ID: 1142508461

View in Genome Browser
Species Human (GRCh38)
Location 17:380567-380589
Sequence GAAGCCCCCCTCATGCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 3, 1: 8, 2: 5, 3: 37, 4: 154}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508445_1142508461 16 Left 1142508445 17:380528-380550 CCCCCTCATCCCTCCCGGAAGCC 0: 18
1: 17
2: 12
3: 46
4: 744
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508455_1142508461 -6 Left 1142508455 17:380550-380572 CCTCCTCATCCCTCCCGGAAGCC 0: 18
1: 17
2: 12
3: 46
4: 744
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508451_1142508461 3 Left 1142508451 17:380541-380563 CCCGGAAGCCCTCCTCATCCCTC 0: 13
1: 16
2: 28
3: 96
4: 563
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508448_1142508461 13 Left 1142508448 17:380531-380553 CCTCATCCCTCCCGGAAGCCCTC 0: 19
1: 17
2: 11
3: 49
4: 371
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508449_1142508461 7 Left 1142508449 17:380537-380559 CCCTCCCGGAAGCCCTCCTCATC 0: 9
1: 17
2: 10
3: 28
4: 282
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508456_1142508461 -9 Left 1142508456 17:380553-380575 CCTCATCCCTCCCGGAAGCCCCC 0: 8
1: 21
2: 17
3: 39
4: 539
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508447_1142508461 14 Left 1142508447 17:380530-380552 CCCTCATCCCTCCCGGAAGCCCT 0: 4
1: 5
2: 4
3: 38
4: 281
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508450_1142508461 6 Left 1142508450 17:380538-380560 CCTCCCGGAAGCCCTCCTCATCC 0: 9
1: 20
2: 13
3: 63
4: 393
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508442_1142508461 24 Left 1142508442 17:380520-380542 CCGGAAGCCCCCCTCATCCCTCC 0: 3
1: 22
2: 19
3: 71
4: 547
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508441_1142508461 25 Left 1142508441 17:380519-380541 CCCGGAAGCCCCCCTCATCCCTC 0: 3
1: 18
2: 22
3: 71
4: 559
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508446_1142508461 15 Left 1142508446 17:380529-380551 CCCCTCATCCCTCCCGGAAGCCC 0: 4
1: 6
2: 6
3: 31
4: 326
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508452_1142508461 2 Left 1142508452 17:380542-380564 CCGGAAGCCCTCCTCATCCCTCC 0: 16
1: 15
2: 18
3: 67
4: 604
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508454_1142508461 -5 Left 1142508454 17:380549-380571 CCCTCCTCATCCCTCCCGGAAGC 0: 17
1: 16
2: 14
3: 43
4: 491
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154
1142508444_1142508461 17 Left 1142508444 17:380527-380549 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG 0: 3
1: 8
2: 5
3: 37
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508461 Original CRISPR GAAGCCCCCCTCATGCTTCC CGG Intronic
900450159 1:2702009-2702031 GAAACCCCCCCACTGCTTCCAGG + Intronic
900454781 1:2768926-2768948 GAAACCCCCCCACTGCTTCCAGG + Intronic
900455834 1:2774127-2774149 GAAACCCCCCCACTGCTTCCAGG + Intronic
900456319 1:2776670-2776692 GAAACCCCCCCACTGCTTCCAGG + Intronic
901326020 1:8365700-8365722 GCACACCCCCTCATGCTTCCCGG + Intronic
901534105 1:9871552-9871574 GAATCGCCCCTCAGCCTTCCGGG - Intronic
901535899 1:9882940-9882962 GAAGTGCCCCTGATGTTTCCCGG - Intronic
902193085 1:14777451-14777473 GAGGGCCTCCTCATGCTGCCAGG + Intronic
902603540 1:17556102-17556124 CAGGCCCCCCCCATGCTCCCAGG - Intronic
904080383 1:27868910-27868932 GAAGCCCTCCGCATGCTGGCTGG - Intergenic
904271089 1:29350515-29350537 GGAGCCCCCCTCATCCATACTGG + Intergenic
904379982 1:30104025-30104047 TAATCCCCCCTCCTCCTTCCAGG - Intergenic
911542632 1:99176418-99176440 GAAGCACCCGAGATGCTTCCTGG + Intergenic
914239503 1:145843639-145843661 GTAGCACCCCTAATACTTCCTGG - Intergenic
915103251 1:153515739-153515761 AAAGCCCCTCTCCTGCCTCCAGG - Intergenic
915165341 1:153945239-153945261 GAAGCACCCCCCACGCTTCTGGG - Intronic
915302404 1:154959159-154959181 GGAGCCCCACTCAGGCTCCCCGG - Exonic
920182832 1:204143125-204143147 GAGGCCTCCCCCATGCTTCCTGG + Intronic
923001497 1:230009758-230009780 GCTCCCTCCCTCATGCTTCCAGG - Intergenic
1063101383 10:2952893-2952915 GAAGACCCCCTCTCCCTTCCGGG - Intergenic
1063367180 10:5498641-5498663 GAGGGCCCCCACCTGCTTCCAGG - Intergenic
1064258734 10:13767703-13767725 GAAGCCACCCTCAAGCCTCCGGG - Intronic
1065211081 10:23403790-23403812 GAAGTCCTGCTCAGGCTTCCTGG - Intergenic
1065278777 10:24113756-24113778 GAAGCCCCTGCCATGCCTCCCGG + Intronic
1067026264 10:42846509-42846531 CATGCCCACCTCATGCTTCATGG + Intergenic
1067155368 10:43776831-43776853 TGAGCCCCCCACTTGCTTCCTGG + Intergenic
1067162240 10:43836808-43836830 GGAGCACCCCTTGTGCTTCCCGG + Intergenic
1072879978 10:99217233-99217255 GATGCCCTCCTCCTGGTTCCCGG + Intronic
1074209881 10:111320745-111320767 GAATCCCTCCTGCTGCTTCCTGG - Intergenic
1075316939 10:121460374-121460396 GAAGCCTCCCTCTTACTCCCAGG - Intergenic
1076218566 10:128715437-128715459 GTATCCCCACTCAGGCTTCCAGG - Intergenic
1083927718 11:65818558-65818580 GAAGCACCGCTCTTTCTTCCTGG + Intergenic
1085427275 11:76415792-76415814 GTAGCCACCCTCAAGCTCCCTGG + Intergenic
1088379023 11:109173021-109173043 GAAGCACTCCTCATGCCCCCAGG - Intergenic
1088910817 11:114190903-114190925 GATGCCAGCATCATGCTTCCTGG - Intronic
1088913807 11:114211877-114211899 GAGGCCCCCCTCAGCATTCCAGG - Intronic
1089414427 11:118275416-118275438 ACAGCTTCCCTCATGCTTCCAGG - Intergenic
1092124425 12:6065555-6065577 GAACCCACGCTCCTGCTTCCAGG + Intronic
1096050996 12:48607331-48607353 GATGCCAGCATCATGCTTCCTGG - Intergenic
1096668345 12:53181648-53181670 GCAGCCCCCCTCTTCCTTTCTGG + Intronic
1098407372 12:70140588-70140610 GAAGGCCACCTCTTCCTTCCGGG - Intergenic
1102258354 12:111428920-111428942 GGAGCCACCCCCATGCCTCCGGG + Intronic
1103365775 12:120382098-120382120 GATGCCCCCCTCTTGCTTTATGG + Intergenic
1103764341 12:123270721-123270743 GGGGCTCCCCTCAAGCTTCCTGG - Intronic
1103972948 12:124683466-124683488 GAGGCCCCACTCATGTTACCTGG - Intergenic
1104180325 12:126373474-126373496 GAAGCCCCCTTCTGGCTTCCTGG - Intergenic
1104645606 12:130495218-130495240 GCAGCCCCCCTCATCATTTCAGG - Intronic
1106366154 13:29082873-29082895 TAACCTCCTCTCATGCTTCCTGG - Intronic
1108306995 13:49147272-49147294 AATGCCCCCCTCGTGCTCCCTGG - Intronic
1113592506 13:111511035-111511057 GAACCCCGCCTAATGCATCCCGG + Intergenic
1116862084 14:50003123-50003145 GAAGCCCCTTCCATCCTTCCTGG + Intronic
1119574120 14:75702870-75702892 CCAGCTCCCCTCATGCCTCCTGG - Intronic
1120124391 14:80723732-80723754 GGAACCCTGCTCATGCTTCCAGG - Intronic
1122273969 14:100581744-100581766 CAAGCCCCTCTCCTGCTGCCTGG + Intronic
1125727025 15:41873380-41873402 GGAGCCCTGCTCTTGCTTCCTGG - Intronic
1128335624 15:66784051-66784073 GAAACTCCCCTCCTGCTTCATGG - Intergenic
1128504942 15:68261575-68261597 GAAGCCCCCCTTATCCTTGGGGG - Intergenic
1130032916 15:80332325-80332347 GGAGCCACCCTCACCCTTCCTGG - Intergenic
1132847846 16:2008955-2008977 GAAGGCCCCCTCGCGCTTCTTGG - Intronic
1136026837 16:27474100-27474122 GAGGCTCCCCTCAAGGTTCCGGG - Intronic
1137435936 16:48454254-48454276 GAAGACCCTCTCTTGCTCCCAGG + Intergenic
1142508378 17:380325-380347 GAAGCCCTTCTCATCCCTCCCGG + Intronic
1142508385 17:380347-380369 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508391 17:380369-380391 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508399 17:380391-380413 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508405 17:380413-380435 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508427 17:380479-380501 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508435 17:380501-380523 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508443 17:380523-380545 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508469 17:380589-380611 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508479 17:380611-380633 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508487 17:380633-380655 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508494 17:380655-380677 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508504 17:380677-380699 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508517 17:380718-380740 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508531 17:380762-380784 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508539 17:380784-380806 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508546 17:380806-380828 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508565 17:380851-380873 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508573 17:380873-380895 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508583 17:380895-380917 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508591 17:380917-380939 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508609 17:380964-380986 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508615 17:380986-381008 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508629 17:381027-381049 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508643 17:381071-381093 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508651 17:381093-381115 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508658 17:381115-381137 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508666 17:381137-381159 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508682 17:381181-381203 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG + Intronic
1142508719 17:381273-381295 GAAGCCCCCCTCATGCCTCCCGG + Intronic
1142508728 17:381295-381317 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508738 17:381317-381339 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508755 17:381361-381383 GAAGCCCTGCTCATCCCTCCCGG + Intronic
1142508777 17:381410-381432 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508783 17:381432-381454 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508791 17:381454-381476 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508799 17:381476-381498 GAAGCCGTCCTCATGCCTCCCGG + Intronic
1142508810 17:381520-381542 GAAGCCCTCCTCATACCTCCCGG + Intronic
1142881542 17:2885810-2885832 GAGGCCACCCTCATGCCTCCTGG + Intronic
1144319402 17:14099550-14099572 GTAGCCCCCCTCATGGTTACTGG + Intronic
1145777573 17:27540047-27540069 AAAGCACCCATGATGCTTCCTGG - Intronic
1146499583 17:33352897-33352919 GAACCCTCCCTCATTCTTCAAGG + Intronic
1150511525 17:65757313-65757335 GAAGCTCCCATCATTGTTCCTGG - Intronic
1150608479 17:66714262-66714284 CACGCCCCCCTCAAGCTGCCAGG + Intronic
1152621902 17:81369006-81369028 GATGACCCCCTCATTCTCCCAGG + Intergenic
1153139304 18:1954140-1954162 AAAGCTCCTCTCATTCTTCCTGG - Intergenic
1155613098 18:27691189-27691211 GAAGCCTCCTTCAAGCTTCATGG - Intergenic
1156253367 18:35373474-35373496 GAAGCTCCCATGATGCTCCCTGG + Exonic
1160897666 19:1410247-1410269 GAAGCCCCCCTCAAGCTGACTGG - Intronic
1161527935 19:4769058-4769080 GAAGCCCCTCCCAGGATTCCTGG + Intergenic
1162786162 19:13036281-13036303 GAAGCGTCAGTCATGCTTCCAGG + Intronic
1162915567 19:13872903-13872925 GAAGCCCCCCTCCCGCCTCCCGG - Intronic
1164250521 19:23471042-23471064 GAAGCTCCCCGCCTTCTTCCTGG - Intergenic
1164776129 19:30855083-30855105 GCAGGTCCCCTCATGCTTCCCGG + Intergenic
1165076501 19:33282535-33282557 GAAGCCCTCCTCCTGGTCCCTGG + Intergenic
925330180 2:3052483-3052505 CACGTCCCCCTCAGGCTTCCTGG + Intergenic
926175578 2:10588844-10588866 GACGCTCCCCTCAGGCCTCCTGG + Intronic
927462131 2:23308325-23308347 GAAACCTCCCTCATCCCTCCAGG - Intergenic
929247590 2:39719791-39719813 GAAGCCTCCCTCATCTTTCAAGG + Intergenic
931442851 2:62303648-62303670 GAAGCACCCCTCCTTCTCCCTGG - Intergenic
933996612 2:87674633-87674655 GAATCCCACCTCCTGCTTCCTGG - Intergenic
935744206 2:106176657-106176679 GCAGCCGCCCTCAGCCTTCCAGG + Intronic
936248844 2:110851995-110852017 GAAGCCCCCAGCATATTTCCTGG + Intronic
936297239 2:111276277-111276299 GAATCCCACCTCCTGCTTCCTGG + Intergenic
936864053 2:117056653-117056675 AAATTCCTCCTCATGCTTCCAGG - Intergenic
939954006 2:148509727-148509749 GAGACGCCCCTCATGCTCCCTGG - Intronic
942692505 2:178601077-178601099 GGAGCCCCCATCATTCTTCGGGG + Exonic
945009382 2:205445390-205445412 GATGCCAGCATCATGCTTCCTGG - Intronic
947773125 2:232686695-232686717 GAAGCTTCCTTGATGCTTCCAGG + Intergenic
948018479 2:234710014-234710036 GAAGCCCCCACCATGATGCCTGG + Intergenic
1168961395 20:1872409-1872431 GATGCCCCACTCACCCTTCCAGG - Intergenic
1169027183 20:2381007-2381029 GAAGCCCCCCTCATGAGCCCTGG - Intronic
1170498235 20:16947846-16947868 GAAGCAACCCTCCTGCTACCAGG + Intergenic
1175295276 20:57904060-57904082 CCAGCTCCCCTCCTGCTTCCAGG + Intergenic
1175897466 20:62345759-62345781 GAAGCCGCCCCCATGGCTCCAGG + Intronic
1178624610 21:34204435-34204457 CCAGCCTCCCTCATGCTTCTAGG - Intergenic
1182122388 22:27796545-27796567 CAAGCCCCCCACATGTTACCAGG - Intronic
1185315708 22:50178328-50178350 GAAGCCCCCCTCCTGGCTCCGGG - Exonic
949146388 3:705670-705692 GAAACTGCCCTCATGATTCCTGG - Intergenic
953961761 3:47271509-47271531 GAAGCCCCCCTTATGCTAGTTGG - Intronic
954194728 3:48989898-48989920 GAAGACGCCCTCTTGCCTCCGGG - Exonic
955416378 3:58695833-58695855 GAAGCCCCCTCCTTGCTTCAAGG - Intergenic
961786166 3:129348102-129348124 CCAGCCCGCCTCTTGCTTCCTGG - Intergenic
962476301 3:135758296-135758318 GAAGCTGCCCTCTTGCTGCCTGG - Intergenic
964714083 3:159703664-159703686 GAAGCCATCCACATGCTTGCTGG - Intronic
968643585 4:1727449-1727471 GACCCCGCCCTCATGCTTCTTGG - Intronic
970842886 4:20496560-20496582 GAAGCTCCCCTCTTGTTTACAGG + Intronic
970892795 4:21066916-21066938 CAAGCATCCCTCATGCATCCCGG - Intronic
973676497 4:53268650-53268672 GAGGCCCTCCTCATGCCTCTCGG - Intronic
975376564 4:73652748-73652770 AAAACTCCACTCATGCTTCCAGG + Intergenic
978348719 4:107798906-107798928 GAAGTCCCACTCATCCTTCAAGG - Intergenic
978690865 4:111507614-111507636 GAAGGCCCCCTCCTACTTCTGGG - Intergenic
980701829 4:136442125-136442147 GCAGCCCTCCCCATGCCTCCTGG - Intergenic
980847419 4:138340912-138340934 GAAGCCACCCTGCTGCTACCTGG - Intergenic
987661792 5:20887902-20887924 GATGCCAGCATCATGCTTCCTGG - Intergenic
988736433 5:34026523-34026545 GAAGCCAGCCTTATACTTCCTGG - Intronic
988761790 5:34317417-34317439 GATGCCAGCATCATGCTTCCTGG + Intergenic
990989891 5:61674573-61674595 GAAGCCTCCGTCTTGCATCCTGG + Intronic
992630565 5:78676233-78676255 GGAACCCCTCTCACGCTTCCTGG + Intronic
995760177 5:115554147-115554169 CAGGCCCCACTCATGGTTCCTGG + Intergenic
998256186 5:140590855-140590877 GAAGGCCCCCTCAGACTTACGGG + Intronic
1000742960 5:164993438-164993460 GAAGCCACCTTCACACTTCCTGG - Intergenic
1001205939 5:169763301-169763323 GAAGCCCCTCTCAGGATTTCAGG + Intronic
1001668778 5:173456320-173456342 GATTCCCCCCTCAGGGTTCCCGG + Intergenic
1002422279 5:179154852-179154874 GAAGCCGTCCTCATGGTTCAGGG + Exonic
1004767492 6:18746831-18746853 GAAGCCTTCCTGATACTTCCAGG + Intergenic
1006465002 6:34188177-34188199 GGAGTCCCCCTCTTTCTTCCAGG + Intergenic
1006912255 6:37571031-37571053 GAAGCCGCCCTCTTGCCTCCAGG - Intergenic
1009648516 6:66442325-66442347 AATATCCCCCTCATGCTTCCTGG + Intergenic
1013450891 6:110279896-110279918 GATGCCAGCATCATGCTTCCTGG - Intronic
1014131282 6:117837199-117837221 CTAGCCTCCCTCATGCTTCCTGG + Intergenic
1017973770 6:159336240-159336262 GAAGCCCTCCTCATCCTGCTTGG - Intergenic
1018222708 6:161597008-161597030 GAAGCCCCCAGCAGTCTTCCCGG - Intronic
1019386351 7:758479-758501 GAAGCCAGCCTCAACCTTCCAGG + Intronic
1020963130 7:14831046-14831068 GAATTCCCCTTCATTCTTCCTGG + Intronic
1021537926 7:21726104-21726126 GATGCCAGCATCATGCTTCCTGG - Intronic
1022554307 7:31276447-31276469 GAAGCCCCCTGCATCCTTGCAGG - Intergenic
1024094860 7:45975484-45975506 GAAGCCAGCCCCATGCTTCCTGG - Intergenic
1024159904 7:46663474-46663496 AAAGCACTCCTCATGCTTCCTGG + Intergenic
1026475273 7:70729443-70729465 GAAGCCCCCCTGGGGATTCCAGG - Intronic
1027533797 7:79369517-79369539 GAAGCTCCCATGATGCTACCAGG + Intronic
1028125285 7:87105553-87105575 GATGCCAGCATCATGCTTCCTGG + Intergenic
1032433266 7:131880134-131880156 GCAGCCCTCCTCCTGCTCCCAGG - Intergenic
1034313115 7:150107576-150107598 GAAGCCACACTCCTGCTTCACGG - Intergenic
1036768796 8:11565138-11565160 GAAGCCCACCTTTTGCATCCAGG + Intergenic
1039244772 8:35596701-35596723 GAAGCCCCCTCCCTGCTTCCAGG - Intronic
1039566821 8:38557921-38557943 GAATCACCCCTCCTGCCTCCTGG + Intergenic
1039886700 8:41658499-41658521 CAAGGCCTCCTCCTGCTTCCAGG - Intronic
1047700910 8:127448496-127448518 GCAGCCCTCCTGATTCTTCCAGG - Intergenic
1048749993 8:137662028-137662050 GAAGCATCCAACATGCTTCCTGG + Intergenic
1049805553 8:144537210-144537232 GAAGCCCTCCCCCTGCTTCTGGG + Intronic
1051457342 9:17274035-17274057 GTAGACCCACTCATTCTTCCAGG - Intronic
1056624757 9:88244900-88244922 GACCCCCCCCACATACTTCCCGG + Intergenic
1057570078 9:96197723-96197745 GCAGTCACCCTCAGGCTTCCTGG - Intergenic
1059476253 9:114550400-114550422 GCAGCCGACCTCCTGCTTCCAGG - Intergenic
1060990698 9:127847093-127847115 GATGCTCCCATCATGCTTACTGG + Intronic
1062246001 9:135566471-135566493 CAAGCCCACCACATCCTTCCAGG + Intronic
1197613652 X:128667061-128667083 GATGCCTCCCTCATTCCTCCAGG + Intergenic
1199025541 X:142932791-142932813 GAAGCCCCCTCTCTGCTTCCAGG - Intergenic
1199693756 X:150328910-150328932 GAAGCCCCCATCCACCTTCCAGG + Intergenic
1199978803 X:152909566-152909588 GAAGCCGGCCTCCTGCTTCCAGG + Intergenic
1201269106 Y:12237183-12237205 GAATCCCCCTCCCTGCTTCCAGG + Intergenic