ID: 1142508453

View in Genome Browser
Species Human (GRCh38)
Location 17:380545-380567
Sequence GAAGCCCTCCTCATCCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 14, 1: 14, 2: 15, 3: 46, 4: 381}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508434_1142508453 24 Left 1142508434 17:380498-380520 CCGGAAGCCCCCCTCATGCTTCC 0: 3
1: 7
2: 8
3: 62
4: 338
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508441_1142508453 3 Left 1142508441 17:380519-380541 CCCGGAAGCCCCCCTCATCCCTC 0: 3
1: 18
2: 22
3: 71
4: 559
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508442_1142508453 2 Left 1142508442 17:380520-380542 CCGGAAGCCCCCCTCATCCCTCC 0: 3
1: 22
2: 19
3: 71
4: 547
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508446_1142508453 -7 Left 1142508446 17:380529-380551 CCCCTCATCCCTCCCGGAAGCCC 0: 4
1: 6
2: 6
3: 31
4: 326
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508437_1142508453 16 Left 1142508437 17:380506-380528 CCCCCTCATGCTTCCCGGAAGCC 0: 7
1: 6
2: 20
3: 35
4: 265
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508439_1142508453 14 Left 1142508439 17:380508-380530 CCCTCATGCTTCCCGGAAGCCCC 0: 3
1: 1
2: 1
3: 13
4: 183
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508440_1142508453 13 Left 1142508440 17:380509-380531 CCTCATGCTTCCCGGAAGCCCCC 0: 3
1: 6
2: 17
3: 36
4: 236
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508436_1142508453 17 Left 1142508436 17:380505-380527 CCCCCCTCATGCTTCCCGGAAGC 0: 3
1: 5
2: 11
3: 37
4: 230
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508444_1142508453 -5 Left 1142508444 17:380527-380549 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508448_1142508453 -9 Left 1142508448 17:380531-380553 CCTCATCCCTCCCGGAAGCCCTC 0: 19
1: 17
2: 11
3: 49
4: 371
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508431_1142508453 29 Left 1142508431 17:380493-380515 CCCTCCCGGAAGCCCCCCTCATG 0: 4
1: 9
2: 13
3: 21
4: 218
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508447_1142508453 -8 Left 1142508447 17:380530-380552 CCCTCATCCCTCCCGGAAGCCCT 0: 4
1: 5
2: 4
3: 38
4: 281
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508438_1142508453 15 Left 1142508438 17:380507-380529 CCCCTCATGCTTCCCGGAAGCCC 0: 3
1: 1
2: 4
3: 16
4: 156
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508432_1142508453 28 Left 1142508432 17:380494-380516 CCTCCCGGAAGCCCCCCTCATGC 0: 4
1: 9
2: 14
3: 29
4: 191
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508445_1142508453 -6 Left 1142508445 17:380528-380550 CCCCCTCATCCCTCCCGGAAGCC 0: 18
1: 17
2: 12
3: 46
4: 744
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508433_1142508453 25 Left 1142508433 17:380497-380519 CCCGGAAGCCCCCCTCATGCTTC 0: 3
1: 8
2: 14
3: 127
4: 512
Right 1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508453 Original CRISPR GAAGCCCTCCTCATCCCTCC CGG Intronic
900432201 1:2607699-2607721 GAAGCCCTGCTGCTCCCTGCAGG - Intronic
900715638 1:4141773-4141795 GAAGCACTCCTCATTCCACTGGG - Intergenic
901393379 1:8963026-8963048 GAAGCCCTCGTCATACCACTTGG + Intronic
902407274 1:16191639-16191661 CTACCCCTCCTCATTCCTCCTGG - Intergenic
903268066 1:22170408-22170430 GAAGCCCTTCTCAACCTGCCAGG - Intergenic
903669147 1:25025274-25025296 CATGCCCTCCTCCTCCCTCCAGG + Intergenic
903673968 1:25052998-25053020 AATGCCCTTCTCCTCCCTCCTGG + Intergenic
904029896 1:27527587-27527609 GACGTGCTCCTCATCACTCCAGG - Intergenic
904123931 1:28222933-28222955 GATGCTTTCCTCATCCCTCTTGG - Intronic
904271089 1:29350515-29350537 GGAGCCCCCCTCATCCATACTGG + Intergenic
904306971 1:29596205-29596227 GAAGTCCTCCTCATCCCTGTGGG + Intergenic
904783412 1:32967384-32967406 GTAGCTCTCCTCAACTCTCCTGG + Intergenic
904822436 1:33254995-33255017 GAAGCCCTCTCCACCTCTCCAGG + Intergenic
904829996 1:33300129-33300151 GAAGCCCCCTACATCCCCCCGGG + Exonic
904944382 1:34188717-34188739 CCAGCCCTCCTCCACCCTCCGGG - Intronic
904965687 1:34370833-34370855 GAAGTCCTACTCATCCTTCAAGG + Intergenic
906399978 1:45497694-45497716 GACCCCCTCCACCTCCCTCCCGG - Intronic
906706312 1:47897406-47897428 GAACTCCTCCTCATCCATCAGGG - Intronic
907250398 1:53134294-53134316 GAAGCCATCCTCTACCCTCCTGG + Intronic
908155871 1:61352524-61352546 AAAGACCTCCTCATTGCTCCTGG - Exonic
908541762 1:65128995-65129017 GAGGGCCTGCTCATCCCTCATGG - Intergenic
908661545 1:66442137-66442159 GAATGCCTCCTCATCCCTGGAGG + Intergenic
908739127 1:67308602-67308624 GAGGCCCTCCTCATCTCCCTAGG + Intronic
908798233 1:67852729-67852751 CAAGCCATCCTCATCTCTCCCGG - Intergenic
910280955 1:85501285-85501307 GTAGCCCTCCTCCTACCGCCTGG + Intronic
910592117 1:88937145-88937167 GAAGCCCTCCTTGCCCCTCTTGG - Intronic
911102367 1:94104745-94104767 AGAGCCCTCCTCCTCCCTTCGGG - Intronic
911542015 1:99168098-99168120 GAAGCCATCATCACCTCTCCTGG - Intergenic
912452208 1:109774136-109774158 CCAGCCCACCTCATCCCTCTGGG + Intronic
913557095 1:119978448-119978470 GAACTCCACCTCACCCCTCCAGG + Intronic
916151843 1:161800772-161800794 GAATGCCTCCTCATCCCTAGAGG - Intronic
916608236 1:166363923-166363945 GATGACCTCCTCACCCCACCTGG + Intergenic
916629044 1:166592179-166592201 CAAGCCCTCCACATCCCTCGGGG + Intergenic
920299934 1:204982486-204982508 GGAGGCCTCCTGATCCCTCAAGG - Intronic
920923166 1:210315116-210315138 GAAGGACTCCTAATCCCTTCTGG - Intergenic
921223212 1:212989464-212989486 GAAGACCTGCTGATCACTCCTGG - Exonic
921889433 1:220339075-220339097 GCAGCCATCCTCCTCCTTCCTGG + Intergenic
922102703 1:222488333-222488355 GAACCCCCCCACCTCCCTCCCGG - Intergenic
923344819 1:233041512-233041534 GAAGGCCTCCTCCTCCCTACAGG + Intronic
923437387 1:233980154-233980176 AAAGTCCTCCTCATCCTTCAAGG - Intronic
923856406 1:237849696-237849718 GATGCCCTCCTCACTCCTCTGGG + Intergenic
1063802963 10:9602475-9602497 TAATCCCTGCTCATCTCTCCAGG - Intergenic
1063818375 10:9804828-9804850 GAAGCCATCTTCATCTGTCCTGG - Intergenic
1064258734 10:13767703-13767725 GAAGCCACCCTCAAGCCTCCGGG - Intronic
1065360528 10:24885057-24885079 GGAGCCAGGCTCATCCCTCCAGG - Intronic
1065882388 10:30047778-30047800 GAAGACCTCCTGATCTCTCATGG - Exonic
1067551394 10:47238806-47238828 CAAGCCCTCTTCATGCCTCTGGG - Intergenic
1068668086 10:59697095-59697117 GAACCCCCCCACCTCCCTCCCGG - Intronic
1069514213 10:69064923-69064945 GATGCCCTCCCCATCCCTAAGGG + Intergenic
1069949566 10:72009665-72009687 GAAGCCCGCCTTCTCCCTCGTGG + Exonic
1070622715 10:78026070-78026092 TAAGGCCCCCTCACCCCTCCTGG - Intronic
1070809018 10:79288253-79288275 GCAGCCCTCCGCCTCCCTCTGGG + Intronic
1071835925 10:89416643-89416665 GCAGCCCTCCTCATCCTCCTTGG + Intronic
1072530933 10:96318281-96318303 GAAGCTCTCCTCTTTCCTCAAGG - Intronic
1074437211 10:113444353-113444375 TAAGCCCTCTTCTTCCTTCCTGG - Intergenic
1074546470 10:114404995-114405017 GCTGCCCTCCTCGCCCCTCCAGG - Intergenic
1075001972 10:118805317-118805339 GAAACCCTCATCCTGCCTCCAGG - Intergenic
1075097738 10:119483638-119483660 GCAGCCCTGGTCAGCCCTCCTGG - Intergenic
1075258725 10:120945040-120945062 GCAGCCCTCCCAGTCCCTCCTGG - Intergenic
1076061355 10:127416618-127416640 GATGCCCTCCTCGTGCCACCTGG + Intronic
1076067853 10:127463491-127463513 GTAGCTCTCCTCCTCCTTCCAGG + Intergenic
1076484770 10:130808876-130808898 CAGGCCCTCCACAGCCCTCCAGG + Intergenic
1077078099 11:710236-710258 GAAGCCCCCTCCCTCCCTCCAGG - Intronic
1077369020 11:2172900-2172922 GGAGGCCTCCCCATCCCTCTGGG + Intergenic
1077411199 11:2404754-2404776 GAACCGCTCCTTGTCCCTCCTGG - Exonic
1077602078 11:3581053-3581075 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1081872098 11:46387897-46387919 GCAGCCCTTCTCTTCCCTCTGGG - Intergenic
1081975780 11:47233842-47233864 CATGCACTCCTCATCCCTGCGGG - Intronic
1082828469 11:57598117-57598139 AATTCCCTCCTCCTCCCTCCTGG - Intronic
1083019319 11:59490163-59490185 GGATCCCTCCTCCTCCCTGCTGG + Intergenic
1083066598 11:59930387-59930409 GCAGTCCTCCTAATACCTCCAGG + Intergenic
1083267351 11:61552862-61552884 GGAAGACTCCTCATCCCTCCAGG + Intronic
1083325031 11:61868927-61868949 GGAGCCCTCCCCAGCCCTGCTGG - Intergenic
1084814769 11:71639611-71639633 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
1084901533 11:72313634-72313656 GTTGCCCTCCTCAGTCCTCCTGG - Intronic
1086104512 11:83133494-83133516 GAAACCCCCCACCTCCCTCCCGG - Intergenic
1087969092 11:104457151-104457173 GAATGCCTCCTCATCCCTGCAGG + Intergenic
1088379023 11:109173021-109173043 GAAGCACTCCTCATGCCCCCAGG - Intergenic
1090564836 11:127978073-127978095 GATGCCCTCCTCACTACTCCTGG - Intergenic
1090680977 11:129057220-129057242 GAAGCCCTCCTGCACCTTCCAGG + Intronic
1091458498 12:626266-626288 GAAGCCCTCCTAATATCTGCTGG + Intronic
1091648355 12:2290693-2290715 GAATCCCTCCTGCTGCCTCCAGG + Intronic
1091857921 12:3753835-3753857 GAAATCCTACTCATCCATCCAGG + Intronic
1092241497 12:6838978-6839000 GAACCTGCCCTCATCCCTCCAGG + Exonic
1092428220 12:8390405-8390427 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1092429306 12:8396558-8396580 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1094694480 12:32804218-32804240 GAATGCCTCCTCATCCCTAAAGG - Intronic
1094707037 12:32924111-32924133 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1095962564 12:47844644-47844666 GCAGCCCTCCTCACCCCGTCTGG - Exonic
1096021985 12:48332466-48332488 GACCCCCTCCACCTCCCTCCCGG + Intergenic
1096178766 12:49539380-49539402 GCTGCCCGCCCCATCCCTCCGGG - Exonic
1096441246 12:51645318-51645340 GAACCCCCCCACCTCCCTCCTGG - Intronic
1096489067 12:52003764-52003786 GTCCCCCTCCTCCTCCCTCCAGG - Intergenic
1097127964 12:56789457-56789479 TGAGCCCTCCTCCTCCCTCCCGG + Intergenic
1097145977 12:56939588-56939610 GATGCTCTCCCCATGCCTCCAGG + Intergenic
1098407372 12:70140588-70140610 GAAGGCCACCTCTTCCTTCCGGG - Intergenic
1100433951 12:94554538-94554560 GAAGCCCTCTTCCACCCTTCTGG - Intergenic
1101408780 12:104452542-104452564 GTACCCCTCCTCACCCCACCAGG - Intergenic
1101579798 12:106032482-106032504 TAAGCTCTCCTCATCCCTTGAGG + Intergenic
1101842734 12:108339768-108339790 GAAGCCTTCCCCAACCCTCGGGG + Intergenic
1102556492 12:113730052-113730074 GAAGTCATCGTCATCCTTCCAGG + Intergenic
1103885078 12:124194406-124194428 GAAGCCCCCCGCACCCCGCCCGG - Intronic
1104814324 12:131637236-131637258 GCAGCCCTCCCCACCCCTCCTGG - Intergenic
1107400929 13:40068342-40068364 GAAGCCATCCTGACCTCTCCAGG + Intergenic
1108370407 13:49762187-49762209 GCTGCCCTCCACCTCCCTCCCGG - Intronic
1109334370 13:60974394-60974416 AAAGCACTCCTCTTACCTCCAGG + Intergenic
1109539532 13:63755707-63755729 GAATGTCTCCTCATCCCTACAGG + Intergenic
1109544312 13:63824127-63824149 GAATGTCTCCTCATCCCTACAGG - Intergenic
1110228164 13:73141411-73141433 GAAACCCTGCTCAGCCTTCCAGG + Intergenic
1110761320 13:79233696-79233718 GAAGGTCTCCTCATCCCTAAAGG + Intergenic
1111901119 13:94200894-94200916 GAAGCCCTGGTCATCCCACTTGG - Intronic
1112390784 13:98982088-98982110 GAAGCCTTCCTCTTCCCCACAGG - Intronic
1113359275 13:109613949-109613971 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1115641008 14:35335619-35335641 GAAGGCCTCCCCACCCCTCTGGG - Intergenic
1117438730 14:55741373-55741395 GGAGCCCTCCTCCTTCCCCCAGG - Intergenic
1119532646 14:75373768-75373790 GAAGCCCTCTGCATCCATCCAGG - Intergenic
1122450126 14:101799139-101799161 GCAGGCTTCCTCTTCCCTCCCGG - Intronic
1122506196 14:102233320-102233342 GCAGCCCTCCACAGCCCTGCTGG - Intronic
1122546878 14:102527954-102527976 CAAGCCCTCCCCATCCCACAGGG - Intergenic
1122776185 14:104117882-104117904 GGAGCGCTCCTCAACCCTACGGG - Intergenic
1122826887 14:104374896-104374918 AAAGGCCTCTTCACCCCTCCTGG - Intergenic
1123031867 14:105455810-105455832 GAAGACCCCCACATCTCTCCAGG + Intronic
1123578900 15:21698522-21698544 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1123615527 15:22141004-22141026 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1124337660 15:28869312-28869334 GAAGAGCTGCTCCTCCCTCCTGG - Intergenic
1124560691 15:30770856-30770878 AGTTCCCTCCTCATCCCTCCAGG - Intronic
1125440702 15:39700234-39700256 GAAACCCTACTCATTCCTCAAGG + Intronic
1127303136 15:57677186-57677208 CTAACCCTCCTCATCCCCCCGGG - Intronic
1128317076 15:66667681-66667703 GAAGTCCCTCTCAGCCCTCCAGG - Intronic
1128716771 15:69914311-69914333 GCAGCCCTCCTCTTACCTCCTGG + Intergenic
1129523452 15:76199881-76199903 AAAGCCCCTCACATCCCTCCTGG - Intronic
1129889913 15:79065264-79065286 GAAGCCCTCCTGATCTCCCTGGG - Intronic
1130814289 15:87414630-87414652 AAAGCCATCTTCATCCTTCCTGG + Intergenic
1131095919 15:89654443-89654465 CCAAGCCTCCTCATCCCTCCCGG + Intronic
1202987770 15_KI270727v1_random:432767-432789 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1132466921 16:81776-81798 GAAGCCCTCCTGAATGCTCCCGG + Intronic
1132982395 16:2745217-2745239 CAAGCCCTCCTCAGCCCTGCAGG + Intergenic
1133071001 16:3246769-3246791 CAAGCCCTGCTGATCCCTTCTGG + Intronic
1133370003 16:5239948-5239970 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
1134269725 16:12723026-12723048 GAATCCTTCCTCATCAGTCCAGG + Intronic
1134275684 16:12774134-12774156 GAATGCCTCCTCATCCCTGGCGG - Intronic
1135490409 16:22904598-22904620 GAAGCCCTCCTTAACCTGCCTGG - Intronic
1135493984 16:22935676-22935698 GCAGCCCTCTTCATTCCTCCAGG + Intergenic
1136296721 16:29308139-29308161 AGAGCCCACGTCATCCCTCCTGG + Intergenic
1137597497 16:49734513-49734535 GAAGCCCTCCCCAGCCCTGGAGG - Intronic
1137705484 16:50532932-50532954 CAAGTCCTCATCATCCCTTCTGG - Intergenic
1138225459 16:55290792-55290814 CAAGTCCTCCCCATCCTTCCAGG + Intergenic
1138330917 16:56214707-56214729 GAAGTCCTCCTCTGCCATCCTGG + Intronic
1141569435 16:84925363-84925385 GCAGCCATTCTCACCCCTCCGGG - Intergenic
1141608197 16:85167581-85167603 TCAGCCCTCCTCCTCTCTCCAGG + Intergenic
1141755596 16:85988677-85988699 GGAACCCTCCTCATGCCCCCTGG - Intergenic
1142058342 16:88014451-88014473 AGAGCCCACGTCATCCCTCCTGG + Intronic
1142225899 16:88877547-88877569 GAAGCCCTCCTGAGCTCACCAGG + Intronic
1142508378 17:380325-380347 GAAGCCCTTCTCATCCCTCCCGG + Intronic
1142508385 17:380347-380369 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508391 17:380369-380391 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508399 17:380391-380413 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508405 17:380413-380435 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508427 17:380479-380501 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508435 17:380501-380523 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508443 17:380523-380545 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508469 17:380589-380611 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508479 17:380611-380633 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508487 17:380633-380655 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508494 17:380655-380677 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508504 17:380677-380699 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508517 17:380718-380740 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508523 17:380740-380762 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508531 17:380762-380784 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508539 17:380784-380806 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508546 17:380806-380828 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508554 17:380829-380851 AAGCCCCCCCTCATCCCTCCCGG + Intronic
1142508565 17:380851-380873 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508573 17:380873-380895 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508583 17:380895-380917 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508591 17:380917-380939 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508609 17:380964-380986 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508615 17:380986-381008 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508629 17:381027-381049 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508635 17:381049-381071 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508643 17:381071-381093 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508651 17:381093-381115 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508658 17:381115-381137 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508666 17:381137-381159 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508682 17:381181-381203 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG + Intronic
1142508719 17:381273-381295 GAAGCCCCCCTCATGCCTCCCGG + Intronic
1142508728 17:381295-381317 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508738 17:381317-381339 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508755 17:381361-381383 GAAGCCCTGCTCATCCCTCCCGG + Intronic
1142508777 17:381410-381432 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508783 17:381432-381454 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508791 17:381454-381476 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508799 17:381476-381498 GAAGCCGTCCTCATGCCTCCCGG + Intronic
1142508810 17:381520-381542 GAAGCCCTCCTCATACCTCCCGG + Intronic
1142597092 17:1035239-1035261 GGACCCCTCCTCATCTCTGCTGG + Intronic
1142881542 17:2885810-2885832 GAGGCCACCCTCATGCCTCCTGG + Intronic
1144003000 17:11072975-11072997 ACATCCCTCCTCCTCCCTCCTGG + Intergenic
1144207282 17:12988109-12988131 GAAGCCCTCATCAGCATTCCTGG - Intronic
1144559770 17:16312139-16312161 GCAGCCCCCCACCTCCCTCCCGG + Intronic
1145404773 17:22578472-22578494 GAAGCCTTCCTCTACTCTCCAGG - Intergenic
1146663474 17:34681116-34681138 CAGGCCCTCCCCAACCCTCCAGG + Intergenic
1146846372 17:36183921-36183943 GAAGACCCCCCCATCTCTCCAGG + Intronic
1147137690 17:38443665-38443687 CCAGCCCTGCCCATCCCTCCCGG - Intronic
1147139881 17:38454781-38454803 GGAGCCCTGCTCCTCCCCCCGGG - Intronic
1147169226 17:38608480-38608502 GTATCCCTTCTCACCCCTCCAGG - Intergenic
1148337623 17:46851961-46851983 GCCGCTCTCCTCATCCCGCCGGG + Intronic
1150449155 17:65251396-65251418 GAACCCCTCCCACTCCCTCCTGG - Intergenic
1151652791 17:75480526-75480548 CAAGACCTCCTCACCCCGCCTGG - Intronic
1151776157 17:76204282-76204304 GAAATCCTACTTATCCCTCCAGG + Intronic
1152077363 17:78168102-78168124 GACCCCCTCCCCATTCCTCCTGG - Intergenic
1152319381 17:79599623-79599645 CAAGCACTCCTCAGCTCTCCCGG - Intergenic
1154195622 18:12264313-12264335 GATGCCCTCGTCATCGCTACCGG + Exonic
1155863337 18:30932316-30932338 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1156375074 18:36506879-36506901 GAATGCCTCCTCATCCCTAGAGG + Intronic
1156437754 18:37151974-37151996 GAAGCTCTCTTCATCCCTCTGGG - Intronic
1156456092 18:37295208-37295230 GCAGCCCTCCTCATTCATTCGGG - Intronic
1156460298 18:37317994-37318016 GAAGCCTTCCTCCTGCCCCCTGG + Intronic
1156473725 18:37393196-37393218 GATGCCCTCCTGCTACCTCCTGG + Intronic
1156513088 18:37657884-37657906 AAAGCTCTGCTCTTCCCTCCAGG + Intergenic
1157592521 18:48844183-48844205 TAGGCCCTCCCCATCCCTTCTGG - Intronic
1159694798 18:71542487-71542509 GAATGCCTCCTCATCCCTACAGG + Intergenic
1160231834 18:77054559-77054581 CAAGCCCTCCTCTGCCCACCTGG - Intronic
1160389823 18:78521652-78521674 GAAGAGCTCCTCCTCCCTCCAGG + Intergenic
1160498883 18:79392659-79392681 GAAGCCCTTAGCAACCCTCCAGG + Intergenic
1161303726 19:3555894-3555916 GCGGCCCTCCTCTCCCCTCCCGG - Intronic
1161567740 19:5012923-5012945 CAACCCCTCGTCTTCCCTCCTGG + Intronic
1162915567 19:13872903-13872925 GAAGCCCCCCTCCCGCCTCCCGG - Intronic
1163183602 19:15621054-15621076 GAAGCCCACCTTATCACCCCAGG - Intronic
1163696383 19:18765598-18765620 GAAGGCCTCCTGTTCCTTCCAGG + Intronic
1163791437 19:19308673-19308695 GAAGACCTGCTCACCCCTGCTGG + Intronic
1163831336 19:19548517-19548539 GAATCCCACCCCCTCCCTCCTGG + Intergenic
1164244774 19:23419604-23419626 GGAGCCCCCCACCTCCCTCCCGG - Intergenic
1164301310 19:23964496-23964518 GGAGCCCCCCACCTCCCTCCCGG - Intergenic
1164692622 19:30222548-30222570 GACGCCCTCTGCATGCCTCCAGG - Intergenic
1164722616 19:30443736-30443758 GAAGCCCCCCGCATCCCTGGAGG + Exonic
1165069597 19:33247878-33247900 GAAGCCATCCTCTTCGCTGCTGG - Intergenic
1165421608 19:35724837-35724859 AAGGCCCGCCTCATCCCTCAGGG - Intronic
1165429824 19:35766309-35766331 CAAGCCATCATCATCCCACCTGG - Intronic
1166720524 19:44993396-44993418 GAAAGCCACCTCATCCCTGCTGG - Intergenic
1166794250 19:45416805-45416827 GAAGCCCTCATCTCACCTCCAGG + Exonic
926190877 2:10726733-10726755 GGAGCCCGCCTGATCCCTCCTGG + Intronic
926315098 2:11703948-11703970 GAAGCCATCCTGACCCTTCCAGG - Intronic
926583214 2:14654958-14654980 GGGGCACACCTCATCCCTCCAGG - Intergenic
926667484 2:15541791-15541813 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667509 2:15541841-15541863 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667534 2:15541891-15541913 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667583 2:15541990-15542012 GAACCCCCCCACCTCCCTCCCGG - Intronic
926723710 2:15981785-15981807 GAAATCCTACTCTTCCCTCCAGG + Intergenic
926821438 2:16855347-16855369 CCAGCCCTCCCCACCCCTCCGGG + Intergenic
927103200 2:19803568-19803590 GAAGCCTTCCTTGTACCTCCAGG - Intergenic
927203990 2:20595480-20595502 GAAGCCCTCCTGCTGCCTCAGGG - Intronic
927287765 2:21374556-21374578 TAAGCACTCCTCATCTCTCCAGG - Intergenic
927462131 2:23308325-23308347 GAAACCTCCCTCATCCCTCCAGG - Intergenic
927897714 2:26795330-26795352 TGACCCCTCCTCCTCCCTCCCGG + Intronic
928182742 2:29080916-29080938 TAAGCCTCCCTCAGCCCTCCTGG + Intergenic
928434846 2:31248340-31248362 GAAGCCCTCCCTCTGCCTCCAGG + Intronic
929177849 2:38999991-39000013 GCAGCCCTCATCATCTCACCAGG - Intronic
929922127 2:46180170-46180192 GGAACCCTCCTCATCCCTCCAGG - Intronic
932592882 2:73077721-73077743 GAAGCCTTCCTGATTCCTCCAGG + Intronic
933179191 2:79210903-79210925 GAAGCCCTCCCTCTCCCGCCTGG + Intronic
933289325 2:80420368-80420390 GGATCCATCCTCATCCCTCCTGG - Intronic
933791442 2:85887046-85887068 GACACCCACCTCAGCCCTCCAGG + Intronic
934763252 2:96867748-96867770 GACTTCCTCCTCACCCCTCCAGG + Intronic
935794122 2:106624260-106624282 TATGCCCACATCATCCCTCCAGG - Intergenic
937168633 2:119844154-119844176 GACGCCCCCCACCTCCCTCCCGG + Intronic
937990507 2:127659486-127659508 GAAGCCCTGCCCAGCCCTCGAGG - Intronic
938595289 2:132782660-132782682 GAGGGACTCCTCATCCCACCTGG - Exonic
938698248 2:133853995-133854017 GAAACCTTCTTCATGCCTCCAGG - Intergenic
938722163 2:134076571-134076593 GAAGCCCTCCTTATACCCACAGG - Intergenic
939041631 2:137196239-137196261 GAATGCCTCCTCATCCCTAGAGG + Intronic
941827454 2:169916466-169916488 GACACCCTCCTCATCCTGCCTGG + Intronic
943732629 2:191319040-191319062 GCAGCCCTCCTCTTCCTTACTGG - Intronic
944360306 2:198846966-198846988 GAAACTCTCCTCTTCCCTTCTGG - Intergenic
944822192 2:203441883-203441905 AAAGCCATCCTCATTCCACCAGG - Exonic
945560923 2:211338946-211338968 AAATACCTCCTCATGCCTCCTGG + Intergenic
945835794 2:214835496-214835518 GACCCCCTCCACCTCCCTCCCGG + Intergenic
946860677 2:223997735-223997757 AATGTCCTCCTCATCCTTCCAGG - Intronic
947549624 2:231037362-231037384 AAAGCCCTCTTCCTCCCACCCGG + Intergenic
947742533 2:232491170-232491192 GAACCCCTCCTCACCCCTCACGG + Intergenic
947800021 2:232923362-232923384 GAAGCCCTCCTCTGCCAACCGGG - Intronic
948683487 2:239654676-239654698 GAAACCCTCCACATCCCTAGAGG - Intergenic
1168762688 20:360238-360260 CATGCCCTCCCCATCCCTACTGG + Intergenic
1170248204 20:14247853-14247875 GAATTCCTCCTCATCCCTATAGG + Intronic
1170645772 20:18194743-18194765 GGAGCCCCCCACCTCCCTCCCGG - Intergenic
1170763632 20:19272940-19272962 GAAGCCTTCCTGGACCCTCCAGG - Intronic
1170940859 20:20846782-20846804 AAAGCCCTCCTCCTCCTTCAGGG + Intergenic
1171374763 20:24685106-24685128 GCAGGACTCCTCATCCCCCCAGG - Intergenic
1172103032 20:32497194-32497216 GAAACCCTCCTGCACCCTCCAGG + Intronic
1172160756 20:32866507-32866529 GAAGCCTTCCCCACCCCTCCAGG - Intronic
1172426604 20:34860077-34860099 GGACCCCTCCTCATTCCCCCAGG - Intronic
1172592260 20:36126178-36126200 GAGGCCTTCCTCATCCCTAATGG - Intronic
1172801090 20:37576768-37576790 GAAGCCCTCCCTGACCCTCCAGG + Intergenic
1174058726 20:47817343-47817365 GATGACCTCAGCATCCCTCCTGG + Intergenic
1175074745 20:56363017-56363039 GATGCCCTCCACAGCCATCCTGG + Intronic
1175264779 20:57695986-57696008 GACTCTCTCCTCACCCCTCCTGG + Intronic
1175317433 20:58058813-58058835 GAAGGTGGCCTCATCCCTCCTGG + Intergenic
1175626469 20:60492346-60492368 GAAGCCCTCCAGATCCCTCCTGG + Intergenic
1175692086 20:61072864-61072886 TGAGCCCTTCTCATCCCACCAGG + Intergenic
1177892905 21:26827668-26827690 GAAGCTCTCTTCCTCCCTTCTGG - Intergenic
1179233438 21:39525595-39525617 GAAGACCTCCTGATCACTCATGG + Intergenic
1179638616 21:42731928-42731950 GAAGGCCAGCGCATCCCTCCAGG + Exonic
1179720653 21:43314311-43314333 GAAGCCTTCTTGTTCCCTCCGGG - Intergenic
1180954599 22:19736049-19736071 GGAGCACTCCTAAGCCCTCCCGG - Intergenic
1181582042 22:23833950-23833972 CAGGCCCTGCTCATCACTCCAGG - Intronic
1181688127 22:24543241-24543263 GAAGCCCTCCTTGCCCATCCTGG + Intronic
1182269603 22:29145172-29145194 GAAGCCCACGTCATCTCTTCTGG - Intronic
1182313616 22:29427202-29427224 CCAGCCCTCCTCATCAGTCCTGG - Intergenic
1183754921 22:39752804-39752826 GCAGCCTTCATCATCCCTCCAGG - Intronic
1183804700 22:40198518-40198540 GATGCCCTTCTCACCTCTCCTGG - Intronic
1184235205 22:43179594-43179616 GCAGCCCTCCTCCACCCACCAGG - Intronic
1185163631 22:49244388-49244410 GAAGCACACCTCAGTCCTCCTGG - Intergenic
1185315708 22:50178328-50178350 GAAGCCCCCCTCCTGGCTCCGGG - Exonic
950434443 3:12970300-12970322 GGGGCCCTCCTCATCCCTCAAGG - Intronic
950560166 3:13716686-13716708 AAAGCCTTCCTCTTTCCTCCTGG - Intergenic
950882585 3:16335255-16335277 TCAGCCAGCCTCATCCCTCCAGG - Intronic
950886405 3:16366496-16366518 GGAGTCCTCCTCGTCCCACCGGG + Intronic
953666663 3:44930526-44930548 GAAGCCCGACTCTGCCCTCCAGG - Intronic
954750420 3:52810416-52810438 GAAGGCCTCCTCATAGCCCCAGG + Intergenic
955245101 3:57217750-57217772 AAAGCCCTCCTCATCACGCTTGG + Intronic
957072926 3:75580117-75580139 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
957218530 3:77352320-77352342 GAAGCCCTTGTCATTACTCCTGG - Intronic
961281160 3:125766661-125766683 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
961784454 3:129339893-129339915 GACCCCCTCCACCTCCCTCCCGG + Intergenic
961873224 3:130002924-130002946 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
966390814 3:179451160-179451182 CGCGCCCTCCTCGTCCCTCCCGG + Intronic
967306944 3:188068477-188068499 GTAGCCCTGCTCATCCATCAGGG + Intergenic
968411819 4:396133-396155 GACCCCCTCCACCTCCCTCCCGG - Intergenic
968539574 4:1157687-1157709 GAAGCACTCCTCATCAGTTCAGG + Intergenic
969016533 4:4107415-4107437 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
969075134 4:4572271-4572293 GATGCCCTGCTCATCCTGCCTGG + Intergenic
969136485 4:5033318-5033340 GAAACCCTGCTTCTCCCTCCAGG + Intergenic
969264519 4:6056024-6056046 GCAGCCCTCCTCATTTCTGCAGG + Intronic
969264550 4:6056147-6056169 GAAGCTCTCCCCATCTCTGCAGG + Intronic
969592637 4:8130651-8130673 GAAGCCCCTCTGCTCCCTCCAGG - Intronic
969737424 4:9000902-9000924 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
972832290 4:42828132-42828154 GAATGCCTCCTCATCCCTGGAGG - Intergenic
973676497 4:53268650-53268672 GAGGCCCTCCTCATGCCTCTCGG - Intronic
974870614 4:67637257-67637279 GCTGCCCTCCACCTCCCTCCAGG - Intronic
977687121 4:99859813-99859835 GAAGCCCTCCACACCCTGCCAGG + Intronic
978729611 4:112010161-112010183 GAATGCCTCCTCAGCCCTGCAGG - Intergenic
980701829 4:136442125-136442147 GCAGCCCTCCCCATGCCTCCTGG - Intergenic
980974638 4:139598900-139598922 GCAGCAGTCCTCATCCTTCCGGG - Intronic
982234050 4:153235812-153235834 CAAGCCCTACTCCTCCCTCAAGG + Intronic
983278469 4:165649280-165649302 GAATACCTCCTCATCCCTAGAGG + Intergenic
985142999 4:186862343-186862365 GAAGCCCTGCACACCCCTGCAGG - Intergenic
985489173 5:169227-169249 GTGACCCTGCTCATCCCTCCGGG + Intronic
985707640 5:1410646-1410668 GTTGCCCTCCTCATTCCTCATGG + Intronic
985733630 5:1565156-1565178 CAAGGCCTCCTCACCCCTCCTGG + Intergenic
985763666 5:1765188-1765210 CAAGCTCTCCGCATTCCTCCTGG + Intergenic
986395910 5:7330339-7330361 GAATGCCTCCTCATCCCTAGAGG + Intergenic
987937891 5:24491629-24491651 GAAGCCCTGCTCCTCCCTGCCGG - Exonic
989048523 5:37295990-37296012 GACCCCCCCCTCCTCCCTCCCGG - Intronic
992494209 5:77276305-77276327 GAATCACTCCTCATCCTTCAGGG + Intronic
992501421 5:77347884-77347906 AAAGCCAGCCTCATACCTCCCGG - Intronic
992778147 5:80105861-80105883 GAAGCCCACCCCCTTCCTCCGGG + Intergenic
992889159 5:81188128-81188150 CCTGCCCTCCTCATCCATCCGGG + Intronic
993182461 5:84572062-84572084 GAAGCTCTGTTCATCCCTCAAGG + Intergenic
994339906 5:98614446-98614468 GAAGTGCTGGTCATCCCTCCTGG - Intergenic
994943974 5:106361427-106361449 GAATGCCTCCTCATCCCTAGAGG - Intergenic
995822857 5:116257126-116257148 GAAGGTCTCCTCATCCCTAGAGG - Intronic
997379222 5:133423446-133423468 GAGGCCCTCAGCCTCCCTCCTGG + Intronic
998630686 5:143894957-143894979 GAATGCCTCCTCATCCCTTGAGG + Intergenic
1001436808 5:171705547-171705569 GTAGCCCTCCACATGGCTCCTGG + Intergenic
1001492440 5:172165156-172165178 CAGGCCCTCCCCTTCCCTCCCGG + Intronic
1001958966 5:175868443-175868465 GAACCCCTCCTCCTGCCCCCAGG + Intronic
1003240225 6:4338393-4338415 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1004203769 6:13573606-13573628 GAGGCCCTTCTCATTCCTGCAGG - Intergenic
1004637987 6:17487145-17487167 GAAGCCATCCTCGTGCCTGCTGG + Intronic
1004767492 6:18746831-18746853 GAAGCCTTCCTGATACTTCCAGG + Intergenic
1005380026 6:25224458-25224480 GCTGCCCTCCTCTCCCCTCCAGG + Intergenic
1006783911 6:36651950-36651972 GAAGACCTCCACATTCCTCAGGG - Intergenic
1006824530 6:36924847-36924869 GAAGCCCTCTTCATTCCTGGAGG + Intronic
1006912255 6:37571031-37571053 GAAGCCGCCCTCTTGCCTCCAGG - Intergenic
1006982110 6:38155018-38155040 GGAGCCTTCGTCATCCATCCTGG - Intergenic
1011069501 6:83364979-83365001 GAAGTCCTCCTCGTCCCACTGGG + Intronic
1011159626 6:84374315-84374337 TGAGGCCTCCTCATCCCTGCAGG + Intergenic
1011750660 6:90451652-90451674 GAAGCCCTCCTTCTCCTTACAGG + Intergenic
1014908241 6:127057053-127057075 GAATGCCTCCTCATCCCTACAGG - Intergenic
1015476984 6:133665545-133665567 GAATCCCCCCACCTCCCTCCCGG - Intergenic
1015842984 6:137493267-137493289 GCAGCCTCCCTCTTCCCTCCCGG + Exonic
1015951852 6:138561369-138561391 TATTCCCTCCTCTTCCCTCCAGG + Intronic
1016210746 6:141531178-141531200 GAAGCCCTCCCTGTCCCTGCAGG + Intergenic
1017708328 6:157145125-157145147 GAAGCCTTTCTCAGCCTTCCAGG + Intronic
1017817776 6:158027824-158027846 GAACTCCTCCTCATCCTTCTGGG - Intronic
1017973770 6:159336240-159336262 GAAGCCCTCCTCATCCTGCTTGG - Intergenic
1018591928 6:165435316-165435338 AAACCCCGCCTCATCCCTGCTGG - Exonic
1018851498 6:167643735-167643757 GACACCCTCCTCATTCCACCTGG - Intergenic
1019291705 7:253715-253737 CAAGCCCTCCTAACCCCGCCCGG + Intronic
1019358984 7:595158-595180 GAAGGCCTCCTCATCCACACAGG + Intronic
1019386351 7:758479-758501 GAAGCCAGCCTCAACCTTCCAGG + Intronic
1019669055 7:2268151-2268173 GACGCCCCCCACCTCCCTCCCGG - Intronic
1021827232 7:24567346-24567368 GAAGACCTCCACTGCCCTCCAGG + Intergenic
1022249654 7:28594516-28594538 TAAGCCCTCCTGATTCCCCCAGG + Intronic
1022924029 7:35042465-35042487 CAAGCCCTCTTTCTCCCTCCTGG + Intergenic
1023148925 7:37181336-37181358 GATGCCCGCCTCATCCCTGCAGG + Intronic
1024159904 7:46663474-46663496 AAAGCACTCCTCATGCTTCCTGG + Intergenic
1024959268 7:54957770-54957792 GAAGCTCTCCTCATCCCGTCAGG - Intergenic
1025979227 7:66393615-66393637 GACCCCCTCCACCTCCCTCCCGG + Intronic
1028498233 7:91486734-91486756 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1029074997 7:97928217-97928239 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1029404902 7:100368863-100368885 GAAGCCCTCTGCATCCCTTTTGG + Intronic
1030083484 7:105797747-105797769 GAAGCCTCCCTCTCCCCTCCTGG + Intronic
1031920392 7:127595911-127595933 GAACCACTCCTCACCCCTCATGG - Exonic
1034093264 7:148383262-148383284 GCAGCCCTGCTCTGCCCTCCTGG - Intronic
1034254551 7:149717352-149717374 GAAGCCAGCCTGAGCCCTCCTGG + Intronic
1034280861 7:149853282-149853304 AAAGGACTCCTCATCCTTCCAGG - Intronic
1034406945 7:150910790-150910812 GACGCTGTCCTCATCCCTTCTGG - Intergenic
1034412409 7:150948228-150948250 GAAGCCCTCTTCCACCCTCCAGG - Intronic
1034940927 7:155229725-155229747 GAAGTCCTCCTGATCACTCCTGG + Intergenic
1036242524 8:7092163-7092185 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
1036258269 8:7221848-7221870 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1036310321 8:7680444-7680466 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1036359217 8:8065659-8065681 GACGTCGTCCTCCTCCCTCCTGG - Intergenic
1036613178 8:10367473-10367495 GAAGCCCTCCTTATCCATGAGGG - Intronic
1036696830 8:10980239-10980261 GCAGCCCTCCCCAGACCTCCTGG - Intronic
1036723578 8:11200516-11200538 GGAGCCCCCCTCCGCCCTCCCGG - Intronic
1036830208 8:12014966-12014988 GACGTCGTCCTCTTCCCTCCTGG + Exonic
1036891741 8:12601293-12601315 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1036899290 8:12659265-12659287 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1036900362 8:12665413-12665435 GACGTCGTCCTCCTCCCTCCTGG + Intergenic
1038284545 8:26195319-26195341 TAAACCATCCTCATCCTTCCAGG - Intergenic
1041715365 8:60927244-60927266 GAAGCCCTCCTCCCCATTCCTGG + Intergenic
1044413725 8:91912785-91912807 AAAGCCCTCCACACCCCACCTGG + Intergenic
1044606994 8:94056607-94056629 GAAACTTTCTTCATCCCTCCTGG + Intergenic
1044966500 8:97579111-97579133 AAAGCCCTCCTCACCCCACCTGG + Intergenic
1045688419 8:104735568-104735590 GAAGTTTTCCTCATCCTTCCAGG - Intronic
1047700910 8:127448496-127448518 GCAGCCCTCCTGATTCTTCCAGG - Intergenic
1048683730 8:136877405-136877427 AAATGCCTCCTCATCCCTCGAGG - Intergenic
1049174987 8:141186782-141186804 CCTGCCCTGCTCATCCCTCCAGG + Intronic
1049199065 8:141331096-141331118 GCTGCCCTCCGCATCCCTGCAGG - Intergenic
1049437879 8:142596020-142596042 GGACCCCTCCTGACCCCTCCTGG + Intergenic
1049552566 8:143267325-143267347 AAAGGCCTCCTCTTCGCTCCCGG + Intronic
1049719962 8:144111230-144111252 GCAGGCCTGCTCAGCCCTCCTGG + Intronic
1050262366 9:3854106-3854128 GAAGCCATCCTCACCACTCCAGG - Intronic
1053601622 9:39616665-39616687 GAAGTCATCCTCATCTCTCAGGG - Intergenic
1053859270 9:42370431-42370453 GAAGTCGTCCTCATCTCTCAGGG - Intergenic
1054566026 9:66760282-66760304 GAAGTCGTCCTCATCTCTCAGGG + Intergenic
1054856006 9:69900385-69900407 AAAACCCTCCTCCTCCCTTCTGG - Intronic
1056307014 9:85300314-85300336 GAAGCCCTCTTCAGCCTTCAGGG - Intergenic
1056455946 9:86760227-86760249 GCAGTCCTCCTCCTCCCGCCAGG - Intergenic
1057034462 9:91801672-91801694 GAATTCCTCCTCTCCCCTCCTGG - Intronic
1057552832 9:96064675-96064697 GAAGTCCTCCTGACCACTCCTGG + Intergenic
1059082830 9:111268098-111268120 AAAGCCCTTCTTATCCCTCAAGG + Intergenic
1059879877 9:118678106-118678128 GATGCCCCCCACCTCCCTCCCGG + Intergenic
1061358221 9:130122502-130122524 GAAGGCCTTCCCATCCCTCAGGG + Intronic
1062080988 9:134623229-134623251 GCAGCCCTGCTCATCCTCCCAGG - Intergenic
1062133603 9:134913215-134913237 GTGGCCCTCCTCCTCCCTCCTGG - Intronic
1062213687 9:135377924-135377946 GGAGCCCTCGTCCTCCCTCAAGG + Intergenic
1062246001 9:135566471-135566493 CAAGCCCACCACATCCTTCCAGG + Intronic
1062343121 9:136102521-136102543 CCAGCCCTCCTCATTCCTCCGGG - Intergenic
1062375912 9:136261853-136261875 GAAGGCCTCCTCGGCCCTCCAGG + Intergenic
1190245174 X:48686076-48686098 GGAGCCCTCCTCTTCTCTCTGGG - Exonic
1192234068 X:69285147-69285169 GAAGCCATGCTCAGGCCTCCTGG + Intergenic
1192252182 X:69422254-69422276 GCTGCCCTCCACCTCCCTCCCGG - Intergenic
1192342998 X:70279691-70279713 GAAGCCCTCACCAGCTCTCCTGG - Intronic
1192610277 X:72559885-72559907 GCTGCCCTCCACCTCCCTCCCGG - Intronic
1192610297 X:72559931-72559953 GCTGCCCTCCACCTCCCTCCTGG - Intronic
1193132672 X:77934078-77934100 GAATGCCTCCTCATCCCTACAGG - Intronic
1197613652 X:128667061-128667083 GATGCCTCCCTCATTCCTCCAGG + Intergenic
1198552833 X:137762642-137762664 GAAATCCTCCTCATCCCCTCAGG + Intergenic
1198600754 X:138282675-138282697 GCTGCCCTCCACCTCCCTCCTGG + Intergenic
1198841911 X:140865868-140865890 GAAGCTCACCTCAGCACTCCTGG - Intergenic
1199104636 X:143849714-143849736 GAATGCCTCCTCATCCCTCAAGG + Intergenic
1199354793 X:146849484-146849506 CACTCCTTCCTCATCCCTCCAGG - Intergenic
1199789047 X:151133041-151133063 GAATGCCTCCTCATCCCTAAAGG + Intergenic
1201274233 Y:12283672-12283694 TAAGCTCTCCTCCTCCTTCCTGG - Intergenic