ID: 1142508444

View in Genome Browser
Species Human (GRCh38)
Location 17:380527-380549
Sequence GCTTCCGGGAGGGATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5749
Summary {0: 4, 1: 23, 2: 17, 3: 87, 4: 5618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508444_1142508453 -5 Left 1142508444 17:380527-380549 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508444_1142508461 17 Left 1142508444 17:380527-380549 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508444 Original CRISPR GCTTCCGGGAGGGATGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr