ID: 1142508704

View in Genome Browser
Species Human (GRCh38)
Location 17:381229-381251
Sequence GAAGCCCTCCTCATGCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 7, 1: 5, 2: 18, 3: 35, 4: 250}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508690_1142508704 -1 Left 1142508690 17:381207-381229 CCCCCCCCCCACATCCCTCCCGG 0: 2
1: 95
2: 92
3: 128
4: 1034
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508689_1142508704 6 Left 1142508689 17:381200-381222 CCGGAAGCCCCCCCCCCACATCC 0: 1
1: 0
2: 1
3: 54
4: 591
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508680_1142508704 29 Left 1142508680 17:381177-381199 CCCAGAAGCCCTCCTCATCCCTC 0: 3
1: 15
2: 17
3: 73
4: 488
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508696_1142508704 -6 Left 1142508696 17:381212-381234 CCCCCACATCCCTCCCGGAAGCC 0: 9
1: 20
2: 10
3: 311
4: 5964
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508681_1142508704 28 Left 1142508681 17:381178-381200 CCAGAAGCCCTCCTCATCCCTCC 0: 16
1: 15
2: 18
3: 67
4: 604
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508692_1142508704 -2 Left 1142508692 17:381208-381230 CCCCCCCCCACATCCCTCCCGGA 0: 3
1: 318
2: 170
3: 119
4: 843
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508698_1142508704 -8 Left 1142508698 17:381214-381236 CCCACATCCCTCCCGGAAGCCCT 0: 5
1: 6
2: 3
3: 19
4: 276
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508693_1142508704 -3 Left 1142508693 17:381209-381231 CCCCCCCCACATCCCTCCCGGAA 0: 2
1: 3
2: 1123
3: 452
4: 533
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508694_1142508704 -4 Left 1142508694 17:381210-381232 CCCCCCCACATCCCTCCCGGAAG 0: 2
1: 15
2: 3971
3: 2186
4: 871
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508697_1142508704 -7 Left 1142508697 17:381213-381235 CCCCACATCCCTCCCGGAAGCCC 0: 5
1: 6
2: 6
3: 37
4: 638
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508684_1142508704 20 Left 1142508684 17:381186-381208 CCTCCTCATCCCTCCCGGAAGCC 0: 18
1: 17
2: 12
3: 46
4: 744
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508695_1142508704 -5 Left 1142508695 17:381211-381233 CCCCCCACATCCCTCCCGGAAGC 0: 5
1: 10
2: 62
3: 5132
4: 3008
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508686_1142508704 11 Left 1142508686 17:381195-381217 CCCTCCCGGAAGCCCCCCCCCCA 0: 1
1: 2
2: 2
3: 51
4: 656
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508683_1142508704 21 Left 1142508683 17:381185-381207 CCCTCCTCATCCCTCCCGGAAGC 0: 17
1: 16
2: 14
3: 43
4: 491
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508685_1142508704 17 Left 1142508685 17:381189-381211 CCTCATCCCTCCCGGAAGCCCCC 0: 8
1: 21
2: 17
3: 39
4: 539
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508687_1142508704 10 Left 1142508687 17:381196-381218 CCTCCCGGAAGCCCCCCCCCCAC 0: 1
1: 1
2: 6
3: 64
4: 762
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508699_1142508704 -9 Left 1142508699 17:381215-381237 CCACATCCCTCCCGGAAGCCCTC 0: 19
1: 17
2: 11
3: 49
4: 371
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250
1142508688_1142508704 7 Left 1142508688 17:381199-381221 CCCGGAAGCCCCCCCCCCACATC 0: 1
1: 0
2: 52
3: 192
4: 702
Right 1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG 0: 7
1: 5
2: 18
3: 35
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508704 Original CRISPR GAAGCCCTCCTCATGCTTCC CGG Intronic
901137147 1:7005327-7005349 GTAGCCCTCCTCATTTTACCAGG - Intronic
901326020 1:8365700-8365722 GCACACCCCCTCATGCTTCCCGG + Intronic
902193085 1:14777451-14777473 GAGGGCCTCCTCATGCTGCCAGG + Intronic
903268066 1:22170408-22170430 GAAGCCCTTCTCAACCTGCCAGG - Intergenic
903564753 1:24256542-24256564 CATGCCCTCCCTATGCTTCCAGG - Intergenic
904080383 1:27868910-27868932 GAAGCCCTCCGCATGCTGGCTGG - Intergenic
904200551 1:28816627-28816649 GAAGTCCTGCTCACGCTTCATGG - Intronic
904965687 1:34370833-34370855 GAAGTCCTACTCATCCTTCAAGG + Intergenic
911070244 1:93826573-93826595 GAAGTGATCCTCATGCTGCCAGG + Intronic
916069614 1:161162202-161162224 GAAGCTCTTCTAAGGCTTCCTGG + Intronic
917923759 1:179771854-179771876 GATGCTCTCCTCAGGCTCCCTGG + Intronic
919010945 1:191962482-191962504 GGAGCTCTCCTCATGTTTCAAGG + Intergenic
920182832 1:204143125-204143147 GAGGCCTCCCCCATGCTTCCTGG + Intronic
921889433 1:220339075-220339097 GCAGCCATCCTCCTCCTTCCTGG + Intergenic
922242117 1:223762425-223762447 TAAGACCTCCGCATGCTGCCGGG + Intronic
923437387 1:233980154-233980176 AAAGTCCTCCTCATCCTTCAAGG - Intronic
1063375185 10:5550454-5550476 GATGCCCTCCTCCTGATCCCTGG + Intergenic
1064258734 10:13767703-13767725 GAAGCCACCCTCAAGCCTCCGGG - Intronic
1064580374 10:16787385-16787407 GACGCCCTCCTCACTCTGCCTGG + Intronic
1065211081 10:23403790-23403812 GAAGTCCTGCTCAGGCTTCCTGG - Intergenic
1066782818 10:38970991-38971013 GAAGCCCTCCTCAAGCATGGGGG + Intergenic
1067026264 10:42846509-42846531 CATGCCCACCTCATGCTTCATGG + Intergenic
1067551394 10:47238806-47238828 CAAGCCCTCTTCATGCCTCTGGG - Intergenic
1067787124 10:49258569-49258591 CAGGCCCTCCTCTTTCTTCCTGG - Intergenic
1067947515 10:50699362-50699384 GAATGGCTCCTGATGCTTCCAGG + Intergenic
1069748711 10:70732299-70732321 GAAGCCATCCTCATGGTTGAGGG - Exonic
1070540291 10:77410721-77410743 AATGGCCTCCTCATGCTGCCAGG + Intronic
1070882833 10:79864349-79864371 GAATGGCTCCTGATGCTTCCAGG + Intergenic
1071649397 10:87380651-87380673 GAATGGCTCCTGATGCTTCCAGG + Intergenic
1071835925 10:89416643-89416665 GCAGCCCTCCTCATCCTCCTTGG + Intronic
1072879978 10:99217233-99217255 GATGCCCTCCTCCTGGTTCCCGG + Intronic
1073276188 10:102313566-102313588 GAAGCCCTCATTAATCTTCCTGG + Intronic
1074209881 10:111320745-111320767 GAATCCCTCCTGCTGCTTCCTGG - Intergenic
1074437211 10:113444353-113444375 TAAGCCCTCTTCTTCCTTCCTGG - Intergenic
1074442573 10:113491690-113491712 CATTCCCTCATCATGCTTCCTGG + Intergenic
1075001972 10:118805317-118805339 GAAACCCTCATCCTGCCTCCAGG - Intergenic
1076061355 10:127416618-127416640 GATGCCCTCCTCGTGCCACCTGG + Intronic
1076067853 10:127463491-127463513 GTAGCTCTCCTCCTCCTTCCAGG + Intergenic
1077414810 11:2420115-2420137 GAAGCCCTCCCCCTTCTCCCTGG + Intronic
1078141529 11:8696712-8696734 AAAGCCTTCCTCAATCTTCCTGG + Intronic
1079094522 11:17501980-17502002 AAAGCCCTCCCTTTGCTTCCAGG - Exonic
1088379023 11:109173021-109173043 GAAGCACTCCTCATGCCCCCAGG - Intergenic
1088910817 11:114190903-114190925 GATGCCAGCATCATGCTTCCTGG - Intronic
1089849774 11:121486227-121486249 TGAGCCTTCCTCATTCTTCCAGG + Intronic
1090298094 11:125608268-125608290 GGAGCTCTCCTCATGCTGACAGG + Exonic
1090680977 11:129057220-129057242 GAAGCCCTCCTGCACCTTCCAGG + Intronic
1091622384 12:2099123-2099145 ATAGCCCTGCTCATGCTTCATGG + Intronic
1091648355 12:2290693-2290715 GAATCCCTCCTGCTGCCTCCAGG + Intronic
1091783142 12:3226391-3226413 TAAGCCCTCCTAAGGCTTCTTGG - Intronic
1091798951 12:3312675-3312697 GGAGCCTTCTTCGTGCTTCCTGG - Intergenic
1093042284 12:14396366-14396388 GAAGCCATACTCATGTTTCAGGG + Intronic
1093083409 12:14839836-14839858 GAAGCCTTCCTCACTTTTCCTGG + Intronic
1095832736 12:46604597-46604619 GGAGCCATCCTCAAGCTCCCAGG - Intergenic
1096050996 12:48607331-48607353 GATGCCAGCATCATGCTTCCTGG - Intergenic
1096711546 12:53460615-53460637 GAAGCACTTCTCATGGTACCTGG + Intronic
1097145977 12:56939588-56939610 GATGCTCTCCCCATGCCTCCAGG + Intergenic
1097684651 12:62680165-62680187 GAAGCCTTGCTGATGCTGCCTGG + Intronic
1098407372 12:70140588-70140610 GAAGGCCACCTCTTCCTTCCGGG - Intergenic
1102556492 12:113730052-113730074 GAAGTCATCGTCATCCTTCCAGG + Intergenic
1104180325 12:126373474-126373496 GAAGCCCCCTTCTGGCTTCCTGG - Intergenic
1104492135 12:129203491-129203513 CCTGCCCTCCACATGCTTCCTGG - Intronic
1105637749 13:22231785-22231807 AAAGCCCTCATCATGCTTTGTGG + Intergenic
1110228164 13:73141411-73141433 GAAACCCTGCTCAGCCTTCCAGG + Intergenic
1110328844 13:74248456-74248478 TAAGCTCTCCTTATTCTTCCTGG - Intergenic
1110552383 13:76824175-76824197 AAAGCCCTTCTCATGGTGCCTGG + Intergenic
1111822769 13:93233745-93233767 GGAACCCTCCTCATGTTTGCAGG - Intronic
1112998092 13:105598832-105598854 TAAGCCCTCCACTAGCTTCCTGG - Intergenic
1113592506 13:111511035-111511057 GAACCCCGCCTAATGCATCCCGG + Intergenic
1113605273 13:111600324-111600346 GAAGCCCTGCTCCTGCGTCTTGG - Intronic
1115150890 14:30283986-30284008 GAAGCATTTCTCAAGCTTCCTGG + Intergenic
1115773315 14:36688551-36688573 GCAGCCGTCCTGATGCTGCCTGG - Intronic
1117554878 14:56873870-56873892 GAGGCCCTCCTCAGGTTTCTAGG + Intergenic
1118599779 14:67463990-67464012 GAGGCCCTCCTGAAGCTACCTGG - Intronic
1119532646 14:75373768-75373790 GAAGCCCTCTGCATCCATCCAGG - Intergenic
1120124391 14:80723732-80723754 GGAACCCTGCTCATGCTTCCAGG - Intronic
1121967919 14:98327519-98327541 GAAGCCCTCTTCTTGATTTCTGG + Intergenic
1121996292 14:98606144-98606166 GGGGCCCTCCTCATGGTTCGTGG - Intergenic
1123578900 15:21698522-21698544 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1123615527 15:22141004-22141026 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1125512834 15:40302103-40302125 CAACCCCTCCCCAGGCTTCCAGG - Intronic
1125727025 15:41873380-41873402 GGAGCCCTGCTCTTGCTTCCTGG - Intronic
1127730966 15:61801659-61801681 GCCCTCCTCCTCATGCTTCCAGG + Intergenic
1127797353 15:62450095-62450117 GAATCTCTCCTCTGGCTTCCAGG + Intronic
1128305424 15:66595091-66595113 GCAGCTCTCCCCATGTTTCCTGG - Intronic
1128716771 15:69914311-69914333 GCAGCCCTCCTCTTACCTCCTGG + Intergenic
1130751164 15:86714735-86714757 GAAGGCTTCCTGATGCTTCTAGG + Intronic
1130814289 15:87414630-87414652 AAAGCCATCTTCATCCTTCCTGG + Intergenic
1202987770 15_KI270727v1_random:432767-432789 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1135490409 16:22904598-22904620 GAAGCCCTCCTTAACCTGCCTGG - Intronic
1135493984 16:22935676-22935698 GCAGCCCTCTTCATTCCTCCAGG + Intergenic
1138225459 16:55290792-55290814 CAAGTCCTCCCCATCCTTCCAGG + Intergenic
1141755596 16:85988677-85988699 GGAACCCTCCTCATGCCCCCTGG - Intergenic
1142508378 17:380325-380347 GAAGCCCTTCTCATCCCTCCCGG + Intronic
1142508385 17:380347-380369 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508391 17:380369-380391 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508399 17:380391-380413 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508405 17:380413-380435 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508427 17:380479-380501 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508435 17:380501-380523 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508443 17:380523-380545 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508469 17:380589-380611 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508479 17:380611-380633 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508487 17:380633-380655 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508494 17:380655-380677 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508504 17:380677-380699 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508517 17:380718-380740 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508523 17:380740-380762 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508531 17:380762-380784 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508539 17:380784-380806 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508546 17:380806-380828 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508565 17:380851-380873 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508573 17:380873-380895 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508583 17:380895-380917 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508591 17:380917-380939 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508609 17:380964-380986 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508615 17:380986-381008 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508629 17:381027-381049 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508635 17:381049-381071 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508643 17:381071-381093 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508651 17:381093-381115 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508658 17:381115-381137 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508666 17:381137-381159 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508682 17:381181-381203 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG + Intronic
1142508719 17:381273-381295 GAAGCCCCCCTCATGCCTCCCGG + Intronic
1142508728 17:381295-381317 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508738 17:381317-381339 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508755 17:381361-381383 GAAGCCCTGCTCATCCCTCCCGG + Intronic
1142508777 17:381410-381432 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508783 17:381432-381454 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508791 17:381454-381476 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508799 17:381476-381498 GAAGCCGTCCTCATGCCTCCCGG + Intronic
1142508810 17:381520-381542 GAAGCCCTCCTCATACCTCCCGG + Intronic
1142881542 17:2885810-2885832 GAGGCCACCCTCATGCCTCCTGG + Intronic
1143719216 17:8798477-8798499 ACAGCCCTCCCCTTGCTTCCTGG - Exonic
1144207282 17:12988109-12988131 GAAGCCCTCATCAGCATTCCTGG - Intronic
1144319402 17:14099550-14099572 GTAGCCCCCCTCATGGTTACTGG + Intronic
1145823363 17:27857659-27857681 GGATCCCTTCTCTTGCTTCCAGG + Intronic
1146279775 17:31537606-31537628 GAAGCCCTGTCCATGGTTCCTGG + Exonic
1148834415 17:50458265-50458287 GGGGCTCTCCTCATTCTTCCAGG + Intronic
1149673922 17:58441735-58441757 GAAGCCCTGCTTTTGCTTTCTGG - Intronic
1151904888 17:77041237-77041259 GAAGCCCTCCTCCTGGTGACCGG - Intergenic
1203165181 17_GL000205v2_random:87193-87215 GGACCCCTCCTTCTGCTTCCTGG - Intergenic
1156456092 18:37295208-37295230 GCAGCCCTCCTCATTCATTCGGG - Intronic
1156460298 18:37317994-37318016 GAAGCCTTCCTCCTGCCCCCTGG + Intronic
1156802724 18:41137280-41137302 GAAGCACTCTTCATGTTTTCTGG + Intergenic
1158532312 18:58274432-58274454 GCTGCCCTCCTCCAGCTTCCGGG - Intronic
1160362444 18:78295356-78295378 GAAGCCCTCCTCCTGATGGCTGG - Intergenic
1160569173 18:79804720-79804742 GAGGGCCTCTTCAGGCTTCCAGG + Intergenic
1160666815 19:334636-334658 GAGGCCCTCTGCATGCTGCCAGG + Intronic
1160897666 19:1410247-1410269 GAAGCCCCCCTCAAGCTGACTGG - Intronic
1160943743 19:1631741-1631763 GCAGGGCTCCTCCTGCTTCCCGG - Intronic
1161164595 19:2779450-2779472 AATGCCGTCCTCATGCTTGCTGG - Intronic
1162915567 19:13872903-13872925 GAAGCCCCCCTCCCGCCTCCCGG - Intronic
1163696383 19:18765598-18765620 GAAGGCCTCCTGTTCCTTCCAGG + Intronic
1164692622 19:30222548-30222570 GACGCCCTCTGCATGCCTCCAGG - Intergenic
1164776129 19:30855083-30855105 GCAGGTCCCCTCATGCTTCCCGG + Intergenic
1165076501 19:33282535-33282557 GAAGCCCTCCTCCTGGTCCCTGG + Intergenic
1166068000 19:40371303-40371325 GATTCCCTCCTCATTCTTTCTGG - Intronic
1166190289 19:41172454-41172476 GAGCCCCTCCTCCAGCTTCCTGG + Intergenic
1168181065 19:54663479-54663501 GAGGACCTGCTCAGGCTTCCGGG + Intronic
926315098 2:11703948-11703970 GAAGCCATCCTGACCCTTCCAGG - Intronic
926429784 2:12774071-12774093 AGAGGCCTCCTCATACTTCCTGG + Intergenic
927203990 2:20595480-20595502 GAAGCCCTCCTGCTGCCTCAGGG - Intronic
927495031 2:23546367-23546389 GAAGTCTTCCTGATGATTCCAGG - Intronic
928372130 2:30747863-30747885 CAAGAGCTCCTCAGGCTTCCTGG - Intronic
928434846 2:31248340-31248362 GAAGCCCTCCCTCTGCCTCCAGG + Intronic
929922127 2:46180170-46180192 GGAACCCTCCTCATCCCTCCAGG - Intronic
932592882 2:73077721-73077743 GAAGCCTTCCTGATTCCTCCAGG + Intronic
933996612 2:87674633-87674655 GAATCCCACCTCCTGCTTCCTGG - Intergenic
935072494 2:99707358-99707380 AAAGCCATCTTCATGCTTCATGG + Intronic
935527626 2:104190534-104190556 GAAGCCTTTCTCTTGCTTCTAGG + Intergenic
936297239 2:111276277-111276299 GAATCCCACCTCCTGCTTCCTGG + Intergenic
936864053 2:117056653-117056675 AAATTCCTCCTCATGCTTCCAGG - Intergenic
937675576 2:124586368-124586390 TAAGCTGTCCTCATGCTTACAGG - Intronic
938459981 2:131491058-131491080 GAGGGTCTCCTCCTGCTTCCAGG + Intronic
938698248 2:133853995-133854017 GAAACCTTCTTCATGCCTCCAGG - Intergenic
940332358 2:152489116-152489138 GCATCCATCCTCCTGCTTCCAGG + Intronic
941827454 2:169916466-169916488 GACACCCTCCTCATCCTGCCTGG + Intronic
942139627 2:172964931-172964953 GAAGAGCTCCACATGCTTTCTGG - Intronic
943732629 2:191319040-191319062 GCAGCCCTCCTCTTCCTTACTGG - Intronic
945009382 2:205445390-205445412 GATGCCAGCATCATGCTTCCTGG - Intronic
945560923 2:211338946-211338968 AAATACCTCCTCATGCCTCCTGG + Intergenic
945932247 2:215866679-215866701 GAAGCCTTCCTCAATCTTTCAGG - Intergenic
946860677 2:223997735-223997757 AATGTCCTCCTCATCCTTCCAGG - Intronic
947954088 2:234172302-234172324 AAAGCTCTCTTCCTGCTTCCCGG - Intergenic
948225504 2:236306437-236306459 CAAGCCCTCCTCCTGTTGCCTGG - Intergenic
948884277 2:240875133-240875155 GAAGCCCTTCTCCTTCTACCTGG + Exonic
1169027183 20:2381007-2381029 GAAGCCCCCCTCATGAGCCCTGG - Intronic
1169821026 20:9710213-9710235 GTAGCTCTTCTCCTGCTTCCTGG - Intronic
1170940859 20:20846782-20846804 AAAGCCCTCCTCCTCCTTCAGGG + Intergenic
1171012959 20:21518423-21518445 GAGGCTCTCCTCTAGCTTCCAGG - Intergenic
1173219439 20:41119951-41119973 AAAGACCTCCTCATGCTCCTGGG - Intronic
1173260085 20:41426368-41426390 GAAGCATTCCACATGGTTCCAGG - Intronic
1175626469 20:60492346-60492368 GAAGCCCTCCAGATCCCTCCTGG + Intergenic
1176406570 21:6371898-6371920 GGACCCCTCCTTCTGCTTCCTGG + Intergenic
1179603819 21:42499233-42499255 GAAGTCCTCCTGGGGCTTCCTGG - Intronic
1180118422 21:45727447-45727469 GCAGCCGTGCTCCTGCTTCCAGG - Intronic
1182438477 22:30346644-30346666 GACGTCCTCCTCTAGCTTCCTGG + Intronic
1184602427 22:45551534-45551556 GCAGCCCTCCATATTCTTCCTGG + Intronic
1184777256 22:46629413-46629435 TAAACCCTCCTCCTGGTTCCAGG + Intronic
1185080448 22:48706865-48706887 GAAGTCCTTCTCGTGCTTTCTGG + Intronic
1185309493 22:50146193-50146215 GAAGCCCTTCACTGGCTTCCCGG - Intronic
1185315708 22:50178328-50178350 GAAGCCCCCCTCCTGGCTCCGGG - Exonic
950425922 3:12924724-12924746 GACTCCCTTCTCAGGCTTCCTGG + Exonic
951851540 3:27146754-27146776 GAAGACCTTCTAATTCTTCCTGG - Intronic
952284412 3:31954359-31954381 GAAGCCCTCCTCATGGAACTTGG - Intronic
953717164 3:45325746-45325768 GAAGCCCTTGGCATGCTGCCTGG + Intergenic
957408281 3:79800795-79800817 GAAGTCCTTCTCATTCTGCCAGG + Intergenic
961786166 3:129348102-129348124 CCAGCCCGCCTCTTGCTTCCTGG - Intergenic
961993591 3:131217702-131217724 AAAGCCCTCCTCTTGTTCCCTGG + Intronic
962070563 3:132029423-132029445 GAAGCCCTGCTTATGGGTCCCGG + Intronic
962989634 3:140566359-140566381 GAAGGCCTTCTCCAGCTTCCTGG + Exonic
963202306 3:142598036-142598058 GAAGTCCTGCTCATGCTGCAAGG + Intronic
963839526 3:150091320-150091342 GAAGCCCTCGTCAGGATCCCAGG + Intergenic
964714083 3:159703664-159703686 GAAGCCATCCACATGCTTGCTGG - Intronic
966339942 3:178914529-178914551 GCTTCCTTCCTCATGCTTCCAGG + Intergenic
969075134 4:4572271-4572293 GATGCCCTGCTCATCCTGCCTGG + Intergenic
969085412 4:4652675-4652697 GAAGGGCTTCTCATGTTTCCTGG + Intergenic
969117940 4:4885363-4885385 GAATGCCTCCTCATTCTGCCTGG + Intergenic
969687349 4:8683085-8683107 GCAGCCCTCCTCTTGCTCCTGGG - Intergenic
969864338 4:10063977-10063999 GAAGTCCTTCTCCTGCTTTCTGG - Intergenic
973676497 4:53268650-53268672 GAGGCCCTCCTCATGCCTCTCGG - Intronic
975202469 4:71607755-71607777 GACACCCTCCTCATGCTGCTTGG + Intergenic
977687121 4:99859813-99859835 GAAGCCCTCCACACCCTGCCAGG + Intronic
980701829 4:136442125-136442147 GCAGCCCTCCCCATGCCTCCTGG - Intergenic
980974638 4:139598900-139598922 GCAGCAGTCCTCATCCTTCCGGG - Intronic
987661792 5:20887902-20887924 GATGCCAGCATCATGCTTCCTGG - Intergenic
988736433 5:34026523-34026545 GAAGCCAGCCTTATACTTCCTGG - Intronic
988761790 5:34317417-34317439 GATGCCAGCATCATGCTTCCTGG + Intergenic
990432998 5:55755880-55755902 GAAGCCTTCCTTTTTCTTCCAGG + Intronic
992494209 5:77276305-77276327 GAATCACTCCTCATCCTTCAGGG + Intronic
1001184595 5:169556712-169556734 GAAGCCTTACTCATGCTGCAAGG - Intergenic
1001436808 5:171705547-171705569 GTAGCCCTCCACATGGCTCCTGG + Intergenic
1001958966 5:175868443-175868465 GAACCCCTCCTCCTGCCCCCAGG + Intronic
1002056778 5:176602551-176602573 AAAACCCTCCTCATTCTTGCCGG + Intronic
1002422279 5:179154852-179154874 GAAGCCGTCCTCATGGTTCAGGG + Exonic
1002434613 5:179222944-179222966 CAACCCCTCCCCCTGCTTCCAGG + Intronic
1002992408 6:2250051-2250073 GAAGCCATCCTTCTGCTTTCTGG + Intergenic
1003512073 6:6790090-6790112 GCACCCCTGCTCATACTTCCAGG + Intergenic
1004637987 6:17487145-17487167 GAAGCCATCCTCGTGCCTGCTGG + Intronic
1004767492 6:18746831-18746853 GAAGCCTTCCTGATACTTCCAGG + Intergenic
1005678988 6:28186045-28186067 TAATCCCTCCTTGTGCTTCCTGG - Intergenic
1006439707 6:34046462-34046484 TGTCCCCTCCTCATGCTTCCGGG - Intronic
1006912255 6:37571031-37571053 GAAGCCGCCCTCTTGCCTCCAGG - Intergenic
1008138179 6:47801024-47801046 AAAGCCCTCCTGATTCTCCCTGG + Intronic
1011750660 6:90451652-90451674 GAAGCCCTCCTTCTCCTTACAGG + Intergenic
1011766101 6:90621935-90621957 AAAGACTTCCTCTTGCTTCCAGG + Intergenic
1012580084 6:100857168-100857190 GAAGCCCTTTTCATGTTTACTGG + Intronic
1013450891 6:110279896-110279918 GATGCCAGCATCATGCTTCCTGG - Intronic
1014131282 6:117837199-117837221 CTAGCCTCCCTCATGCTTCCTGG + Intergenic
1017708328 6:157145125-157145147 GAAGCCTTTCTCAGCCTTCCAGG + Intronic
1017817776 6:158027824-158027846 GAACTCCTCCTCATCCTTCTGGG - Intronic
1017973770 6:159336240-159336262 GAAGCCCTCCTCATCCTGCTTGG - Intergenic
1018398019 6:163395616-163395638 GAAGCCTTCCGTATGCTTCAGGG + Intergenic
1018806798 6:167268211-167268233 GGAGTCCTCCCCATGCTTCTGGG - Intergenic
1019386351 7:758479-758501 GAAGCCAGCCTCAACCTTCCAGG + Intronic
1019979062 7:4607567-4607589 GAAGTCTTCCTCCTGCTTGCAGG - Intergenic
1020547395 7:9550126-9550148 CAAGCGATCCTCCTGCTTCCTGG + Intergenic
1021537926 7:21726104-21726126 GATGCCAGCATCATGCTTCCTGG - Intronic
1023202215 7:37711190-37711212 GAAGGCCTCCAGATGATTCCTGG - Intronic
1024094860 7:45975484-45975506 GAAGCCAGCCCCATGCTTCCTGG - Intergenic
1024159904 7:46663474-46663496 AAAGCACTCCTCATGCTTCCTGG + Intergenic
1026942068 7:74293001-74293023 GCAGCTCTCCCCATGCTCCCAGG + Intronic
1028125285 7:87105553-87105575 GATGCCAGCATCATGCTTCCTGG + Intergenic
1030157008 7:106465542-106465564 GAAGCCTTCTTGATGATTCCAGG - Intergenic
1031560642 7:123233893-123233915 GAAGACCTGATCAGGCTTCCTGG - Intergenic
1032270545 7:130400709-130400731 GAAAACCTCTTCATGCTTTCCGG - Exonic
1032433266 7:131880134-131880156 GCAGCCCTCCTCCTGCTCCCAGG - Intergenic
1032461435 7:132114310-132114332 GACTCCCTCTTCATGCTCCCCGG - Intergenic
1033402659 7:141041606-141041628 GAAGACATCCTGATGTTTCCTGG - Intergenic
1034280861 7:149853282-149853304 AAAGGACTCCTCATCCTTCCAGG - Intronic
1035049667 7:155991517-155991539 GAATCCCTCATCTTGGTTCCTGG - Intergenic
1036290004 8:7479167-7479189 GAAGCCCTGATAATGGTTCCTGG - Intergenic
1036331472 8:7832356-7832378 GAAGCCCTGATAATGGTTCCTGG + Intergenic
1036637707 8:10563439-10563461 GAAGTCCTGCCCATGCTCCCAGG - Intergenic
1036768796 8:11565138-11565160 GAAGCCCACCTTTTGCATCCAGG + Intergenic
1038284545 8:26195319-26195341 TAAACCATCCTCATCCTTCCAGG - Intergenic
1038323125 8:26547745-26547767 GAAGACCTCCGCCTGCTTGCAGG - Intronic
1038821577 8:30957002-30957024 CATGCCCTCAACATGCTTCCTGG - Intergenic
1039244772 8:35596701-35596723 GAAGCCCCCTCCCTGCTTCCAGG - Intronic
1039251852 8:35674697-35674719 AAAGGCTTCCTCGTGCTTCCGGG + Intronic
1039886700 8:41658499-41658521 CAAGGCCTCCTCCTGCTTCCAGG - Intronic
1041715365 8:60927244-60927266 GAAGCCCTCCTCCCCATTCCTGG + Intergenic
1045049038 8:98306303-98306325 GAAACCCTCCACTTGTTTCCAGG + Intergenic
1045688419 8:104735568-104735590 GAAGTTTTCCTCATCCTTCCAGG - Intronic
1047700910 8:127448496-127448518 GCAGCCCTCCTGATTCTTCCAGG - Intergenic
1048206690 8:132421095-132421117 AAAGCCCTCCTAATGTTTGCAGG - Intronic
1049167269 8:141134093-141134115 GCAGCCCTCCTCCTGGATCCTGG - Intronic
1049683628 8:143930624-143930646 GGGGCCCTCCTGATGCTCCCGGG + Intronic
1049805553 8:144537210-144537232 GAAGCCCTCCCCCTGCTTCTGGG + Intronic
1056307014 9:85300314-85300336 GAAGCCCTCTTCAGCCTTCAGGG - Intergenic
1058071311 9:100603239-100603261 GCATCCCTCCTCTTGCTTTCGGG - Intergenic
1059476253 9:114550400-114550422 GCAGCCGACCTCCTGCTTCCAGG - Intergenic
1060231180 9:121826815-121826837 CAAGCCCTCCTCATTCTGCAAGG - Intronic
1061973317 9:134056150-134056172 GAAGCCCTCTTGCTGCTGCCAGG + Intronic
1062080988 9:134623229-134623251 GCAGCCCTGCTCATCCTCCCAGG - Intergenic
1062246001 9:135566471-135566493 CAAGCCCACCACATCCTTCCAGG + Intronic
1062343121 9:136102521-136102543 CCAGCCCTCCTCATTCCTCCGGG - Intergenic
1062371869 9:136243747-136243769 GAAGCCCTCTCCCTGCTGCCTGG + Intronic
1187107754 X:16261566-16261588 GAATCCCTCCCCATGGTTTCTGG + Intergenic
1188383766 X:29530764-29530786 CAATCACTCCACATGCTTCCTGG - Intronic
1189760194 X:44314406-44314428 CAGGCCTTCCTCATTCTTCCAGG - Intronic
1192234068 X:69285147-69285169 GAAGCCATGCTCAGGCCTCCTGG + Intergenic
1193907362 X:87260133-87260155 GAAGCCCTCCTTTAGCTTCTTGG + Intergenic
1197854603 X:130902058-130902080 GAAGCCCTCATCCGGCTTTCAGG - Intronic
1199398399 X:147367494-147367516 GAACCCCTCCCCCTACTTCCTGG - Intergenic
1199978803 X:152909566-152909588 GAAGCCGGCCTCCTGCTTCCAGG + Intergenic
1200012449 X:153128906-153128928 GGAGACCTCCTCGGGCTTCCTGG - Intergenic
1200027150 X:153271013-153271035 GGAGACCTCCTCGGGCTTCCTGG + Intergenic
1200762400 Y:7052040-7052062 GAAGCCCTCTCCCTGCTTCAAGG - Intronic
1201274233 Y:12283672-12283694 TAAGCTCTCCTCCTCCTTCCTGG - Intergenic