ID: 1142508495

View in Genome Browser
Species Human (GRCh38)
Location 17:380659-380681
Sequence GCTTCCGGGAGGGATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5749
Summary {0: 4, 1: 23, 2: 17, 3: 87, 4: 5618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508495_1142508504 -5 Left 1142508495 17:380659-380681 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508504 17:380677-380699 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508495_1142508512 14 Left 1142508495 17:380659-380681 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508512 17:380696-380718 CCGGAAGCCCTCATCCTTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508495 Original CRISPR GCTTCCGGGAGGGATGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr