ID: 1142508574

View in Genome Browser
Species Human (GRCh38)
Location 17:380877-380899
Sequence GCTTCCGGGAGGGATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8217
Summary {0: 5, 1: 10, 2: 62, 3: 5132, 4: 3008}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508574_1142508583 -5 Left 1142508574 17:380877-380899 CCCCCCACATCCCTCCCGGAAGC 0: 5
1: 10
2: 62
3: 5132
4: 3008
Right 1142508583 17:380895-380917 GAAGCCCTCCTCATCCCTCCCGG 0: 14
1: 14
2: 15
3: 46
4: 381
1142508574_1142508591 17 Left 1142508574 17:380877-380899 CCCCCCACATCCCTCCCGGAAGC 0: 5
1: 10
2: 62
3: 5132
4: 3008
Right 1142508591 17:380917-380939 GAAGCCCTCCTCATGCCTCCCGG 0: 2
1: 24
2: 17
3: 35
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508574 Original CRISPR GCTTCCGGGAGGGATGTGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr