic
931936146 2:67198896-67198918 ATATAACAATAACAATACAAGGG + Intergenic
931977540 2:67659212-67659234 GTACAAGAACAATAGCACAAAGG - Intergenic
932117263 2:69063740-69063762 GTATGACAATAATAACACAAAGG + Intronic
932271742 2:70416341-70416363 GTATAACAACAATAGCACAGAGG + Intergenic
932279977 2:70482211-70482233 GTATAAAACTGTTAGCACAAAGG - Intronic
932296504 2:70627822-70627844 GTAAGACAAAAATAGCACCAAGG + Intronic
932686618 2:73876090-73876112 ATATAACAATAATAGTAATAAGG + Intergenic
933302151 2:80553641-80553663 GTATAACAGTAATACAAGAATGG - Intronic
933568997 2:83986240-83986262 ATGCAACAACAATAGCACAAAGG - Intergenic
935284078 2:101548227-101548249 GTATGACATCGATAGCACAAAGG - Intergenic
935480385 2:103580911-103580933 ATATGGCAATAATAGCATAAAGG - Intergenic
935923750 2:108043450-108043472 ATATAGCAATTATAGCATAAAGG + Intergenic
937005147 2:118505051-118505073 ATATAAAGAGAATAGCACAATGG - Intergenic
937731267 2:125233125-125233147 CTAAAACAATCAGAGCACAACGG - Intergenic
937842921 2:126543691-126543713 GTATGACAAAAATAGCATAAAGG + Intergenic
937995128 2:127688224-127688246 ATTTAACAGTAACAGCACAAAGG - Intergenic
938204577 2:129408307-129408329 GTATGACAATTAAAGCACAAAGG - Intergenic
938509993 2:131931352-131931374 CTATAACAAGAACAGCACAGGGG + Intergenic
938530961 2:132185498-132185520 GTATGAGAAAAATAGAACAAAGG + Intronic
939353376 2:141069800-141069822 GTATAATAATAATAAAAGAAGGG - Intronic
939368881 2:141271926-141271948 ATTTGCCAATAATAGCACAAAGG + Intronic
939439508 2:142226583-142226605 ACATGACAATAATAGCAAAAAGG + Intergenic
939658974 2:144863920-144863942 GCATAATAAAAAAAGCACAAAGG - Intergenic
939710624 2:145514222-145514244 GTATGACAACAGGAGCACAAAGG + Intergenic
940112846 2:150173162-150173184 AAATGACAACAATAGCACAAAGG + Intergenic
940196200 2:151097059-151097081 ATATAACAAAAATGTCACAAAGG + Intergenic
940452112 2:153851885-153851907 GTATGACAAGACTAGTACAAAGG + Intergenic
940596016 2:155794424-155794446 TTATAACAGTAATAGTACATTGG + Intergenic
941108356 2:161389014-161389036 GTATAACAATAACAAAACAAAGG - Intronic
941540978 2:166784197-166784219 ATTTACCAATAATAGTACAAAGG + Intergenic
941555618 2:166976647-166976669 GTAAGACAAAGATAGCACAATGG - Intronic
942100518 2:172577736-172577758 ATATGACAATAACAGCACAAAGG - Intronic
942160138 2:173176394-173176416 ATATCACAACAATAGCATAAAGG + Intronic
942940366 2:181608387-181608409 CTAGAACAATAAGAGCACAAAGG + Intronic
943815045 2:192242677-192242699 AAATAACAATAGTAGCAAAAGGG + Intergenic
943826177 2:192396423-192396445 GTATGACAATGATAGTACAAAGG - Intergenic
944072380 2:195686799-195686821 GTATAAGAATTACAGCACAGTGG - Intronic
944290107 2:197995491-197995513 GTATAATGAGAATACCACAAAGG + Intronic
944478267 2:200128634-200128656 GTGTAACAGTAATATCAAAAGGG + Intergenic
944669679 2:201984575-201984597 GCATGACAATAATAAAACAAGGG + Intergenic
944924092 2:204445828-204445850 TTATTACAATAATGGCACAAAGG + Intergenic
944990864 2:205233559-205233581 ATATGACAATAACAGCACAGAGG + Intronic
945062413 2:205920754-205920776 GTATAAAAATCCTAGCACAGTGG + Intergenic
945647432 2:212515926-212515948 ATAAAACAATAAAAGCATAAAGG + Intronic
945743105 2:213687223-213687245 GCATGACAATAATAACAGAAAGG - Intronic
946382322 2:219357613-219357635 GTAAGGCAGTAATAGCACAATGG - Intergenic
946536985 2:220641576-220641598 ATATGACAACAATAACACAAGGG + Intergenic
946887354 2:224235636-224235658 GTATGACAAAGATAGCACAAAGG - Intergenic
947098889 2:226597308-226597330 GGATAACAATAAAAGCAAAATGG - Intergenic
947401815 2:229738592-229738614 GTATGACAATAATAGCATATAGG + Intergenic
947899020 2:233704735-233704757 ATTTGACAATAATAGCACAAGGG - Intronic
948215870 2:236230560-236230582 TATTACCAATAATAGCACAAAGG + Intronic
948579641 2:238976474-238976496 GTATAACAATAATAGCAGAAAGG + Intergenic
1168733585 20:109930-109952 GTATGACAATAAGTGCAAAATGG + Intergenic
1168822124 20:781652-781674 GTATTAAAATAAAAGCACAATGG - Intergenic
1168975236 20:1960754-1960776 GTATAACAAAAACAATACAAAGG + Intergenic
1169022921 20:2342970-2342992 GTATGAAAATAATAACACAATGG + Intergenic
1169024363 20:2356248-2356270 GTATGACAATAATTTCACAATGG + Intergenic
1169079275 20:2785610-2785632 GTATTACAATAAGAGCACAAAGG - Intergenic
1169866621 20:10207516-10207538 GTATGAAAATAAAAGCACCAAGG - Intergenic
1170415712 20:16137687-16137709 GTACAAGAATGATAGCAAAAAGG + Intergenic
1171129512 20:22637790-22637812 GTATGACAGTAATAGCATAAAGG - Intergenic
1172019610 20:31904688-31904710 TTATTACAATAATTGCAAAATGG + Intronic
1172317861 20:33970304-33970326 GCATAACAGGACTAGCACAAAGG + Intergenic
1172811376 20:37650537-37650559 GTATTACAACAAAGGCACAAAGG + Intergenic
1173054830 20:39601509-39601531 GTATCACAAAAGTATCACAATGG - Intergenic
1173086373 20:39922791-39922813 GTATAATAATAATAAAAAAAAGG + Intergenic
1173756299 20:45519422-45519444 ATATGACAACAAAAGCACAAAGG - Intergenic
1174830301 20:53806173-53806195 GTATAACAATAATAAACCCAGGG + Intergenic
1175620525 20:60442995-60443017 GTAGGACAACATTAGCACAAAGG - Intergenic
1176765499 21:13013911-13013933 GTATGAGAAAAATAGAACAAAGG - Intergenic
1177517280 21:22171389-22171411 GTATAAGAATAATGGCACAAAGG - Intergenic
1177603530 21:23347738-23347760 GTATAACAATAATAATACTGTGG + Intergenic
1178317908 21:31582356-31582378 TAATAATAATAACAGCACAAGGG + Intergenic
1178767302 21:35466447-35466469 CTATCACAAGAATAGCACCAAGG - Intronic
1179001264 21:37461340-37461362 ATAAAACAATCACAGCACAAAGG - Intronic
1179362282 21:40722360-40722382 GAATAACAATATTAACACAAAGG + Intronic
1179378221 21:40872100-40872122 ATTTGACAATAATAGCACAAAGG + Intergenic
1179917489 21:44486761-44486783 GTATAATAATAATAAAAAAAAGG - Intergenic
1180111791 21:45660723-45660745 GTATGACAATAACAGCACAAAGG - Intronic
1180224039 21:46378838-46378860 GTACGACAATATGAGCACAAAGG - Intronic
1180430077 22:15240398-15240420 GTATGAGAAAAATAGAACAAAGG - Intergenic
1180512688 22:16108720-16108742 GTATGAGAAAAATAGAACAAAGG - Intergenic
1182196909 22:28528275-28528297 ATATGACAGTAATACCACAAAGG + Intronic
1182805825 22:33069379-33069401 GTATGAGAATTAAAGCACAAAGG + Intergenic
1182942450 22:34290069-34290091 ATAAAACAATACTAGGACAAGGG + Intergenic
1183144763 22:35980139-35980161 GTATAAAAAAAATAGACCAAAGG + Intronic
1183810240 22:40250268-40250290 TTATAACAATAAAACCACAAAGG - Intronic
1183907969 22:41056956-41056978 TTGTGACAATAACAGCACAAAGG - Intergenic
1184056676 22:42056311-42056333 TTGTAACAATAACAGCATAAAGG - Intronic
1184284107 22:43457811-43457833 GTATGACAATAATAGCATAAAGG - Intronic
949216310 3:1572807-1572829 ATATAAAAATAATAGCACAAAGG + Intergenic
949241120 3:1873579-1873601 ATATGACAATAATAGCACAAAGG + Intergenic
949389180 3:3539896-3539918 GTATAATAATAATAGAAAAGAGG - Intergenic
950144402 3:10638332-10638354 GTATGACAATAACAGCATAAAGG + Intronic
951759779 3:26133867-26133889 ATGTAACAATAATAGCACAAAGG - Intergenic
952359851 3:32619291-32619313 TTATGTCAATAATAGAACAAAGG + Intergenic
952900080 3:38106080-38106102 GTATGACAATAATAGTACAAAGG - Intronic
953595801 3:44312281-44312303 GAATAAGAATAATAATACAATGG + Intronic
953714243 3:45303018-45303040 ATTTGACAATAACAGCACAAAGG + Intergenic
954282377 3:49591232-49591254 GTTTGACAAAAAGAGCACAAAGG - Intronic
954889152 3:53907494-53907516 ATATGACAGTAACAGCACAAGGG + Intergenic
955152984 3:56387257-56387279 CTATAACAATAATAACAAATTGG - Intronic
955265737 3:57442364-57442386 ATATGACAACAATAGCACAATGG + Intronic
955711748 3:61786667-61786689 GTATAAAAATAGAAGCACAAAGG - Intronic
955791680 3:62594524-62594546 CTATTTCAATAATAGAACAATGG - Intronic
956079607 3:65543896-65543918 GTATAATAATAATAAAACACAGG + Intronic
956222082 3:66915168-66915190 GTATTATAATAATAGCACAAAGG + Intergenic
956539316 3:70317130-70317152 ATATGAAAATAATAGTACAAAGG - Intergenic
956759032 3:72421337-72421359 GTATTACAATAGCAGCACAAAGG + Intronic
956807471 3:72829998-72830020 GTGTAAAAATAATACCCCAAAGG + Intronic
956812563 3:72878234-72878256 GAATGACAGTAATAACACAAGGG - Intergenic
956828831 3:73025355-73025377 GTCTCACAATAATAGAACAAGGG - Intronic
957479748 3:80776323-80776345 CTGTAAAATTAATAGCACAATGG - Intergenic
957504631 3:81103876-81103898 GTATAATAATAATAAAAGAATGG - Intergenic
957696956 3:83650880-83650902 CTATCACAAGAATAGCATAAGGG + Intergenic
957718220 3:83961422-83961444 GTTTAAAAATAGTAGAACAAAGG - Intergenic
957857933 3:85903103-85903125 ATTTGACAATAACAGCACAAAGG - Intronic
957876237 3:86149956-86149978 CTATCACAAGAATAGCACCAAGG - Intergenic
958544789 3:95530888-95530910 GTAAAACAAAAATAGAATAAAGG - Intergenic
958582400 3:96044234-96044256 CTATCACAATAATAGCATGAAGG + Intergenic
958637867 3:96767831-96767853 ATTTTACAATAATAACACAAAGG + Intergenic
958787033 3:98607913-98607935 TAATGACAACAATAGCACAAAGG + Intergenic
958985186 3:100772441-100772463 GTATGACAATAATAGTCCAAAGG + Intronic
959102455 3:102027067-102027089 GTATGACAAAAATAACACAGAGG + Intergenic
959656505 3:108811504-108811526 GTATGACATTAATAACACAAAGG - Intergenic
959877228 3:111398390-111398412 GTATGACAATAATATCCAAAAGG - Intronic
960477818 3:118151767-118151789 GAATGACAATAATGACACAAAGG + Intergenic
961587579 3:127946119-127946141 ATATAACAAGAAAAGTACAACGG - Intronic
962050182 3:131805415-131805437 GTATAACTAGAACAGCACATTGG - Intronic
962287098 3:134095563-134095585 GTATGACAAAAATAGCTCAAAGG - Intronic
962551097 3:136492913-136492935 ATATGACAATAATAGCACAAAGG + Intronic
963100233 3:141594967-141594989 ATATGACAGTAACAGCACAAAGG + Intronic
963694377 3:148546551-148546573 ACTTAACAATAATAGCACAAAGG - Intergenic
963863838 3:150339097-150339119 GTATGACAATCATAGCACAAAGG + Intergenic
964268105 3:154922699-154922721 ATATGACAATAATATTACAAAGG + Intergenic
964351915 3:155811464-155811486 GAATGGCAATAATAGCTCAAAGG + Intergenic
964410206 3:156390069-156390091 AGACAACAATAATAACACAAGGG + Intronic
964467790 3:157016751-157016773 ATATGACAATAATAACACAATGG + Intronic
964926530 3:161964493-161964515 GTATCACAAGAATAGCATGATGG - Intergenic
965043668 3:163546485-163546507 GTATTACAATGATAGAACACAGG - Intergenic
966991233 3:185233193-185233215 TTGTGACAATAATAGCATAAAGG + Intronic
967569176 3:191008137-191008159 GTATAATAATAATAAAAAAAGGG + Intergenic
968513700 4:1006525-1006547 ATGTAACAACAATAGCACAATGG - Intergenic
968536905 4:1137471-1137493 ATACGACAACAATAGCACAAAGG - Intergenic
968791644 4:2668616-2668638 ATAGGACAATAATAGTACAAAGG - Intronic
969434405 4:7178662-7178684 ATGTGACAATAATAGTACAAGGG - Intergenic
970020640 4:11563567-11563589 GTATAATAATAATAAAAAAAAGG + Intergenic
970166758 4:13246602-13246624 GTGTGACAATAACTGCACAAAGG - Intergenic
970351476 4:15206017-15206039 GAATAACAACAATAGAACAAGGG - Intergenic
970555381 4:17226269-17226291 ATATGGCAACAATAGCACAAAGG + Intergenic
970569645 4:17367215-17367237 ATACAACAATAATACCACACAGG - Intergenic
970770179 4:19602768-19602790 GTATAATAATAATAAAAAAAAGG + Intergenic
971108443 4:23554252-23554274 GTATGAAAATACCAGCACAAAGG + Intergenic
971585207 4:28397033-28397055 ATATAACAAGAAAGGCACAAAGG - Intronic
971604736 4:28643342-28643364 GTAAAACGATATTAACACAATGG - Intergenic
972037810 4:34548729-34548751 GCACAACAACCATAGCACAAAGG - Intergenic
972231958 4:37083563-37083585 GAGTGACAATGATAGCACAAAGG + Intergenic
972252315 4:37315967-37315989 ATATGACAATAATAAAACAAAGG - Intronic
973891801 4:55374874-55374896 CTTCAACAATAATAACACAAGGG - Intergenic
974509218 4:62815961-62815983 GTACTTCAATAATAGCACACAGG - Intergenic
975460931 4:74652107-74652129 GTATAATAATAATAAAAAAAAGG - Intergenic
976631652 4:87243983-87244005 CTGTGACAATAATAGCATAAAGG + Intergenic
977525179 4:98136691-98136713 GTACAACCACAATAGGACAAAGG + Intronic
978858495 4:113420650-113420672 GTATAACAGCAATAGCACAAAGG + Intergenic
979640329 4:123005828-123005850 ATATGACAACAATAGCACAAAGG - Intronic
979801628 4:124916458-124916480 GTATCATAAAAATAGCATAAAGG - Intergenic
979928645 4:126601472-126601494 CTCTAACAATAAGAGTACAAAGG + Intergenic
980384708 4:132073274-132073296 GTATTACAATACTAGTAAAATGG + Intergenic
981442328 4:144797298-144797320 GTATCACAAGAATATCACCAAGG - Intergenic
982063668 4:151630458-151630480 ATATAACAATAATTGCACAAAGG + Intronic
982150486 4:152450127-152450149 GTATAACATGAATATCAAAAGGG - Intronic
982728441 4:158929698-158929720 GTCTAAAACTAATAGCACAAAGG - Intronic
983830873 4:172326971-172326993 ATTTCACAATAATAGCATAAAGG - Intronic
984655648 4:182315075-182315097 ATATCTCAATAATAGCATAAAGG - Intronic
985001546 4:185489230-185489252 GTATAACAATAATAGCATAAAGG - Intergenic
985710705 5:1427241-1427263 CTATGACAACAATTGCACAAAGG + Intronic
985813334 5:2107258-2107280 GTTTGACAATAATAACATAAGGG + Intergenic
985813341 5:2107424-2107446 GTATGACAATAGTAGCCCAAAGG + Intergenic
985981279 5:3467241-3467263 GTGTGACAAAAACAGCACAAGGG + Intergenic
986480500 5:8182046-8182068 GTATAACAAGAATGGAATAAAGG + Intergenic
987002874 5:13678552-13678574 GTATGACAAAAATAGCACAAAGG + Intergenic
987045555 5:14104216-14104238 ATTTAACAATAACAACACAAAGG + Intergenic
987320174 5:16761289-16761311 GTATAACAATAATACAAGCAAGG - Intronic
987899033 5:23986850-23986872 ATATACCAATAATACCATAAAGG - Intronic
988135127 5:27160289-27160311 ATATAACAATAAAATCAGAATGG + Intergenic
988319452 5:29673804-29673826 GTATGACAATAACAGTATAAAGG - Intergenic
988319827 5:29680425-29680447 CTATAACAGTAACAGCACAAAGG - Intergenic
988396182 5:30699991-30700013 GTATCACAAGAACAGCATAAAGG - Intergenic
989185280 5:38618729-38618751 GTATGACAACAATAGCACGAAGG - Intergenic
989452456 5:41602904-41602926 TTGTGACAATAATAGCACAAAGG + Intergenic
989729091 5:44626233-44626255 GTATAATAATAATAAAAAAAAGG + Intergenic
990077658 5:51871216-51871238 AGATAACAATGATGGCACAATGG - Intergenic
990200004 5:53361357-53361379 GTATAATAATAATGACACCATGG - Intergenic
990234156 5:53748883-53748905 GTATGTATATAATAGCACAAAGG + Intergenic
990351814 5:54925273-54925295 CTGTAACAATAACAGCATAAAGG - Intergenic
991012072 5:61893824-61893846 GTATAACAACAATAGTACAGTGG - Intergenic
991164474 5:63547666-63547688 GTAAATAAATAATAACACAATGG + Intergenic
991577259 5:68117874-68117896 GTATTTCAATTATATCACAATGG + Intergenic
991626537 5:68607739-68607761 GTATGACAAATATAGCATAAAGG + Intergenic
992613107 5:78524413-78524435 TTCCAACAATAATATCACAATGG + Intronic
992818091 5:80464957-80464979 GTATGGCAATAATGACACAAAGG - Intronic
992908061 5:81367401-81367423 GCATGACAATAACGGCACAAAGG + Intronic
992913178 5:81418983-81419005 GTATCACAATTTTAACACAAAGG + Exonic
993107640 5:83617567-83617589 CTATCACAAGAACAGCACAAGGG - Intergenic
993118699 5:83748450-83748472 GTATAACAGTAATAGCAAAAAGG - Intergenic
993413526 5:87599860-87599882 GTATCACAATAAAAGCATACAGG - Intergenic
993741602 5:91547659-91547681 GTTTGACAATAACAGCACAAAGG - Intergenic
993970241 5:94411050-94411072 GTATGACAACAATAGAATAAAGG + Intronic
995285391 5:110383103-110383125 CTATCACAAGAATAGCATAAGGG - Intronic
995649478 5:114353382-114353404 ATTTGACAATAACAGCACAAAGG - Intergenic
996081197 5:119260199-119260221 GTATGACAATCATAATACAAAGG + Intergenic
998907788 5:146925066-146925088 ATAGGACAGTAATAGCACAAAGG - Intronic
999014037 5:148077657-148077679 ATATGACAACAATAGCATAAAGG + Intronic
999872615 5:155767861-155767883 TTAAACAAATAATAGCACAAAGG - Intergenic
1000151598 5:158507254-158507276 ATATGTCAACAATAGCACAAAGG + Intergenic
1000649616 5:163801273-163801295 GTATGATAACAATATCACAAAGG - Intergenic
1001356034 5:171023321-171023343 CTATAAGAACAATAGTACAAAGG - Intronic
1001472887 5:172027593-172027615 GGATAAGGTTAATAGCACAAAGG - Intergenic
1002511728 5:179724440-179724462 GTAGAACAATAAAAACAAAAGGG - Intronic
1002794223 6:457795-457817 TTATGACAATAACAGCACAAAGG - Intergenic
1002892856 6:1351952-1351974 GTATAACAATAACAGGACAAAGG + Intergenic
1003987003 6:11445966-11445988 ATATGAAAACAATAGCACAAAGG - Intergenic
1004592121 6:17061970-17061992 GCATGACAATAATACTACAAAGG + Intergenic
1004762621 6:18686453-18686475 GTGTAACAAAAGTAGCACAAAGG - Intergenic
1004809633 6:19246184-19246206 ATATAACAGTAACAACACAAAGG + Intergenic
1005328394 6:24724065-24724087 ATAAAACAACAAAAGCACAAGGG - Intergenic
1005495072 6:26381351-26381373 GGATAACAATAATAGAAGACAGG + Intergenic
1005905301 6:30257968-30257990 ATACAACAAGAATAGCACAATGG + Intergenic
1005934902 6:30513809-30513831 ATATGACAATAATGGTACAAAGG + Intergenic
1006053138 6:31358789-31358811 ATACAACAATAATAGCACAATGG - Intergenic
1006279189 6:33034165-33034187 GTATGACAATAACAGCACGGGGG - Intergenic
1006476199 6:34255962-34255984 GTATTACTTTAATAGCATAAAGG + Intergenic
1007732900 6:43960497-43960519 ACACAACAGTAATAGCACAAAGG + Intergenic
1007863737 6:44944119-44944141 GCATGACAATTATAGCATAAAGG + Intronic
1008397855 6:51029685-51029707 GAATATTTATAATAGCACAAAGG - Intergenic
1008779177 6:55081544-55081566 GTATGACCATAATAGAACTACGG - Intergenic
1008967912 6:57333168-57333190 GTATGACCATACTAGGACAATGG - Intronic
1009539535 6:64934985-64935007 GTATCACAATAATAAAACAAGGG + Intronic
1009572304 6:65402132-65402154 GTATAACAAAAATAATACTATGG + Intronic
1009615627 6:66001265-66001287 CTATAATAATAATAATACAAAGG - Intergenic
1009693930 6:67071774-67071796 GTGGGACAATAATAGCACTAAGG - Intergenic
1009820515 6:68794563-68794585 GAATAACAATAATACTTCAAAGG - Intronic
1009903744 6:69842377-69842399 ATATAACAGTAATTCCACAAGGG - Intergenic
1010689629 6:78893976-78893998 ATATAACAACAATAGCACAAAGG + Intronic
1010822099 6:80427389-80427411 GTATGACTATAATAGCAAAAAGG - Intergenic
1010835112 6:80576747-80576769 GCATGACAATAATAGTATAAAGG + Intergenic
1011134130 6:84081467-84081489 CTATCACAAGAATAGCACAGGGG - Intronic
1011440861 6:87385782-87385804 CAATAACAATAACAGCACCATGG + Intronic
1012007994 6:93740568-93740590 CTATGACAAAACTAGCACAAAGG - Intergenic
1012310936 6:97723227-97723249 CTATGACAATAATGGCACCATGG + Intergenic
1013217705 6:108044325-108044347 ATATAACAATAATACTGCAATGG + Exonic
1013335207 6:109151482-109151504 GTATGAAAACTATAGCACAAAGG - Intronic
1014053392 6:116983903-116983925 GTATGACAAAAGTACCACAAAGG - Intergenic
1014700890 6:124686506-124686528 CTATAACAAGAACAGCACTAGGG + Intronic
1014972765 6:127838394-127838416 GTAGAACACTAATAGGAAAATGG - Intronic
1015237587 6:130988604-130988626 GCATAACAAGAATAGCATCAAGG + Intronic
1015616616 6:135082790-135082812 TTATGACAATAATAGCACAATGG + Intronic
1015804379 6:137093561-137093583 GTATAAAAATAATAATATAAAGG + Intergenic
1016132436 6:140492480-140492502 GTATGACAATAACAGCATAAAGG - Intergenic
1016180363 6:141139136-141139158 CTATGACTAGAATAGCACAAAGG - Intergenic
1016210476 6:141527217-141527239 TGATAACAAAATTAGCACAAAGG - Intergenic
1016430472 6:143979620-143979642 TTACAACAATAATTGCACAAAGG - Intronic
1016681467 6:146833810-146833832 GGATGAAAATAATACCACAAAGG + Intergenic
1017573808 6:155779021-155779043 CTATCACAAGAATAGCACTAGGG - Intergenic
1017606504 6:156140258-156140280 ATATGACAAGTATAGCACAAAGG - Intergenic
1017691868 6:156974848-156974870 GTATGACAACAACAGCAAAAAGG - Intronic
1018539992 6:164869159-164869181 GTATGACAAAAACAGCATAAAGG - Intergenic
1018654129 6:166016872-166016894 ATATGACAATATTAGCACAAAGG + Intergenic
1019818893 7:3224282-3224304 GTATGACAACAATATTACAAAGG - Intergenic
1019846323 7:3505914-3505936 GCATAACAGTAATTGCACAAGGG - Intronic
1020446254 7:8271559-8271581 GGATAAAATTAATAGCAGAACGG - Intergenic
1021499376 7:21313339-21313361 ATATGATAATAATAGCACAAAGG + Intergenic
1022492329 7:30830615-30830637 GTATTACAAGAATAGCATGAGGG + Intronic
1022585927 7:31611253-31611275 GTATGACAATAATACCGCAAAGG - Intronic
1022825180 7:34003383-34003405 GTATGACAGTAATAGTAGAAAGG - Intronic
1022938850 7:35211177-35211199 GTTTGACAAGAATGGCACAATGG - Intronic
1023155062 7:37241785-37241807 GTATGACAATGAGAGCACAAAGG - Intronic
1023272486 7:38479596-38479618 GTATGACAATAACAGTGCAAAGG + Intronic
1024008706 7:45248509-45248531 ATATGACAATTATAGCACAAAGG + Intergenic
1024518275 7:50280113-50280135 TAATAAAAATAATAGCAAAATGG - Intergenic
1024583219 7:50817812-50817834 GTATGACAAGAACAGCACAGAGG - Intergenic
1024766041 7:52660968-52660990 GTATTACAATAAAAACACAGAGG + Intergenic
1025797165 7:64749236-64749258 GCATTAAAATAAAAGCACAATGG - Intergenic
1026083756 7:67245337-67245359 GTATGATAATAATAGCACAAGGG + Intergenic
1026693282 7:72568713-72568735 GTATGATAATAATAGCACAAGGG - Intronic
1027404866 7:77849436-77849458 TTATAACAAAAACAGCACAGTGG - Intronic
1027408220 7:77885430-77885452 GTATAACAATAATACCCTCAAGG - Intronic
1027656145 7:80932764-80932786 GAATAACAGTAACTGCACAATGG + Intergenic
1027678887 7:81194077-81194099 GTATGGCAACAATAGTACAAAGG + Intronic
1027715427 7:81663511-81663533 GTATCTCAATAAGAGCAGAAGGG - Intergenic
1028043098 7:86082266-86082288 AAATAACAGTAATAGCACAAAGG - Intergenic
1028574769 7:92336071-92336093 CTATAATAATGATAGCATAAGGG - Intronic
1028752592 7:94396959-94396981 TTATAACAATTATGGCAAAAGGG + Intronic
1030669633 7:112321384-112321406 GTATGACAACAATAGCACAAAGG - Intronic
1030774789 7:113520882-113520904 ATAGAGCAACAATAGCACAAAGG - Intergenic
1031281521 7:119807702-119807724 GTATAATAATAGTATCACAACGG - Intergenic
1031293982 7:119979642-119979664 CTATAACAACAATAGCACAAGGG + Intergenic
1031713331 7:125076110-125076132 ATATAACAATGAAAGCAAAAGGG - Intergenic
1032172467 7:129596743-129596765 CTATGACAAAAATAGCAGAAGGG + Intergenic
1032907950 7:136394490-136394512 GTGTGACAACAATAGCACAAAGG + Intergenic
1033057406 7:138071339-138071361 ATGTAACAATAATATCATAAAGG + Intronic
1033394515 7:140961127-140961149 GTATGACAGTAACAGCACAAAGG + Intergenic
1033463372 7:141567925-141567947 GGATAATAATAATATCTCAATGG + Intronic
1033839679 7:145359290-145359312 GTATGATAATAATGGCATAATGG + Intergenic
1034212692 7:149378234-149378256 CTATGACAATAATAACACAAAGG - Intergenic
1034707690 7:153160917-153160939 GTATAATAACAATAGCACAAAGG + Intergenic
1034733465 7:153408659-153408681 GTCTAACAACAGTGGCACAAAGG - Intergenic
1035360310 7:158308570-158308592 TCATGACAATAACAGCACAAAGG + Intronic
1035915797 8:3620725-3620747 GGATAACAGTAATGGGACAAAGG + Intronic
1037208187 8:16350882-16350904 TTATAAAATTAAGAGCACAACGG + Intronic
1037680354 8:21092235-21092257 ATATAATAATAGTTGCACAATGG + Intergenic
1037955435 8:23053596-23053618 GCATTAAAATAAAAGCACAATGG + Intronic
1038037088 8:23695710-23695732 GTATAACAAAAAAAGCACTGTGG - Intergenic
1038071693 8:24022226-24022248 GTATGACAATACTAGCACAAAGG + Intergenic
1038317112 8:26495110-26495132 ATATGATAACAATAGCACAAAGG + Intronic
1038784413 8:30598135-30598157 GTATAACAATAAAGGCAAAATGG + Intronic
1039304340 8:36244898-36244920 ATATGACAATAATTGCAGAAAGG + Intergenic
1039309339 8:36298638-36298660 CTATCACAAGAATAGCACTAAGG + Intergenic
1039346330 8:36709721-36709743 GTATAACACTAATTGATCAAGGG + Intergenic
1039394383 8:37211561-37211583 GTATTACAATAATAGCACAAAGG + Intergenic
1039726540 8:40223555-40223577 ATATAACAATAATTGTGCAAAGG - Intergenic
1039745119 8:40418424-40418446 GTAATAAAATATTAGCACAATGG + Intergenic
1040711049 8:50189078-50189100 GTCTCACAGGAATAGCACAAAGG + Intronic
1040712277 8:50203706-50203728 CAATGACAATAATAGTACAATGG - Intronic
1040857623 8:51965219-51965241 GAATGACAATCATAGCACAAAGG - Intergenic
1041142063 8:54831561-54831583 ACATAACAGTAATAGCATAAGGG - Intergenic
1041417891 8:57632872-57632894 AAATGAAAATAATAGCACAAAGG + Intergenic
1041589268 8:59558086-59558108 ATATGACAACAATAGCACAAAGG - Intergenic
1041822037 8:62047240-62047262 ATATGTCAATAATACCACAAAGG - Intergenic
1041833479 8:62183873-62183895 GGATATCAGTAATAGCACATAGG - Intergenic
1041849098 8:62367438-62367460 GCATTACATTAATAGAACAAAGG + Intronic
1042035318 8:64526631-64526653 CTAAAACATTAAAAGCACAAAGG - Intergenic
1043829781 8:84973566-84973588 GTATAATAATAATAAAAAAATGG + Intergenic
1044261090 8:90122303-90122325 TTACAAAAATAATAGGACAAAGG - Intergenic
1044499586 8:92937807-92937829 ATATGACAATAATATCCCAAAGG - Intronic
1044777751 8:95710848-95710870 ATAGAACAGTAATAGCACGAAGG - Intergenic
1045560984 8:103262397-103262419 GTATGACAACAATAAGACAAAGG + Intergenic
1045715590 8:105039955-105039977 GTATGACAACAACGGCACAAAGG + Intronic
1046259558 8:111749483-111749505 GTATAATTATAATAGCAAAAAGG + Intergenic
1046366910 8:113245547-113245569 ATATTACAATAACAGCAGAAAGG - Intronic
1046385511 8:113503849-113503871 GCATTAAAATAAAAGCACAATGG - Intergenic
1047139065 8:122115489-122115511 ATATAACTATAAAATCACAAAGG - Intergenic
1047890932 8:129308672-129308694 GTATGACAACAATAGCACAAAGG - Intergenic
1048026659 8:130593248-130593270 CTATCACAAGAATAGCACAGGGG - Intergenic
1050218294 9:3354952-3354974 GAATGACAAAAATAGCACAAAGG + Intronic
1050685495 9:8163958-8163980 CTATCACAAGAACAGCACAAGGG - Intergenic
1051705080 9:19869691-19869713 ATATGACAAGGATAGCACAAAGG - Intergenic
1051803793 9:20967746-20967768 ATATAACATTAATAATACAAAGG - Intronic
1051992821 9:23173962-23173984 GTATAACAATAATATAATAGTGG + Intergenic
1052155064 9:25177168-25177190 GTATGACAACTATAGCACAAAGG + Intergenic
1052242082 9:26285631-26285653 GTATGACAGTAATAGCACATGGG - Intergenic
1052414461 9:28158984-28159006 GTAGAACAATAAAAGCCAAAAGG + Intronic
1052459388 9:28742842-28742864 ATTTGACAATAATAGCACAGAGG - Intergenic
1053084331 9:35205051-35205073 CTATAACAAGAATAGCACCAAGG - Intronic
1053571153 9:39309126-39309148 ATTTGACAATAATGGCACAAAGG + Intergenic
1053616144 9:39768491-39768513 GTATTACAACAATGGCACAAGGG + Intergenic
1053709568 9:40792023-40792045 GTATGAGAAAAATAGAACAAAGG + Intergenic
1053741193 9:41140320-41140342 GTATCGAAATAATAACACAATGG + Intronic
1053837042 9:42149731-42149753 ATTTGACAATAATGGCACAAAGG + Intergenic
1053874315 9:42527792-42527814 GTATTACAACAATGGCACAAGGG + Intergenic
1053898300 9:42766796-42766818 GTATTACAACAATGGCACAAGGG - Intergenic
1054092719 9:60867829-60867851 ATTTGACAATAATGGCACAAAGG + Intergenic
1054114190 9:61143734-61143756 ATTTGACAATAATGGCACAAAGG + Intergenic
1054125992 9:61309886-61309908 ATTTGACAATAATGGCACAAAGG - Intergenic
1054237373 9:62573899-62573921 GTATTACAACAATGGCACAAGGG - Intergenic
1054268020 9:62938962-62938984 GTATTACAACAATGGCACAAGGG - Intergenic
1054346402 9:63969808-63969830 GTATGGAAATAATAACACAATGG + Intergenic
1054419472 9:64912811-64912833 GTATGAGAAAAATAGAACAAAGG + Intergenic
1054444178 9:65296458-65296480 GTATGGAAATAATAACACAATGG + Intergenic
1054486094 9:65725047-65725069 GTATGGAAATAATAACACAATGG - Intronic
1054551508 9:66608410-66608432 GTATTACAACAATGGCACAAGGG - Intergenic
1054687156 9:68290976-68290998 GTATCGAAATAATAACACAATGG - Intronic
1054844811 9:69782903-69782925 GTATGACAATAACAACACAAAGG - Intergenic
1055359228 9:75471561-75471583 GTATAACAGAAATAACACAGGGG + Intergenic
1055988213 9:82075725-82075747 GAATAACAATAATAGCTTATTGG - Intergenic
1056283358 9:85063752-85063774 GTAAAACATTAATAGCCCAAGGG - Intergenic
1056594434 9:87994623-87994645 GTTTGCCAATAACAGCACAAAGG - Intergenic
1056921918 9:90798709-90798731 TTAAAAGAATAAAAGCACAAAGG - Intergenic
1056970864 9:91201411-91201433 GTATGACAATAAAAGCACAGAGG + Intergenic
1057129779 9:92646081-92646103 GTATCCCAATAACAGCACAAAGG + Intronic
1057296393 9:93845929-93845951 GTTTGACAATAACAGCACAAAGG - Intergenic
1057662916 9:97019410-97019432 GTATAATAATAATAATAAAAAGG + Intergenic
1057980394 9:99655589-99655611 GTATGATAATAATAGGGCAAAGG + Intergenic
1058278060 9:103072498-103072520 GTATAAAAATAATAGTACACAGG - Intergenic
1058482340 9:105408808-105408830 GTATGACAATAACAACATAAAGG + Intronic
1058520925 9:105813302-105813324 GTATAATAATAATATTAAAAAGG - Intergenic
1058811963 9:108648597-108648619 GAATAACAATAATAATAAAAAGG - Intergenic
1059290367 9:113218203-113218225 TAATAACAACAATAGCACATAGG + Intronic
1059828852 9:118068133-118068155 GTATAAAGATAATAGCACAAAGG - Intergenic
1060249497 9:121973737-121973759 GTATAATAATAATAAAAAAAAGG + Intronic
1060361003 9:122957652-122957674 GTAGAACAATAATAGGGCATTGG - Intronic
1060774407 9:126361357-126361379 GTATGCCAACAATAGCACAAGGG - Intronic
1061827362 9:133267948-133267970 ATATGACAATAATAGCATAAAGG + Intronic
1187002445 X:15196569-15196591 GTATAATAATAATAAAAAAAGGG - Intergenic
1187157024 X:16729780-16729802 GTATTAAAATAAAAGCACATAGG - Intronic
1187591389 X:20721062-20721084 GGATATCAATATAAGCACAAGGG - Intergenic
1187633722 X:21204183-21204205 CTATATAAATAATAGTACAATGG - Intergenic
1187870192 X:23758554-23758576 CTGTAACAAAAATAGCAAAAGGG + Intronic
1188167730 X:26882575-26882597 GCATTAAAATAAAAGCACAACGG - Intergenic
1188855440 X:35188886-35188908 GTATTACAATAATACCTTAATGG + Intergenic
1189249348 X:39587859-39587881 GTATCACAATGACAGCACCAAGG - Intergenic
1189502191 X:41572617-41572639 GTATGACAACAGTAGCACAAAGG - Intronic
1189627463 X:42914566-42914588 GTATAAAAATAATAGAAATAAGG + Intergenic
1189879490 X:45474803-45474825 GTATGAAAACAATAGCACAATGG - Intergenic
1190112157 X:47598253-47598275 GTTTGACAATAATAGCACAAAGG + Intronic
1191172747 X:57465881-57465903 ATATGACAGCAATAGCACAAAGG + Intronic
1191781274 X:64869444-64869466 ATATGACAATAATAGCTTAAAGG - Intergenic
1191887988 X:65908852-65908874 GTAGGACAATAATAGTTCAAAGG - Intergenic
1191897657 X:66010619-66010641 GTAGAATAATAGTAGCCCAAAGG - Intergenic
1192241878 X:69337913-69337935 GTATGACAATAATAGTACAAAGG - Intergenic
1192566630 X:72169758-72169780 ATATAACAACAATAACACAAAGG + Intergenic
1192593149 X:72378623-72378645 GTGTGACAATAACAACACAAAGG - Intronic
1192636245 X:72821991-72822013 TTATGACAATAGTAGCACAAAGG - Intronic
1192645469 X:72898823-72898845 TTATGACAATAGTAGCACAAAGG + Intronic
1192774315 X:74226145-74226167 GTATAGTAATAATAGCACAAAGG + Intergenic
1192849931 X:74943698-74943720 ATATGACATCAATAGCACAAGGG - Intergenic
1193026104 X:76847703-76847725 GTATAATAATAATAAAAAAAAGG + Intergenic
1193678757 X:84490398-84490420 GTGTAGCAATAATAGCACAAAGG - Intronic
1194172612 X:90606070-90606092 GAATAATAATAATAACACATAGG + Intergenic
1194499979 X:94670567-94670589 ATATAAAAATAAAAGCAAAATGG - Intergenic
1194759679 X:97780777-97780799 CTATGACAATAGCAGCACAAAGG + Intergenic
1195204984 X:102589328-102589350 ATATGATAATAATAACACAAAGG - Intergenic
1195205002 X:102589583-102589605 TTATTACAATGATAACACAAAGG - Intergenic
1195952905 X:110295841-110295863 GAATGACAGTAATAGCACATAGG - Intronic
1196014707 X:110925733-110925755 GTATGACAATAATAGCATAAAGG + Intergenic
1196032444 X:111105250-111105272 ATATGATATTAATAGCACAAAGG - Intronic
1196074324 X:111558267-111558289 GCATTAAAATAAAAGCACAATGG - Intergenic
1196641499 X:118068240-118068262 GTATCACTAGAAAAGCACAATGG + Intronic
1196790489 X:119459844-119459866 GTATAACAACAATAGGAGACTGG + Intergenic
1196903042 X:120404744-120404766 GCATGACAATAATAGCTCAAAGG - Intergenic
1197042330 X:121953080-121953102 GTGTGACAATAATATCTCAAAGG - Intergenic
1197676180 X:129333252-129333274 ATATGACAATAATAGCACAAAGG - Intergenic
1197945784 X:131838880-131838902 ATATGACAATAATAGTATAAAGG - Intergenic
1198444557 X:136699207-136699229 TTATAATAATAATAACAAAAAGG + Intronic
1198475046 X:136987801-136987823 GTATGACAATGACAGCACAAAGG - Intergenic
1198738121 X:139810080-139810102 GTATGACAACAATAACACAAAGG + Intronic
1198755358 X:139976484-139976506 ATATGGCAGTAATAGCACAAAGG + Intergenic
1198855622 X:141012551-141012573 GCATTAAAATAAAAGCACAATGG + Intergenic
1198876511 X:141233645-141233667 GCATTAAAATAAAAGCACAACGG - Intergenic
1198907072 X:141574817-141574839 GCATTAAAATAAAAGCACAATGG - Intergenic
1198909719 X:141599591-141599613 GCATTAAAATAAAAGCACAATGG + Intronic
1198917367 X:141688555-141688577 GCATTAAAATAAAAGCACAATGG - Intronic
1199296793 X:146168535-146168557 TTATAACAATAAAAGTATAAAGG - Intergenic
1199663277 X:150074770-150074792 GTATGACAACAATAACATAAAGG + Intergenic
1200313362 X:155103152-155103174 GTATGACCACAATGGCACAAAGG - Intronic
1200518840 Y:4183807-4183829 GAATAATAATAATAACACATAGG + Intergenic
1201353026 Y:13067240-13067262 GCATTAAAATAAAAGCACAATGG + Intergenic
1201757672 Y:17504341-17504363 GTAACACAAGGATAGCACAATGG + Intergenic
1201843882 Y:18401641-18401663 GTAACACAAGGATAGCACAATGG - Intergenic
1201912603 Y:19147985-19148007 CTATAACAATAATTGCAGCAAGG + Intergenic