ID: 1142506960

View in Genome Browser
Species Human (GRCh38)
Location 17:370601-370623
Sequence AAGTCAGCCAAGTCCTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142506954_1142506960 28 Left 1142506954 17:370550-370572 CCAAATGGGATCAGAGACACATG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 183
1142506959_1142506960 -9 Left 1142506959 17:370587-370609 CCACTTGGAGCTTGAAGTCAGCC 0: 1
1: 1
2: 2
3: 15
4: 184
Right 1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 183
1142506958_1142506960 -8 Left 1142506958 17:370586-370608 CCCACTTGGAGCTTGAAGTCAGC 0: 1
1: 0
2: 1
3: 10
4: 192
Right 1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 183
1142506957_1142506960 -2 Left 1142506957 17:370580-370602 CCTAAACCCACTTGGAGCTTGAA 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142506960 Original CRISPR AAGTCAGCCAAGTCCTCCTG CGG Intronic
900033170 1:385875-385897 AAGTCAGCCATGCCCCTCTGAGG - Intergenic
900054009 1:615765-615787 AAGTCAGCCATGCCCCTCTGAGG - Intergenic
902609574 1:17589137-17589159 ATGTCAGTCAAGTCCCCCTTTGG + Intronic
903780910 1:25819730-25819752 AACGCAGCCAACTCCTCCCGGGG + Intronic
904841730 1:33376367-33376389 AAGTCTGCCCTGTCCTTCTGAGG - Intronic
905639483 1:39578806-39578828 AAGTCTTCCTAGACCTCCTGTGG + Intergenic
908788756 1:67760293-67760315 AACTCAGCCAACTCATCCAGAGG + Intronic
908833234 1:68202707-68202729 AATGCAGCCAAGACCACCTGTGG + Intronic
909609448 1:77537197-77537219 GACTCAGCCGAGTCCTCCTCAGG - Intronic
910934542 1:92476515-92476537 AAGTCAGGGGAGTCCTCCCGGGG - Intronic
911729606 1:101279235-101279257 AAGGCATTCAAGACCTCCTGAGG - Intergenic
912223553 1:107704959-107704981 AAGTCTGCCAGATGCTCCTGAGG - Exonic
912243760 1:107939479-107939501 CAGTCAGCCAAGTGATCATGAGG + Intronic
912525679 1:110281016-110281038 AAGTCACTCAGATCCTCCTGGGG + Intronic
914878877 1:151532541-151532563 AAGTCGGCTCAGTCCTCCAGAGG - Exonic
917218282 1:172700451-172700473 AGGTCAGTCAAGTCCTCTTCGGG - Intergenic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
918192366 1:182188099-182188121 AAAGCAGCAATGTCCTCCTGTGG + Intergenic
919849499 1:201663119-201663141 ACATCAGCCAATTCCCCCTGGGG + Intronic
921146168 1:212359317-212359339 AAGTCAGCATAGTTCTCCTTTGG + Intronic
922255530 1:223890026-223890048 AAGTCAGCCATGCCCCTCTGAGG - Intergenic
923219728 1:231882069-231882091 AGAAGAGCCAAGTCCTCCTGTGG - Intronic
924336733 1:242992895-242992917 AAGTCAGCCATGCCCCTCTGAGG - Intergenic
1062845907 10:704919-704941 AAGACAGCCAAGTCCTCATCTGG + Intergenic
1063502640 10:6569252-6569274 AAGAAAGCCAAGTCCTGATGTGG + Intronic
1063805304 10:9632417-9632439 CAGTCAACCAATTCATCCTGAGG + Intergenic
1064111416 10:12542574-12542596 AAGTCAGAGGAGTCCTCTTGAGG + Intronic
1066375811 10:34856988-34857010 TAGCCAGTCAGGTCCTCCTGAGG + Intergenic
1068594571 10:58888779-58888801 AACTGAGCCAAGTTCTTCTGAGG - Intergenic
1071552816 10:86580360-86580382 AAGTTTGCCAAGTCCTGTTGTGG + Intergenic
1072720486 10:97777864-97777886 CAGTCATCCCAGCCCTCCTGGGG - Intergenic
1075338272 10:121624557-121624579 AAGTCAGCCATGTCCTGTAGCGG + Intergenic
1075806288 10:125191239-125191261 AAGTCAGCCAAGTCTTCAGCTGG + Intergenic
1076144339 10:128105250-128105272 AAGCCAGCCAAGTCTTCTAGGGG + Exonic
1077079897 11:720591-720613 AAGTCTTCCAGCTCCTCCTGCGG - Exonic
1078195302 11:9132228-9132250 AAGTCAGCCAAGTCCTAGTTAGG + Intronic
1078471368 11:11589653-11589675 ATGACAGCCCAGCCCTCCTGGGG + Intronic
1080860767 11:36148446-36148468 AAGGCAGCAAAGTCCTCGTTAGG - Intronic
1081616982 11:44596968-44596990 AGGTCAGCAAAGGCTTCCTGGGG + Intronic
1083160029 11:60849034-60849056 AAGTGAGCCTTGGCCTCCTGTGG - Intronic
1085127909 11:74014322-74014344 AAGTCAGCCAGGTTTGCCTGTGG - Intronic
1086579101 11:88376253-88376275 TAGTCAGGGAAGCCCTCCTGGGG - Intergenic
1090158934 11:124470978-124471000 AAGACATCCAAGTCCTCCAGGGG + Intergenic
1091697312 12:2636628-2636650 GAGTCAGCCTAGCCCTCCTGGGG + Intronic
1092909615 12:13135462-13135484 AATGCAGCCAAGTGCCCCTGGGG + Intronic
1093205276 12:16241189-16241211 AAGTCAACCAAGTCTTCTTGAGG + Intronic
1094302664 12:28982953-28982975 AAGGCTGCCCGGTCCTCCTGTGG + Intergenic
1097822876 12:64145399-64145421 AAGACAGCAAAGTCCTGATGGGG - Exonic
1098343593 12:69476618-69476640 GAGTCACAGAAGTCCTCCTGGGG + Intronic
1100000414 12:89827877-89827899 AAGGCATGCAAGGCCTCCTGAGG + Intergenic
1100579184 12:95922474-95922496 AAGTCAATCACATCCTCCTGTGG - Intronic
1103719697 12:122966566-122966588 AAGCCCGCCCACTCCTCCTGAGG - Intronic
1105022177 12:132824154-132824176 AAGACAGGCACGTCCTGCTGCGG - Intronic
1107893302 13:44933085-44933107 AGGTCAGCAAAGGCTTCCTGAGG + Intergenic
1110425533 13:75362342-75362364 AAGTCAGCCAGGTCCTCTCCTGG + Exonic
1114083246 14:19219487-19219509 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1114635788 14:24186069-24186091 AAGTGTGCCTAGTCCCCCTGAGG - Intronic
1116681343 14:47973769-47973791 GAGTCACCCTACTCCTCCTGTGG + Intergenic
1120674716 14:87407738-87407760 AAGTCTGCAATGTCCACCTGGGG - Intergenic
1121027075 14:90624443-90624465 GAGTCAGCGAAGTCTTCCTGGGG - Intronic
1121217673 14:92261213-92261235 AACTCTGCCAAGACCTACTGAGG - Intergenic
1122167435 14:99838996-99839018 AAGTCAACAAAGACATCCTGTGG - Intronic
1202894868 14_GL000194v1_random:1257-1279 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1123905956 15:24921536-24921558 AGGTTCTCCAAGTCCTCCTGTGG + Intronic
1127039249 15:54955194-54955216 GAGTCAACAAAGTCCTTCTGTGG + Intergenic
1127766936 15:62195428-62195450 AATTCAGCCAACCCCACCTGTGG - Intergenic
1129701125 15:77769209-77769231 AAGGCAGCAAAGGCCTCCAGCGG + Intronic
1131377372 15:91936829-91936851 AACTCAGGAATGTCCTCCTGGGG - Intronic
1133090039 16:3397063-3397085 AAGACAGCCAAGACCTTCTGTGG + Intronic
1134751232 16:16627106-16627128 AAGACAATCAAGTCCTTCTGTGG + Intergenic
1134841440 16:17405148-17405170 AAGGGAGCCAACTCCTGCTGAGG + Intronic
1134994222 16:18726486-18726508 AAGACAATCAAGTCCTTCTGTGG - Intergenic
1137886620 16:52111310-52111332 AAGTCAGCCAGGTCTCCTTGAGG - Intergenic
1138121930 16:54407377-54407399 AAGTCAGCCAAGTTCACCTTAGG - Intergenic
1138145276 16:54603527-54603549 ACATCAGACAAGTCATCCTGAGG - Intergenic
1138223164 16:55270269-55270291 AAGTCACCGATGGCCTCCTGTGG + Intergenic
1138585991 16:57970847-57970869 AGGTCCCCCAAGTCCTCCTGGGG + Intronic
1139274357 16:65713753-65713775 AAGTAAGGCAAGTCCCTCTGAGG + Intergenic
1140101296 16:71919728-71919750 AAGTCAGGTAAGGCTTCCTGAGG - Intronic
1141566897 16:84908660-84908682 AAGACAGCCAGGTCCTGCTCTGG - Exonic
1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG + Intronic
1143290606 17:5825164-5825186 AAGTCATCTATGTCCTCCTTTGG - Intronic
1145788173 17:27607749-27607771 AACCCAGCCCAGTCCTGCTGGGG - Intronic
1145881276 17:28354433-28354455 ATGTCTGCCATCTCCTCCTGAGG + Intronic
1146563250 17:33889874-33889896 AAGCTAGCCCAGTCCTCATGAGG - Intronic
1151245611 17:72792297-72792319 AAGCCAGCCACATCCTCCTGCGG - Intronic
1151884209 17:76913959-76913981 AAATTAGCCAAGTGCGCCTGTGG + Intronic
1153674391 18:7443218-7443240 AAGTCAGGGAAGTTGTCCTGAGG + Intergenic
1156674598 18:39512615-39512637 AAGGCAGACAATTCCTCATGAGG + Intergenic
1157409310 18:47450443-47450465 ACTTCAGACAAGTCCTTCTGAGG + Intergenic
1157749784 18:50168055-50168077 AAATCAGCCAAGGCCCCATGTGG - Intronic
1158435673 18:57434478-57434500 AAGTGAGCAAACTTCTCCTGGGG - Intergenic
1158628744 18:59093763-59093785 GAGGCTGCCAAGTCCTCCTAAGG + Intergenic
1159864466 18:73687956-73687978 AAGTCAGCCAAATCCACATGGGG - Intergenic
1161044193 19:2126247-2126269 AAGTCAGCCAAAGCCTCACGGGG - Intronic
1161484886 19:4530160-4530182 GAGGCAGCCAGGTCCCCCTGTGG - Intronic
1163428987 19:17255590-17255612 AGGTCCGCCAGGGCCTCCTGTGG + Exonic
1163862054 19:19747807-19747829 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1164706260 19:30322581-30322603 AAGCCAGCCCAGTCTTCCTAAGG + Intronic
1166525688 19:43508127-43508149 GAGGCACCCAAGGCCTCCTGGGG - Intronic
1167739879 19:51318124-51318146 CAGTCAGAAAGGTCCTCCTGGGG + Intronic
928198714 2:29232951-29232973 ATGTCAGCAAAGTCCACCTTAGG + Intronic
935211605 2:100943678-100943700 ATGTCAATCATGTCCTCCTGTGG - Intronic
936227421 2:110669306-110669328 ATGTCAGCCACCTGCTCCTGTGG - Intronic
937956044 2:127422341-127422363 AGGCCAGCCAAGGCCTGCTGGGG - Intronic
938499155 2:131821521-131821543 GGGTGAGCCAGGTCCTCCTGAGG + Intergenic
938642065 2:133291664-133291686 AAGTAAGCCAGGTACCCCTGAGG + Intronic
941755802 2:169184451-169184473 CAGTCAGCCCAGACCTCCAGAGG - Intronic
1169723777 20:8706718-8706740 GAGTCAGACAAATCTTCCTGGGG + Intronic
1169911961 20:10654277-10654299 AAGTCATCCATGGCCTCTTGTGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173725049 20:45291473-45291495 AAGTCTTCCATGGCCTCCTGCGG + Intergenic
1176424595 21:6540393-6540415 AAATTAGCCAAGTGCGCCTGTGG + Intergenic
1176614565 21:9017244-9017266 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1179000241 21:37451006-37451028 ACGTAAGCCAAGACCTCCTTGGG - Intronic
1179489823 21:41734081-41734103 AAGCCAGACCAGACCTCCTGAGG - Intergenic
1179564178 21:42236054-42236076 AAGGGAGCCAGGGCCTCCTGGGG + Intronic
1179700088 21:43148708-43148730 AAATTAGCCAAGTGCGCCTGTGG + Intergenic
1180294727 22:10873780-10873802 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1180497533 22:15903194-15903216 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1181591019 22:23884643-23884665 AAGTGGGACAAGGCCTCCTGCGG - Exonic
1182407081 22:30144296-30144318 AACTGAGAGAAGTCCTCCTGTGG - Intronic
1182471789 22:30553408-30553430 AAGTTGGCCAATCCCTCCTGGGG - Intergenic
1183730327 22:39614837-39614859 AAGACAGCCACCTCCTCCTGGGG + Intronic
949200554 3:1373602-1373624 AGGTCCACCAGGTCCTCCTGAGG + Exonic
949644850 3:6081502-6081524 AAGACAGCCAAATCCTTCGGAGG + Intergenic
950120630 3:10480386-10480408 AATACAGCCAAACCCTCCTGGGG + Intronic
951690088 3:25386184-25386206 AAGTCAGAGAAGGCTTCCTGGGG + Intronic
953097259 3:39790464-39790486 AAGTCAGACAAGTCAGCCTGAGG - Intergenic
954068514 3:48125960-48125982 GAGTCAGGGAAGGCCTCCTGGGG + Intergenic
954153413 3:48671189-48671211 TAGTCAGAGAAGTCCTCTTGGGG - Intergenic
954307029 3:49733004-49733026 AACTCAGGCAAGTCATCCTCTGG + Intronic
955939275 3:64132518-64132540 AAATCAGACTAGTCCTTCTGTGG - Intronic
956492394 3:69787026-69787048 ATGTCTGCCAAATACTCCTGGGG + Intronic
958584936 3:96074867-96074889 AATTCAGCAAAGTCCCACTGGGG + Intergenic
966164036 3:176997246-176997268 AAATCCACCAAGTCCTCCTAAGG + Intergenic
966496777 3:180590330-180590352 AAATCAGCCAGGTGCACCTGTGG + Intergenic
966806235 3:183809985-183810007 AAGTGAGCCAGGGCCTCCTGTGG + Intronic
968915050 4:3493660-3493682 AAGTCAGCCCCTTCCTCCGGTGG - Exonic
971435662 4:26620246-26620268 AGGTCAGTGAAGTCCTCTTGGGG - Intronic
977146896 4:93453749-93453771 AAGTCAGAAAATTCCACCTGAGG - Intronic
978082050 4:104605775-104605797 GAGTCAGTCTAGTCCACCTGTGG - Intergenic
978189114 4:105893224-105893246 AAGTCAGAAAAGGCTTCCTGGGG + Intronic
979240397 4:118442415-118442437 AAGTCAGCCATGCCCCTCTGAGG + Intergenic
982851639 4:160324297-160324319 AAGTCCTCCAAGTACTCCTGCGG - Intergenic
983888383 4:173006016-173006038 AAGTCTGCCAAATCTGCCTGTGG - Intronic
984710165 4:182878205-182878227 AAATCAGCCAAGTCCTTATCAGG - Intergenic
985076072 4:186216275-186216297 AAGTCTGCCAAGTTCTATTGAGG + Intronic
986524118 5:8654597-8654619 GTGTCTGCCCAGTCCTCCTGTGG + Intergenic
987506947 5:18785264-18785286 AAGTCAGTCAATGCCTCCTCTGG - Intergenic
988523427 5:31965948-31965970 AAGTGGGGCAAGTCCTCCTTGGG + Intronic
989330396 5:40251647-40251669 AAGTTAGCCAAGTACCCCTTTGG + Intergenic
990575274 5:57117789-57117811 AAGGCAGCCACAGCCTCCTGAGG - Intergenic
997444733 5:133932947-133932969 AAGTCAACCACGTCCTCCCATGG + Intergenic
997718896 5:136062487-136062509 ATGTCTGCCAAGGCCACCTGAGG + Intronic
1000528280 5:162385858-162385880 AAGTAAGCCAATTTCTCCTAGGG + Intergenic
1002740650 5:181432993-181433015 AAGTCAGCCATGCCCCTCTGAGG + Intergenic
1003552779 6:7113669-7113691 AATGCTGCTAAGTCCTCCTGAGG - Intronic
1004132796 6:12936863-12936885 AAGTCATCCCAGGCCTCCAGTGG - Intronic
1004832379 6:19490824-19490846 ATTTCAGCCCTGTCCTCCTGAGG - Intergenic
1006096909 6:31661838-31661860 TAGTCAGGGAACTCCTCCTGGGG + Exonic
1006778752 6:36617347-36617369 GAGGCAGACAAGTCCTGCTGTGG - Intergenic
1007723484 6:43900195-43900217 GAGTCTACCAAGTGCTCCTGGGG + Intergenic
1011685071 6:89817506-89817528 AAGTCAGAAAAGTCTTCCTGGGG + Intronic
1012259000 6:97065890-97065912 AGGTCAGCCATGTTCACCTGAGG + Intronic
1013719097 6:113001083-113001105 AAATCTGCCAGGACCTCCTGTGG - Intergenic
1015754509 6:136594024-136594046 AAGTCAACCAATTCATCCTGGGG - Intronic
1018849033 6:167574669-167574691 AAGTCTCCCAGGTCTTCCTGAGG - Intergenic
1019245760 6:170708589-170708611 AAGTCAGCCATGCCCCTCTGAGG + Intergenic
1019275424 7:173168-173190 AGGTCAGCCCAGTCCAGCTGAGG + Intergenic
1019649317 7:2148225-2148247 AGCTCAGCCTTGTCCTCCTGTGG - Intronic
1020068150 7:5205558-5205580 CAGTGAGCCACCTCCTCCTGTGG - Intronic
1022911466 7:34902917-34902939 AAGTCTGCCAAGTCCATCTTAGG - Intergenic
1023178061 7:37452859-37452881 AAGTCAGGAAAAGCCTCCTGGGG + Intergenic
1026512721 7:71040374-71040396 AAGCCAGCCTATTCCTCATGTGG - Intergenic
1028402807 7:90442605-90442627 AACTCTCCCAACTCCTCCTGAGG - Intronic
1030313048 7:108087019-108087041 AAGTCAGAGAAGGCCTCGTGGGG + Intronic
1031535645 7:122930066-122930088 AAGTCACCCAATTCCTCCTTAGG + Intergenic
1031620006 7:123924424-123924446 AAGTCAGCCAATTTGTCCTCAGG + Intergenic
1032083281 7:128870462-128870484 AAGAGAGCCGAGGCCTCCTGGGG - Intronic
1035502364 8:99609-99631 AAGTCAGCCATGCCCCTCTGAGG - Intergenic
1040715315 8:50244590-50244612 AAGTAACCAGAGTCCTCCTGAGG - Intronic
1041260994 8:56020446-56020468 AACTCAGCCCTGGCCTCCTGCGG + Intergenic
1042564684 8:70100155-70100177 AGGGAAGCCAAGGCCTCCTGAGG - Intergenic
1048811924 8:138296233-138296255 AAGCCAGCCGAGGCCTTCTGAGG - Intronic
1050401736 9:5263037-5263059 AAGTCAGCCAATTGGTGCTGCGG + Intergenic
1053647624 9:40132326-40132348 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1053758107 9:41331517-41331539 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1054328601 9:63730280-63730302 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1054536955 9:66243844-66243866 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1058759717 9:108119251-108119273 CAGTCAACGAAGGCCTCCTGGGG + Intergenic
1058824071 9:108759307-108759329 AAGAGAGCCAGCTCCTCCTGGGG - Intergenic
1059150245 9:111943002-111943024 CAGTCAGAAAAGCCCTCCTGGGG - Intergenic
1059452309 9:114378039-114378061 AACTCATCCATGTCTTCCTGTGG + Intronic
1062729051 9:138098274-138098296 AAGTAAGCCCAGTCGACCTGGGG + Intronic
1203605958 Un_KI270748v1:57800-57822 AAGTCAGCCATGCCCCTCTGAGG + Intergenic
1185516939 X:707113-707135 AAGACAGACAATTCCTCCTTAGG - Intergenic
1189236358 X:39490195-39490217 AGGTCAGCCAAGGCCACCTGGGG + Intergenic
1195534958 X:106000563-106000585 AAGTCAATCACATCCTCCTGTGG - Intergenic
1197093593 X:122568593-122568615 AAGTCAGACAAATCTTCCTTTGG - Intergenic
1201687967 Y:16728375-16728397 ATCTCTGCCAAGTGCTCCTGTGG - Intergenic
1202388125 Y:24344237-24344259 AAGTCAGCCATGCCCCTCTGAGG + Intergenic
1202482662 Y:25325891-25325913 AAGTCAGCCATGCCCCTCTGAGG - Intergenic