ID: 1142508470

View in Genome Browser
Species Human (GRCh38)
Location 17:380593-380615
Sequence GCTTCCGGGAGGGATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5749
Summary {0: 4, 1: 23, 2: 17, 3: 87, 4: 5618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508470_1142508487 17 Left 1142508470 17:380593-380615 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508487 17:380633-380655 GAAGCCGTCCTCATCCCTCCCGG 0: 3
1: 15
2: 11
3: 48
4: 164
1142508470_1142508479 -5 Left 1142508470 17:380593-380615 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508479 17:380611-380633 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508470 Original CRISPR GCTTCCGGGAGGGATGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr