ID: 1142508556

View in Genome Browser
Species Human (GRCh38)
Location 17:380833-380855
Sequence GCTTCCGGGAGGGATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5749
Summary {0: 4, 1: 23, 2: 17, 3: 87, 4: 5618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508556_1142508565 -5 Left 1142508556 17:380833-380855 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508565 17:380851-380873 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508556_1142508573 17 Left 1142508556 17:380833-380855 CCCCCCTCATCCCTCCCGGAAGC 0: 4
1: 23
2: 17
3: 87
4: 5618
Right 1142508573 17:380873-380895 GAAGCCCCCCACATCCCTCCCGG 0: 2
1: 5
2: 37
3: 1267
4: 4802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508556 Original CRISPR GCTTCCGGGAGGGATGAGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr