ID: 1142508710

View in Genome Browser
Species Human (GRCh38)
Location 17:381251-381273
Sequence GAACCCCTCCTCATCCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1331
Summary {0: 1, 1: 14, 2: 15, 3: 54, 4: 1247}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142508701_1142508710 6 Left 1142508701 17:381222-381244 CCTCCCGGAAGCCCTCCTCATGC 0: 8
1: 14
2: 12
3: 33
4: 284
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508706_1142508710 -6 Left 1142508706 17:381234-381256 CCTCCTCATGCTTCCCGGAACCC 0: 1
1: 7
2: 6
3: 32
4: 221
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508702_1142508710 3 Left 1142508702 17:381225-381247 CCCGGAAGCCCTCCTCATGCTTC 0: 7
1: 5
2: 19
3: 72
4: 472
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508695_1142508710 17 Left 1142508695 17:381211-381233 CCCCCCACATCCCTCCCGGAAGC 0: 5
1: 10
2: 62
3: 5132
4: 3008
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508698_1142508710 14 Left 1142508698 17:381214-381236 CCCACATCCCTCCCGGAAGCCCT 0: 5
1: 6
2: 3
3: 19
4: 276
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508697_1142508710 15 Left 1142508697 17:381213-381235 CCCCACATCCCTCCCGGAAGCCC 0: 5
1: 6
2: 6
3: 37
4: 638
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508692_1142508710 20 Left 1142508692 17:381208-381230 CCCCCCCCCACATCCCTCCCGGA 0: 3
1: 318
2: 170
3: 119
4: 843
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508699_1142508710 13 Left 1142508699 17:381215-381237 CCACATCCCTCCCGGAAGCCCTC 0: 19
1: 17
2: 11
3: 49
4: 371
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508705_1142508710 -5 Left 1142508705 17:381233-381255 CCCTCCTCATGCTTCCCGGAACC 0: 1
1: 4
2: 9
3: 36
4: 215
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508696_1142508710 16 Left 1142508696 17:381212-381234 CCCCCACATCCCTCCCGGAAGCC 0: 9
1: 20
2: 10
3: 311
4: 5964
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508690_1142508710 21 Left 1142508690 17:381207-381229 CCCCCCCCCCACATCCCTCCCGG 0: 2
1: 95
2: 92
3: 128
4: 1034
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508693_1142508710 19 Left 1142508693 17:381209-381231 CCCCCCCCACATCCCTCCCGGAA 0: 2
1: 3
2: 1123
3: 452
4: 533
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508700_1142508710 7 Left 1142508700 17:381221-381243 CCCTCCCGGAAGCCCTCCTCATG 0: 8
1: 15
2: 9
3: 17
4: 182
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508707_1142508710 -9 Left 1142508707 17:381237-381259 CCTCATGCTTCCCGGAACCCCTC 0: 1
1: 4
2: 7
3: 40
4: 178
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508703_1142508710 2 Left 1142508703 17:381226-381248 CCGGAAGCCCTCCTCATGCTTCC 0: 6
1: 5
2: 22
3: 53
4: 406
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508689_1142508710 28 Left 1142508689 17:381200-381222 CCGGAAGCCCCCCCCCCACATCC 0: 1
1: 0
2: 1
3: 54
4: 591
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508688_1142508710 29 Left 1142508688 17:381199-381221 CCCGGAAGCCCCCCCCCCACATC 0: 1
1: 0
2: 52
3: 192
4: 702
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247
1142508694_1142508710 18 Left 1142508694 17:381210-381232 CCCCCCCACATCCCTCCCGGAAG 0: 2
1: 15
2: 3971
3: 2186
4: 871
Right 1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG 0: 1
1: 14
2: 15
3: 54
4: 1247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142508710 Original CRISPR GAACCCCTCCTCATCCCTCC CGG Intronic
901030572 1:6305074-6305096 TGACCCCCCCACATCCCTCCCGG + Intronic
901100363 1:6715136-6715158 GACCCCCCCCACCTCCCTCCTGG + Intergenic
901100512 1:6715493-6715515 GACCCCCCCCACCTCCCTCCTGG + Intergenic
901341668 1:8501923-8501945 GATCCCCCCCACCTCCCTCCCGG - Intronic
901341719 1:8502022-8502044 GACCCCCCCCACCTCCCTCCCGG - Intronic
901849850 1:12008422-12008444 GACCCCCCCCACCTCCCTCCCGG + Intronic
902018682 1:13328491-13328513 GACCCCCCCCACCTCCCTCCCGG - Intergenic
902018964 1:13329138-13329160 GACCCCCCCCACCTCCCTCCCGG - Intergenic
902078025 1:13802975-13802997 GAACCGCTCCTCCACCCTGCTGG + Intronic
902407274 1:16191639-16191661 CTACCCCTCCTCATTCCTCCTGG - Intergenic
902408621 1:16200007-16200029 CAACCTCTCCTCATCCTTCAGGG + Intronic
903019846 1:20386365-20386387 GAACTCCTGTTCCTCCCTCCTGG + Intergenic
903148080 1:21387920-21387942 GACCCCCCCCACCTCCCTCCCGG - Intergenic
903354432 1:22737544-22737566 GAACTCCTACTCATCCTTCAAGG + Intronic
903525857 1:23993352-23993374 GACCCCCCCCACCTCCCTCCCGG + Intergenic
903525988 1:23993659-23993681 GACCCCCCCCACCTCCCTCCCGG + Intergenic
903634102 1:24799862-24799884 GACCCCCCCCACCTCCCTCCCGG - Intronic
903634231 1:24800160-24800182 GACCCCCCCCACCTCCCTCCCGG - Intronic
903637618 1:24833212-24833234 GACCCCCCCCACCTCCCTCCCGG + Intronic
903637954 1:24833963-24833985 GACCCCCCCCACCTCCCTCCCGG + Intronic
903669147 1:25025274-25025296 CATGCCCTCCTCCTCCCTCCAGG + Intergenic
903748468 1:25604036-25604058 GACCCCCCCCACCTCCCTCCCGG - Intergenic
903748492 1:25604085-25604107 GACCCCCCCCACCTCCCTCCCGG - Intergenic
903962137 1:27064266-27064288 GACCCCCCCCACCTCCCTCCCGG - Intergenic
904077977 1:27854352-27854374 GACCCCCCCCACCTCCCTCCCGG - Intergenic
904200609 1:28816890-28816912 GACCCCCTCTTCCTCCCGCCTGG + Intronic
904306971 1:29596205-29596227 GAAGTCCTCCTCATCCCTGTGGG + Intergenic
904794981 1:33051876-33051898 GACCCCCCCCACCTCCCTCCCGG - Intronic
904795026 1:33051975-33051997 TGACCCCTCCACCTCCCTCCCGG - Intronic
904795329 1:33052649-33052671 GACCCCCCCCACCTCCCTCCCGG - Intronic
904814022 1:33181914-33181936 GCACCCCTCCTCTTCTCTGCCGG - Intronic
905258511 1:36701021-36701043 GAACTCCTATTCATCCCTCAAGG + Intergenic
905315757 1:37080941-37080963 GACCCCCCCCACCTCCCTCCCGG - Intergenic
905315980 1:37081489-37081511 GACCCCCCCCACCTCCCTCCTGG - Intergenic
905862288 1:41359799-41359821 GAGCCCCTCCTCATTCCCCAGGG - Intergenic
906399978 1:45497694-45497716 GACCCCCTCCACCTCCCTCCCGG - Intronic
906487293 1:46242118-46242140 GACCCCCCCCACCTCCCTCCCGG - Intergenic
906487372 1:46242296-46242318 GACCCCCCCCACCTCCCTCCTGG - Intergenic
906706312 1:47897406-47897428 GAACTCCTCCTCATCCATCAGGG - Intronic
906761486 1:48382590-48382612 GACCCCCCCCACCTCCCTCCCGG + Intronic
906761585 1:48382810-48382832 GACCCCCCCCACCTCCCTCCCGG + Intronic
906761885 1:48383478-48383500 GACCCCCCCCACCTCCCTCCCGG + Intronic
907250398 1:53134294-53134316 GAAGCCATCCTCTACCCTCCTGG + Intronic
907372409 1:54011903-54011925 GAACCCGTATTCATCCCTCAAGG - Intronic
907453417 1:54561735-54561757 GACCCCCCCCACCTCCCTCCCGG + Intronic
907453550 1:54562043-54562065 GACCCCCCCCACCTCCCTCCCGG + Intronic
908048598 1:60201815-60201837 GCACCCCTCCTCATACATACTGG - Intergenic
908062139 1:60362708-60362730 CAACACCTCCTCCTCCATCCTGG - Intergenic
908446180 1:64201318-64201340 GACCCCCCCCACCTCCCTCCCGG - Intergenic
908467966 1:64415306-64415328 GACCCCCCCCACCTCCCTCCCGG - Intergenic
908661545 1:66442137-66442159 GAATGCCTCCTCATCCCTGGAGG + Intergenic
908798233 1:67852729-67852751 CAAGCCATCCTCATCTCTCCCGG - Intergenic
909043883 1:70686301-70686323 GAACTCGTCCTCAGGCCTCCTGG + Intergenic
910344121 1:86216679-86216701 GACCCCCCCCACCTCCCTCCAGG - Intergenic
910406792 1:86899417-86899439 GACCCCCCCCACCTCCCTCCCGG + Intronic
910799377 1:91130512-91130534 GAACCTCTTCTCTTCCCTCTGGG - Intergenic
911351663 1:96762496-96762518 GACCCCCGCCACCTCCCTCCCGG + Intronic
912266144 1:108160096-108160118 TGACCCCTCCACCTCCCTCCCGG + Intronic
912298068 1:108488978-108489000 GACCCCCCCCACCTCCCTCCCGG + Intergenic
912298146 1:108489156-108489178 GACCCCCCCCACCTCCCTCCCGG + Intergenic
912298486 1:108489929-108489951 GACCCCCCCCACCTCCCTCCCGG + Intergenic
912629348 1:111233554-111233576 GACCCCCCCCACCTCCCTCCTGG - Intronic
912668979 1:111607868-111607890 GACCCCCCCCACCTCCCTCCCGG + Intronic
912751967 1:112293973-112293995 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912752109 1:112294291-112294313 TGACCCCTCCACCTCCCTCCCGG - Intergenic
912808049 1:112773615-112773637 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912808198 1:112773968-112773990 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912808272 1:112774144-112774166 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912808349 1:112774322-112774344 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912825101 1:112898256-112898278 GACCCCCCCCACCTCCCTCCCGG + Intergenic
912825324 1:112898756-112898778 GACCCCCCCCACCTCCCTCCCGG + Intergenic
912845034 1:113069851-113069873 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912845161 1:113070126-113070148 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912845241 1:113070304-113070326 GACCCCCCCCACCTCCCTCCCGG - Intergenic
912845333 1:113070494-113070516 GACCCCCCCCACCTCCCTCCCGG - Intergenic
913021127 1:114790642-114790664 GACCCCCCCCACCTCCCTCCTGG + Intergenic
913305779 1:117429435-117429457 GACCCCCCCCACCTCCCTCCCGG + Intronic
913305909 1:117429711-117429733 GACCCCCCCCACCTCCCTCCCGG + Intronic
913306179 1:117430309-117430331 GACCCCCCCCACCTCCCTCCCGG + Intronic
913557095 1:119978448-119978470 GAACTCCACCTCACCCCTCCAGG + Intronic
913993782 1:143637889-143637911 GACCCCCCCCACCTCCCTCCCGG - Intergenic
913993988 1:143638368-143638390 TGACCCCTCCACCTCCCTCCCGG - Intergenic
913994234 1:143638911-143638933 TGACCCCTCCACCTCCCTCCCGG - Intergenic
914392273 1:147233458-147233480 GACCCCCCCCACCTCCCTCCCGG - Intronic
914775009 1:150728581-150728603 GACCCCCCCCACCTCCCTCCCGG + Intergenic
914775211 1:150729033-150729055 GACCCCCCCCACCTCCCTCCCGG + Intergenic
914888047 1:151600486-151600508 GACCCCCCCCACCTCCCTCCCGG - Intergenic
914888178 1:151600788-151600810 GACCCCCCCCACCTCCCTCCCGG - Intergenic
914893790 1:151651331-151651353 GACCCCCCCCACCTCCCTCCCGG + Intronic
914893815 1:151651381-151651403 GACCCCCCCCACCTCCCTCCCGG + Intronic
915113954 1:153583259-153583281 GACCCCCCCCACCTCCCTCCCGG - Intergenic
915502420 1:156328186-156328208 GACCCCCCCCACCTCCCTCCCGG - Intronic
915519420 1:156432802-156432824 AAGCCCCTCCTCTTCCTTCCAGG + Intergenic
915539340 1:156557423-156557445 GACCCCCCCCACCTCCCTCCCGG - Intronic
915539443 1:156557648-156557670 GACCCCCCCCACCTCCCTCCCGG - Intronic
915539613 1:156558013-156558035 GACCCCCCCCACCTCCCTCCCGG - Intronic
916104892 1:161423310-161423332 GACCCCCCCCACCTCCCTCCCGG - Intergenic
916104917 1:161423360-161423382 GACCCCCCCCACCTCCCTCCCGG - Intergenic
916151843 1:161800772-161800794 GAATGCCTCCTCATCCCTAGAGG - Intronic
916629044 1:166592179-166592201 CAAGCCCTCCACATCCCTCGGGG + Intergenic
916950957 1:169779849-169779871 GCACCCATCTTCATCCCCCCTGG - Intronic
917375685 1:174349360-174349382 GACCCCCCCCACCTCCCTCCCGG + Intronic
917375784 1:174349587-174349609 GACCCCCCCCACCTCCCTCCCGG + Intronic
917848235 1:179040363-179040385 CAACCCCCCCACTTCCCTCCCGG + Intronic
917860076 1:179135944-179135966 GACCCCCCCCACCTCCCTCCTGG - Intronic
917860127 1:179136072-179136094 GACCCCCCCCACCTCCCTCCTGG - Intronic
919994896 1:202740106-202740128 GACCCCCCCCACCTCCCTCCCGG + Intronic
920067399 1:203278551-203278573 CCACCCCTCCTCCTCTCTCCTGG - Intergenic
920152214 1:203919324-203919346 GACCCCCCCCACCTCCCTCCCGG + Intergenic
920415658 1:205797815-205797837 GACCCCCACCCCATCTCTCCAGG + Intronic
920451551 1:206064248-206064270 GACCCCCCCCACCTCCCTCCCGG - Intronic
920854300 1:209650890-209650912 GTACCCCTTCCCATCCTTCCAGG - Intronic
921043985 1:211460623-211460645 GACCCCCCCCACCTCCCTCCCGG - Intergenic
921140326 1:212299178-212299200 GACCCCCCCCACCTCCCTCCCGG + Intronic
921237744 1:213150995-213151017 GACCCCCCCCACCTCCCTCCCGG + Intronic
921237902 1:213151347-213151369 TAACCCCCCCACCTCCCTCCCGG + Intronic
921238081 1:213151782-213151804 GACCCCCCCCACCTCCCTCCCGG + Intronic
921238203 1:213152056-213152078 TAACCCCCCCACCTCCCTCCCGG + Intronic
921238321 1:213152330-213152352 GACCCCCCCCACCTCCCTCCCGG + Intronic
921414009 1:214869233-214869255 GACCCCCCCCACCTCCCTCCCGG + Intergenic
922043210 1:221917329-221917351 CAACTACTCCTCATGCCTCCTGG - Intergenic
922102504 1:222487895-222487917 GACCCCCCCCACCTCCCTCCCGG - Intergenic
922102703 1:222488333-222488355 GAACCCCCCCACCTCCCTCCCGG - Intergenic
922503766 1:226114980-226115002 GACCCCCCCCACCTCCCTCCCGG + Intergenic
923344819 1:233041512-233041534 GAAGGCCTCCTCCTCCCTACAGG + Intronic
923710822 1:236386809-236386831 GACCCCCCCCACCTCCCTCCCGG - Intronic
923710999 1:236387182-236387204 GACCCCCCCCACCTCCCTCCCGG - Intronic
923711078 1:236387360-236387382 GACCCCCCCCACCTCCCTCCCGG - Intronic
923793000 1:237127564-237127586 GACCCCCCCCACCTCCCTCCCGG + Intronic
924936218 1:248773811-248773833 GCACCCCTCCAACTCCCTCCCGG + Intergenic
1062906621 10:1183856-1183878 GGCCCCATCCTCTTCCCTCCTGG - Intronic
1063340618 10:5259966-5259988 TATCCCCTCATCATCCCACCTGG + Intergenic
1063802963 10:9602475-9602497 TAATCCCTGCTCATCTCTCCAGG - Intergenic
1065012210 10:21430457-21430479 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1065012236 10:21430508-21430530 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1065320678 10:24506198-24506220 GAACGACTCCTGATCCCACCTGG - Intronic
1065335864 10:24656150-24656172 GACCCCCCCCACCTCCCTCCCGG - Intronic
1065336038 10:24656553-24656575 GACCCCCCCCACCTCCCTCCCGG - Intronic
1065336298 10:24657106-24657128 GACCCCCCCCACCTCCCTCCCGG - Intronic
1065840532 10:29697129-29697151 GACCCCCCCCACCTCCCTCCCGG - Intronic
1066085348 10:31969937-31969959 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1066085614 10:31970499-31970521 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1066085691 10:31970675-31970697 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1066330551 10:34417035-34417057 GAACCATTCCTCATGCCTCTGGG - Intronic
1066464158 10:35639304-35639326 GCCCCCCTCCCCACCCCTCCTGG + Exonic
1066467991 10:35670321-35670343 GAGCCCCTCCTCCTTGCTCCTGG - Intergenic
1067119912 10:43465049-43465071 GACCCCCCCCACCTCCCTCCCGG + Intronic
1068668086 10:59697095-59697117 GAACCCCCCCACCTCCCTCCCGG - Intronic
1069645421 10:69993011-69993033 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1069699086 10:70408159-70408181 GACCCCCCCCACCTCCCTCCCGG + Intronic
1069740936 10:70686882-70686904 GACCCCCCCCACCTCCCTCCCGG + Intronic
1069741015 10:70687060-70687082 GACCCCCCCCACCTCCCTCCCGG + Intronic
1069741070 10:70687189-70687211 GACCCCCCCCACCTCCCTCCCGG + Intronic
1069928781 10:71869290-71869312 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1070135486 10:73689844-73689866 GACCCCCCCCACCTCCCTCCTGG - Intronic
1070317913 10:75333235-75333257 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1070684006 10:78468560-78468582 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1070966528 10:80534301-80534323 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1072116761 10:92375544-92375566 TGACCCCTCCACCTCCCTCCCGG - Intergenic
1072117331 10:92376794-92376816 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1072149520 10:92674363-92674385 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1072149653 10:92674642-92674664 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1072150024 10:92675465-92675487 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1072180354 10:92975462-92975484 GACCCCCCCCACCTCCCTCCCGG - Intronic
1072602358 10:96941541-96941563 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072648702 10:97276686-97276708 GACCCCCCCCACCTCCCTCCCGG - Intronic
1072648835 10:97276994-97277016 GACCCCCCCCACCTCCCTCCTGG - Intronic
1072659898 10:97357282-97357304 GGCCCCCTTCTCATCCCTGCTGG - Intronic
1072684476 10:97528673-97528695 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072684502 10:97528723-97528745 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072730382 10:97841831-97841853 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1072736302 10:97881849-97881871 GAACTGCTCCTCATTCCTCAGGG + Intronic
1072770591 10:98134461-98134483 CAACCCTTCCTCATTCCTCTCGG - Intergenic
1072809306 10:98446814-98446836 GAGCCCCCCTTCAACCCTCCCGG - Exonic
1072949290 10:99838105-99838127 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072949394 10:99838332-99838354 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072949597 10:99838784-99838806 GACCCCCCCCACCTCCCTCCCGG + Intronic
1072949785 10:99839189-99839211 CAACCCCCCCACCTCCCTCCCGG + Intronic
1072980411 10:100093527-100093549 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1073386513 10:103129916-103129938 GACCCCCCCCACCTCCCTCCCGG - Intronic
1074151994 10:110767115-110767137 GACCCCCCCCACCTCCCTCCCGG + Intronic
1075001972 10:118805317-118805339 GAAACCCTCATCCTGCCTCCAGG - Intergenic
1075050794 10:119181937-119181959 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1075128852 10:119722243-119722265 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1075359210 10:121814709-121814731 CCACCCTTCCTCATCCCGCCAGG - Intronic
1076648185 10:131969072-131969094 AGACCCATCCTCCTCCCTCCGGG - Intronic
1077146774 11:1050055-1050077 GGACCCCTCCACTTTCCTCCAGG + Intergenic
1077397569 11:2332603-2332625 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1077397594 11:2332653-2332675 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1077411199 11:2404754-2404776 GAACCGCTCCTTGTCCCTCCTGG - Exonic
1077411766 11:2407003-2407025 GGACCCCTCCTCAGCCCTGTGGG - Intronic
1078177121 11:8978711-8978733 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1079039740 11:17050412-17050434 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1079039864 11:17050688-17050710 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1079174004 11:18121440-18121462 TAACCCCCCCACCTCCCTCCCGG - Intronic
1079444858 11:20548603-20548625 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1079444911 11:20548730-20548752 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1080097964 11:28430213-28430235 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1080098231 11:28430839-28430861 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1080551942 11:33380017-33380039 CAACCCCACCTCATCCTTCAAGG - Intergenic
1080620914 11:33986361-33986383 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1081288701 11:41303983-41304005 GACCCCCCCCACCTCCCTCCCGG - Intronic
1081289192 11:41305086-41305108 GACCCCCCCCACCTCCCTCCCGG - Intronic
1081627391 11:44663807-44663829 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1081627471 11:44663985-44664007 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1081709238 11:45206302-45206324 GAACCCCTCCTCTTTCATCTGGG - Intronic
1081784596 11:45738159-45738181 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1081784674 11:45738337-45738359 GACCCCCACCACCTCCCTCCCGG + Intergenic
1081950121 11:47037977-47037999 GACCCCCCCCACCTCCCTCCTGG + Intronic
1082828469 11:57598117-57598139 AATTCCCTCCTCCTCCCTCCTGG - Intronic
1082844764 11:57716842-57716864 GACCCCCCCCACCTCCCTCCTGG + Intronic
1083019319 11:59490163-59490185 GGATCCCTCCTCCTCCCTGCTGG + Intergenic
1083091029 11:60200921-60200943 TGACCCCTCCACCTCCCTCCCGG + Intergenic
1083091168 11:60201244-60201266 GACCCCCCCCACCTCCCTCCCGG + Intronic
1083267351 11:61552862-61552884 GGAAGACTCCTCATCCCTCCAGG + Intronic
1083366383 11:62143904-62143926 GAGCCCCTGCCCATCCCTGCTGG + Intronic
1083382644 11:62279514-62279536 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1083382721 11:62279692-62279714 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1083645631 11:64171347-64171369 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1083645762 11:64171655-64171677 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1083646163 11:64172557-64172579 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1083739625 11:64701890-64701912 GACCCCCCCCACCTCCCTCCCGG - Intronic
1083739674 11:64701989-64702011 GACCCCCCCCACCTCCCTCCCGG - Intronic
1083739747 11:64702165-64702187 TGACCCCTCCACCTCCCTCCCGG - Intronic
1083832084 11:65239514-65239536 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1083865556 11:65451384-65451406 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1084624220 11:70295333-70295355 GACCCCCCCCACCTCCCTCCCGG + Intronic
1084624296 11:70295511-70295533 GACCCCCCCCACCTCCCTCCCGG + Intronic
1084624373 11:70295688-70295710 GACCCCCCCCACCTCCCTCCCGG + Intronic
1084745586 11:71167670-71167692 TGACCCCTCCACCTCCCTCCTGG + Intronic
1084873740 11:72115563-72115585 TAACTCCTACTCATCCCTCAAGG - Intronic
1084924777 11:72502641-72502663 GACCCCCGCCACCTCCCTCCCGG + Intergenic
1084957182 11:72697641-72697663 TAACCCCTCCACAGCCATCCAGG - Exonic
1084967919 11:72753962-72753984 GGACCCCTCCACCTCCCTTCTGG + Intronic
1085111997 11:73897235-73897257 GACCCCCCCCACCTCCCTCCCGG + Intronic
1085292429 11:75410070-75410092 GACCCCCCCCTCCCCCCTCCCGG + Intronic
1085311767 11:75521046-75521068 GGTCTCCTCCTCCTCCCTCCAGG + Intronic
1085359890 11:75877511-75877533 GACCCCCCCCACCTCCCTCCCGG + Intronic
1085413458 11:76305535-76305557 GACCCCCAGCTCACCCCTCCAGG - Intergenic
1085513078 11:77098230-77098252 GACCCCCCCCACCTCCCTCCCGG + Intronic
1085513299 11:77098730-77098752 GACCCCCCCCACCTCCCTCCCGG + Intronic
1085513348 11:77098829-77098851 GACCCCCCCCACCTCCCTCCCGG + Intronic
1086104512 11:83133494-83133516 GAAACCCCCCACCTCCCTCCCGG - Intergenic
1086366177 11:86110964-86110986 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1086447108 11:86879808-86879830 GACCCCCCCCACCTCCCTCCCGG - Intronic
1086512987 11:87580241-87580263 TAACCCCTCTTCTTCTCTCCAGG + Intergenic
1087198196 11:95320989-95321011 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1087948735 11:104194861-104194883 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1087969092 11:104457151-104457173 GAATGCCTCCTCATCCCTGCAGG + Intergenic
1088379023 11:109173021-109173043 GAAGCACTCCTCATGCCCCCAGG - Intergenic
1089421092 11:118331862-118331884 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1089585441 11:119507623-119507645 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1089868496 11:121652158-121652180 AAACTCCTCCTCATTCCTCATGG - Intergenic
1090256899 11:125290920-125290942 TAACCCCTACTCATCCTTCTAGG - Intronic
1090323236 11:125863724-125863746 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1090323315 11:125863902-125863924 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1091300609 11:134504868-134504890 GCACCCATCCTCACTCCTCCAGG - Intergenic
1091378598 12:42111-42133 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1091648355 12:2290693-2290715 GAATCCCTCCTGCTGCCTCCAGG + Intronic
1091654149 12:2333093-2333115 CAACCCCTCCTCTTCCCCCACGG - Intronic
1091762334 12:3095631-3095653 GACCCCCCCCACCTCCCTCCCGG + Intronic
1091857921 12:3753835-3753857 GAAATCCTACTCATCCATCCAGG + Intronic
1092241497 12:6838978-6839000 GAACCTGCCCTCATCCCTCCAGG + Exonic
1092331330 12:7589983-7590005 TGACCCCTCCACCTCCCTCCCGG + Intergenic
1092401850 12:8184333-8184355 GACCCCCCCCACCTCCCTCCTGG - Intronic
1092453800 12:8625730-8625752 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1092453876 12:8625907-8625929 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1092591170 12:9953443-9953465 GACCCCCCCCACCTCCCTCCCGG - Intronic
1092827578 12:12414111-12414133 GACCCCCCCCACCTCCCTCCTGG + Intronic
1092827829 12:12414689-12414711 GACCCCCCCCACCTCCCTCCCGG + Intronic
1094103439 12:26785542-26785564 GACCCCCCCCACCTCCCTCCTGG - Intronic
1094670300 12:32563094-32563116 GACCCCCCCCACCTCCCTCCCGG + Intronic
1094694480 12:32804218-32804240 GAATGCCTCCTCATCCCTAAAGG - Intronic
1094707037 12:32924111-32924133 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1095068550 12:37814469-37814491 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1095068792 12:37815018-37815040 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1095439665 12:42228134-42228156 GACCCCCCCCACCTCCCTCCCGG - Intronic
1095571131 12:43685298-43685320 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1096021985 12:48332466-48332488 GACCCCCTCCACCTCCCTCCCGG + Intergenic
1096022039 12:48332595-48332617 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1096022339 12:48333243-48333265 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1096233926 12:49913079-49913101 CAACCCCACCTCATCACTCGGGG - Intergenic
1096441246 12:51645318-51645340 GAACCCCCCCACCTCCCTCCTGG - Intronic
1096489067 12:52003764-52003786 GTCCCCCTCCTCCTCCCTCCAGG - Intergenic
1096557074 12:52409975-52409997 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1097127964 12:56789457-56789479 TGAGCCCTCCTCCTCCCTCCCGG + Intergenic
1097127989 12:56789510-56789532 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1098412632 12:70201984-70202006 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1098412935 12:70202650-70202672 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1099255222 12:80307439-80307461 GACCCCCCCCACCTCCCTCCTGG + Intronic
1100570398 12:95840773-95840795 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1100570475 12:95840949-95840971 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1100570732 12:95841518-95841540 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1100582052 12:95947511-95947533 GACCCCCCCCACCTCCCTCCCGG - Intronic
1101408780 12:104452542-104452564 GTACCCCTCCTCACCCCACCAGG - Intergenic
1102174665 12:110867127-110867149 GACCCCCCCCACCTCCCTCCCGG + Intronic
1102186227 12:110950771-110950793 GACCCCCACCACCTCCCTCCCGG + Intergenic
1102293905 12:111723194-111723216 TGACCCCCCCTCCTCCCTCCCGG + Intronic
1102547015 12:113664560-113664582 GCCCCCCTCCCCTTCCCTCCTGG + Intergenic
1102578770 12:113872914-113872936 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103457165 12:121076409-121076431 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1103457243 12:121076588-121076610 GACCCCCCCCACTTCCCTCCCGG - Intergenic
1103591305 12:121993832-121993854 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103591442 12:121994140-121994162 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103591522 12:121994319-121994341 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103641729 12:122357494-122357516 GACCCCCCCCACCTCCCTCCTGG - Intronic
1103641753 12:122357544-122357566 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103641858 12:122357801-122357823 GACCCCCCCCACCTCCCTCCCGG - Intronic
1103682918 12:122708887-122708909 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1104814324 12:131637236-131637258 GCAGCCCTCCCCACCCCTCCTGG - Intergenic
1105060517 12:133146162-133146184 GAACCTGTTCTCATCCCTTCAGG - Intronic
1105367732 13:19779267-19779289 GACCCCCCCCACCTCCCTCCCGG - Intronic
1105368061 13:19779995-19780017 GACCCCCCCCACCTCCCTCCCGG - Intronic
1105368140 13:19780173-19780195 GACCCCCCCCACCTCCCTCCCGG - Intronic
1105555996 13:21448178-21448200 GACCCCCCCCACCTCCCTCCCGG - Intronic
1105980386 13:25512736-25512758 GACCCCCCCCACCTCCCTCCCGG + Intronic
1105980509 13:25513011-25513033 GACCCCCCCCACCTCCCTCCCGG + Intronic
1106104869 13:26724178-26724200 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1106495328 13:30270060-30270082 GACCCCCCCCACCTCCCTCCCGG - Intronic
1106560105 13:30839604-30839626 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1106918616 13:34540728-34540750 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1106918686 13:34540876-34540898 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1106918861 13:34541279-34541301 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1106918887 13:34541329-34541351 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1107092331 13:36495376-36495398 GGCCCCCTCCTCAACACTCCTGG - Intergenic
1107165993 13:37280750-37280772 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1107493239 13:40900860-40900882 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1107953239 13:45485233-45485255 GACCCCCCCCACCTCCCTCCCGG + Intronic
1107953316 13:45485411-45485433 GACCCCCCCCACCTCCCTCCCGG + Intronic
1108271307 13:48762315-48762337 GAACTCATCCTCATCCTTCAAGG + Intergenic
1108330483 13:49378750-49378772 GACCCCCCCCACCTCCCTCCCGG - Intronic
1108330539 13:49378879-49378901 GACCCCCCCCACCTCCCTCCCGG - Intronic
1108608819 13:52064435-52064457 GACCCCCCCCACCTCCCTCCCGG - Intronic
1108935037 13:55872667-55872689 GAACCACTCCTCTTGCCTCTAGG - Intergenic
1109539532 13:63755707-63755729 GAATGTCTCCTCATCCCTACAGG + Intergenic
1109544312 13:63824127-63824149 GAATGTCTCCTCATCCCTACAGG - Intergenic
1110228164 13:73141411-73141433 GAAACCCTGCTCAGCCTTCCAGG + Intergenic
1110269337 13:73574840-73574862 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1110269560 13:73575341-73575363 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1110269608 13:73575441-73575463 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1112056034 13:95690920-95690942 GACCCCCCCCACCTCCCTCCCGG + Intronic
1113359275 13:109613949-109613971 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1113478907 13:110606289-110606311 TGACCCCTCCACCTCCCTCCCGG + Intergenic
1113592506 13:111511035-111511057 GAACCCCGCCTAATGCATCCCGG + Intergenic
1113683174 13:112259301-112259323 GAGCACCTTCTCTTCCCTCCAGG - Intergenic
1114165193 14:20212752-20212774 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1114165218 14:20212803-20212825 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1114165291 14:20212954-20212976 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1114165316 14:20213005-20213027 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1114199183 14:20506299-20506321 GACCCCCCCCACCTCCCTCCCGG - Intronic
1114199260 14:20506476-20506498 GACCCCCACCACCTCCCTCCCGG - Intronic
1114199382 14:20506750-20506772 GACCCCCCCCACCTCCCTCCCGG - Intronic
1114199484 14:20506976-20506998 GACCCCCACCACCTCCCTCCCGG - Intronic
1114427694 14:22637268-22637290 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1114427872 14:22637670-22637692 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1115609696 14:35039066-35039088 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1115609819 14:35039341-35039363 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1116480776 14:45390191-45390213 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1116841134 14:49821298-49821320 GACCCCCCCCACCTCCCTCCCGG - Intronic
1116841160 14:49821348-49821370 GACCCCCCCCACCTCCCTCCCGG - Intronic
1118148735 14:63165956-63165978 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1118184211 14:63522846-63522868 GACCCCCCCCACCTCCCTCCTGG - Intronic
1118340893 14:64895077-64895099 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1118340970 14:64895253-64895275 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1118341227 14:64895823-64895845 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1118455389 14:65941574-65941596 GCTCCCCTCCCCATCTCTCCAGG - Intergenic
1118584738 14:67341499-67341521 GACCCCCCCCACCTCCCTCCCGG - Intronic
1118609629 14:67529922-67529944 GATCCCCTCCTCCTGCCTTCAGG - Intronic
1118894221 14:69932261-69932283 GACCCCCTCCTGAGCCCTTCAGG - Intronic
1119254552 14:73184745-73184767 GACCCCCCCCACCTCCCTCCCGG + Intronic
1119532646 14:75373768-75373790 GAAGCCCTCTGCATCCATCCAGG - Intergenic
1119535676 14:75400807-75400829 TAACCCCTTATCATCCCACCAGG + Intergenic
1119868479 14:77993656-77993678 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1120309771 14:82814251-82814273 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1120714337 14:87823992-87824014 GAACTCCTACTCATCCTTCAAGG + Intergenic
1121531625 14:94658246-94658268 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1122212345 14:100181115-100181137 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1122212424 14:100181292-100181314 GACCCCCCCCGCCTCCCTCCCGG - Intergenic
1122362911 14:101177983-101178005 GCTCCCATCCTCAGCCCTCCCGG + Intergenic
1122413117 14:101536009-101536031 GAACTCCTACTCACCCCTCAGGG + Intergenic
1122568243 14:102676732-102676754 GACCCCCCCCACCTCCCTCCCGG + Intronic
1122635573 14:103128121-103128143 TCACCCCTCCTCCTGCCTCCTGG - Intronic
1123493173 15:20799209-20799231 GACCCCCGCCTCTCCCCTCCCGG + Intergenic
1123549679 15:21368311-21368333 GACCCCCGCCTCTCCCCTCCCGG + Intergenic
1123578900 15:21698522-21698544 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1123615527 15:22141004-22141026 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1124560691 15:30770856-30770878 AGTTCCCTCCTCATCCCTCCAGG - Intronic
1125016837 15:34946418-34946440 GACCCCCCCCACCTCCCTCCCGG - Intronic
1125016909 15:34946566-34946588 GACCCCCCCCACCTCCCTCCCGG - Intronic
1125017037 15:34946873-34946895 GACCCCCCCCACCTCCCTCCCGG - Intronic
1125240144 15:37564991-37565013 AAACCCCTCCCCCTCCCTGCTGG + Intergenic
1125440702 15:39700234-39700256 GAAACCCTACTCATTCCTCAAGG + Intronic
1125659165 15:41382493-41382515 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1125659566 15:41383396-41383418 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1125728339 15:41879534-41879556 GGACACCTCCCCATCCATCCGGG + Intronic
1126098501 15:45105923-45105945 AAACTCCTCCCCATCCATCCAGG + Intronic
1126125691 15:45293090-45293112 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1126516946 15:49549914-49549936 GACCCCCCCCACCTCCCTCCCGG + Intronic
1126799487 15:52286303-52286325 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127073235 15:55303646-55303668 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127073315 15:55303824-55303846 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127154317 15:56110357-56110379 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127154394 15:56110529-56110551 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127154472 15:56110706-56110728 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127154575 15:56110961-56110983 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127303136 15:57677186-57677208 CTAACCCTCCTCATCCCCCCGGG - Intronic
1127584272 15:60366662-60366684 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127584531 15:60367204-60367226 GACCCCCCCCACCTCCCTCCCGG - Intronic
1127824216 15:62689934-62689956 GACCCCCCCCACCTCCCTCCCGG + Intronic
1128586955 15:68859833-68859855 GACCCCCCCCACCTCCCTCCGGG + Intronic
1128587112 15:68860186-68860208 GACCCCCCCCACCTCCCTCCGGG + Intronic
1128716771 15:69914311-69914333 GCAGCCCTCCTCTTACCTCCTGG + Intergenic
1128970185 15:72100857-72100879 GACCCCCCCCACCTCCCTCCCGG - Intronic
1128970210 15:72100906-72100928 GACCCCCCCCACCTCCCTCCCGG - Intronic
1129428584 15:75481689-75481711 GACCCCCCCCACCTCCCTCCCGG - Intronic
1129431675 15:75504467-75504489 TGACCCCTCCACCTCCCTCCCGG - Intronic
1129431691 15:75504499-75504521 GACCCCCCCCACCTCCCTCCCGG - Intronic
1129976327 15:79825007-79825029 GAACCCTTTCTCACCCCTGCTGG - Intergenic
1129976480 15:79826471-79826493 GAACCCTTTCTCACCCCTGCTGG - Intergenic
1130306568 15:82715563-82715585 CACCCCCTCCTCAATCCTCCTGG + Intergenic
1130344858 15:83033683-83033705 GATCCCCACCTCAGCCCCCCAGG + Intronic
1130946142 15:88552356-88552378 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1130946245 15:88552582-88552604 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1130946299 15:88552710-88552732 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1131001253 15:88941560-88941582 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1131001378 15:88941838-88941860 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1131043844 15:89296970-89296992 GACCCCCCCCACCTCCCTCCCGG + Intronic
1131095919 15:89654443-89654465 CCAAGCCTCCTCATCCCTCCCGG + Intronic
1131125466 15:89854507-89854529 GACCCCCCCCACCTCCCTCCCGG - Intronic
1131125492 15:89854557-89854579 GACCCCCCCCACCTCCCTCCCGG - Intronic
1131127207 15:89867908-89867930 GACCCCCCCCACCTCCCTCCCGG - Intronic
1131127386 15:89868328-89868350 TGACCCCTCCACCTCCCTCCCGG - Intronic
1202958010 15_KI270727v1_random:95529-95551 GACCCCCGCCTCTCCCCTCCCGG + Intergenic
1202987770 15_KI270727v1_random:432767-432789 CAAACCCTTCTCATGCCTCCTGG - Intergenic
1132776770 16:1599310-1599332 GACCCCCCCCACCTCCCTCCCGG - Intronic
1132776921 16:1599637-1599659 GACCCCCCCCACCTCCCTCCCGG - Intronic
1132982395 16:2745217-2745239 CAAGCCCTCCTCAGCCCTGCAGG + Intergenic
1132992224 16:2802021-2802043 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1133364966 16:5202800-5202822 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1134269725 16:12723026-12723048 GAATCCTTCCTCATCAGTCCAGG + Intronic
1134275684 16:12774134-12774156 GAATGCCTCCTCATCCCTGGCGG - Intronic
1135026551 16:19003393-19003415 GACCCCCCCCACCTCCCTCCCGG - Intronic
1135493984 16:22935676-22935698 GCAGCCCTCTTCATTCCTCCAGG + Intergenic
1136160594 16:28416742-28416764 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136160650 16:28416871-28416893 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136160703 16:28417000-28417022 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136160784 16:28417178-28417200 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136202183 16:28697822-28697844 GACCCCCCCCACCTCCCTCCCGG + Intronic
1136202264 16:28698000-28698022 GACCCCCCCCACCTCCCTCCCGG + Intronic
1136202318 16:28698129-28698151 GACCCCCCCCACCTCCCTCCCGG + Intronic
1136202490 16:28698532-28698554 GACCCCCCCCACCTCCCTCCCGG + Intronic
1136425788 16:30168988-30169010 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136425956 16:30169363-30169385 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136425982 16:30169413-30169435 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136572157 16:31104488-31104510 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136572286 16:31104792-31104814 GACCCCCACCACCTCCCTCCCGG - Intergenic
1136572518 16:31105320-31105342 GACCCCCCCCACTTCCCTCCCGG - Intergenic
1136583644 16:31169665-31169687 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1136633730 16:31505787-31505809 GAACACTTCCTCATCCCTAGAGG + Intronic
1137060916 16:35791193-35791215 GTACCCCTCCACAGCACTCCTGG - Intergenic
1137283896 16:47000313-47000335 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1137303988 16:47181438-47181460 GACCCCCCCCACCTCCCTCCCGG - Intronic
1137446464 16:48535412-48535434 GGACCCCTCCGGCTCCCTCCTGG - Intergenic
1138101342 16:54254469-54254491 AATCCCCTACTCACCCCTCCCGG - Intronic
1138400177 16:56739348-56739370 GACCCCCCCCACCTCCCTCCCGG + Intronic
1138400456 16:56739949-56739971 GACCCCCCCCACCTCCCTCCCGG + Intronic
1138605678 16:58086677-58086699 GGCCCCCTCATCCTCCCTCCAGG - Intergenic
1138642374 16:58396567-58396589 GATCCCCCCCACCTCCCTCCCGG + Intronic
1139672455 16:68501039-68501061 GACCCCATCCTCATGCCTCTTGG + Intergenic
1139864205 16:70051140-70051162 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1139864663 16:70052187-70052209 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1139885691 16:70205314-70205336 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1140986659 16:80164348-80164370 CAACCCCTGCTCATCTCTACAGG + Intergenic
1141755596 16:85988677-85988699 GGAACCCTCCTCATGCCCCCTGG - Intergenic
1142473046 17:173706-173728 CAACTCCTACTCATCCCTCATGG - Intronic
1142508378 17:380325-380347 GAAGCCCTTCTCATCCCTCCCGG + Intronic
1142508385 17:380347-380369 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508391 17:380369-380391 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508399 17:380391-380413 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508405 17:380413-380435 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508427 17:380479-380501 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508435 17:380501-380523 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508443 17:380523-380545 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508453 17:380545-380567 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508461 17:380567-380589 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508469 17:380589-380611 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508479 17:380611-380633 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508487 17:380633-380655 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508494 17:380655-380677 GAAGCCCCCCTCATCCCTCCCGG + Intronic
1142508504 17:380677-380699 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508517 17:380718-380740 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508523 17:380740-380762 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508531 17:380762-380784 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508539 17:380784-380806 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508546 17:380806-380828 GAAGCCCCCCTCATGCTTCCCGG + Intronic
1142508554 17:380829-380851 AAGCCCCCCCTCATCCCTCCCGG + Intronic
1142508565 17:380851-380873 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508573 17:380873-380895 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508583 17:380895-380917 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508591 17:380917-380939 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508609 17:380964-380986 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508615 17:380986-381008 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508629 17:381027-381049 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508635 17:381049-381071 GATGCCCTCCACATCCCTCCCGG + Intronic
1142508643 17:381071-381093 GAAGCCCTCCACATCCCTCCCGG + Intronic
1142508651 17:381093-381115 GAAGCCGTCCTCATCCCTCCCGG + Intronic
1142508658 17:381115-381137 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508666 17:381137-381159 GAAGCCCTCCTCATGCCTCCCGG + Intronic
1142508682 17:381181-381203 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508704 17:381229-381251 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508710 17:381251-381273 GAACCCCTCCTCATCCCTCCCGG + Intronic
1142508719 17:381273-381295 GAAGCCCCCCTCATGCCTCCCGG + Intronic
1142508728 17:381295-381317 GAAGCCCCCCACATCCCTCCCGG + Intronic
1142508738 17:381317-381339 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508755 17:381361-381383 GAAGCCCTGCTCATCCCTCCCGG + Intronic
1142508777 17:381410-381432 GAAGCCCTCCTCATGCTTCCCGG + Intronic
1142508783 17:381432-381454 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508791 17:381454-381476 GAAGCCCTCCTCATCCCTCCCGG + Intronic
1142508799 17:381476-381498 GAAGCCGTCCTCATGCCTCCCGG + Intronic
1142508810 17:381520-381542 GAAGCCCTCCTCATACCTCCCGG + Intronic
1142597092 17:1035239-1035261 GGACCCCTCCTCATCTCTGCTGG + Intronic
1142818587 17:2447436-2447458 GACCCCCCCCACCTCCCTCCCGG - Intronic
1142818639 17:2447564-2447586 GACCCCCCCCACCTCCCTCCTGG - Intronic
1142818788 17:2447887-2447909 GACCCCCCCCACCTCCCTCCCGG - Intronic
1144003000 17:11072975-11072997 ACATCCCTCCTCCTCCCTCCTGG + Intergenic
1144717001 17:17442611-17442633 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144717027 17:17442664-17442686 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144717053 17:17442714-17442736 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144717174 17:17442990-17443012 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144717200 17:17443040-17443062 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144717226 17:17443090-17443112 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1144934762 17:18888654-18888676 GACCCCCCCCACCTCCCTCCCGG + Intronic
1144934788 17:18888705-18888727 GACCCCCCCCACCTCCCTCCCGG + Intronic
1144957827 17:19028307-19028329 GAACTCCTACTCATGCCTCAAGG + Intronic
1144977331 17:19146213-19146235 GAACTCCTACTCATGCCTCAAGG - Intronic
1145022326 17:19441722-19441744 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145047123 17:19627720-19627742 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1145047249 17:19627995-19628017 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1145205824 17:20984576-20984598 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145205872 17:20984675-20984697 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145206272 17:20985560-20985582 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145418163 17:22741406-22741428 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145717227 17:27034009-27034031 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145733674 17:27212244-27212266 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145733729 17:27212371-27212393 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1145862983 17:28224267-28224289 GGACCCCCCCACCTCCCTCCCGG - Intergenic
1146155919 17:30523561-30523583 GATCCCCCCCACCTCCCTCCCGG - Exonic
1146215955 17:30979493-30979515 GACCCCCCCCACCTCCCTCCCGG + Intronic
1146216031 17:30979663-30979685 GATCCCCCCCACCTCCCTCCCGG + Intronic
1146216056 17:30979713-30979735 GACCCCCCCCACCTCCCTCCCGG + Intronic
1146216400 17:30980502-30980524 GACCCCCCCCACCTCCCTCCCGG + Intronic
1146444489 17:32923003-32923025 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1147169226 17:38608480-38608502 GTATCCCTTCTCACCCCTCCAGG - Intergenic
1147172668 17:38631103-38631125 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1147785171 17:42973356-42973378 GACCCCCCCCACTTCCCTCCCGG - Intronic
1149624905 17:58073988-58074010 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1149630346 17:58116696-58116718 AGACCCCTCCCCTTCCCTCCAGG - Intergenic
1149632251 17:58136031-58136053 CAACATCTCCTCATCTCTCCAGG - Intergenic
1149908885 17:60551410-60551432 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1149909247 17:60552234-60552256 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1150449155 17:65251396-65251418 GAACCCCTCCCACTCCCTCCTGG - Intergenic
1150527342 17:65937554-65937576 GACCCCCCCCACCTCCCTCCCGG - Intronic
1150703887 17:67470564-67470586 GACCCCCCCCACCTCCCTCCCGG - Intronic
1151042736 17:70882644-70882666 GTGCCCCTCCTCCTCCCTCTTGG - Intergenic
1151422813 17:74009659-74009681 AAGCCCCTCCTCCTTCCTCCGGG - Intergenic
1151776157 17:76204282-76204304 GAAATCCTACTTATCCCTCCAGG + Intronic
1152077363 17:78168102-78168124 GACCCCCTCCCCATTCCTCCTGG - Intergenic
1152088890 17:78236285-78236307 GAACCCTTGCTCCTCCCACCAGG - Intronic
1152288344 17:79425028-79425050 TAACCCCTCCACAAGCCTCCTGG + Intronic
1152390531 17:80001487-80001509 GAACCCCCGCCCACCCCTCCGGG - Intronic
1152696188 17:81798002-81798024 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1153847046 18:9059599-9059621 AACCCTCTCCTCATCCCTCTAGG + Intergenic
1155749084 18:29398012-29398034 GGACCCCTCCTCACTCCACCAGG + Intergenic
1155863337 18:30932316-30932338 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1156200628 18:34827514-34827536 AAACTCTCCCTCATCCCTCCAGG - Intronic
1156375074 18:36506879-36506901 GAATGCCTCCTCATCCCTAGAGG + Intronic
1156437754 18:37151974-37151996 GAAGCTCTCTTCATCCCTCTGGG - Intronic
1156538117 18:37883308-37883330 ATACCCCACCTCATCCCTGCTGG - Intergenic
1156827484 18:41448937-41448959 GAACCACTGCTCATCACTCTGGG + Intergenic
1157629449 18:49080641-49080663 GACCCCCCCCACCTCCCTCCCGG + Intronic
1158148771 18:54343757-54343779 GACCCCCCCCACCTCCCTCCCGG - Intronic
1158232150 18:55269023-55269045 CAACTCCACCTCTTCCCTCCAGG + Intronic
1159054436 18:63450403-63450425 GACCCCCACCACCTCCCTCCCGG + Intergenic
1159694798 18:71542487-71542509 GAATGCCTCCTCATCCCTACAGG + Intergenic
1159935510 18:74363646-74363668 GACCCCCTCATCATCCCTGGTGG + Intergenic
1160033309 18:75280898-75280920 GGGCCCTCCCTCATCCCTCCAGG - Intronic
1160108324 18:76001274-76001296 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1160389823 18:78521652-78521674 GAAGAGCTCCTCCTCCCTCCAGG + Intergenic
1160586284 18:79915287-79915309 CACCCCCTCCGCATCCCCCCAGG + Intronic
1161227137 19:3151907-3151929 AAACTCCTACTCATCCCTCAGGG - Intronic
1161567740 19:5012923-5012945 CAACCCCTCGTCTTCCCTCCTGG + Intronic
1161790241 19:6355608-6355630 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1161862892 19:6811586-6811608 GAACTCCTACTCATCCTTCAAGG - Intronic
1162065628 19:8123736-8123758 GTGCCCCTCCCCATCCTTCCAGG + Intronic
1162207983 19:9070308-9070330 GCACCTCTCCTCCACCCTCCAGG - Intergenic
1162396441 19:10420410-10420432 GCCCCCCTCCTCCTCCGTCCGGG - Intronic
1162714535 19:12621754-12621776 GACCCCCCCCACCTCCCTCCCGG - Intronic
1163001707 19:14372351-14372373 CAACCCCTCCGCATGCCTCTGGG - Intergenic
1163064618 19:14784008-14784030 CAACCCCTCCGCATGCCTCTGGG + Intergenic
1163143182 19:15363470-15363492 GACCCCCCCCACCTCCCTCCCGG - Intronic
1163314455 19:16532536-16532558 GCGCTCCTCCTCAACCCTCCTGG - Intronic
1163497018 19:17652531-17652553 GAACCCCTCCTCCTCCTCTCTGG + Intronic
1163542284 19:17918503-17918525 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1163765387 19:19160803-19160825 GGACCCCTCCTCCCCTCTCCTGG + Intronic
1163831336 19:19548517-19548539 GAATCCCACCCCCTCCCTCCTGG + Intergenic
1163905598 19:20149406-20149428 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1163913111 19:20214596-20214618 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1163913160 19:20214693-20214715 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1163921800 19:20296577-20296599 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1163945236 19:20529863-20529885 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164034731 19:21443573-21443595 GCACCCCCCCACCTCCCTCCTGG + Intronic
1164066464 19:21721202-21721224 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1164066719 19:21721773-21721795 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1164071857 19:21776012-21776034 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1164105595 19:22106741-22106763 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164105748 19:22107098-22107120 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164106069 19:22107823-22107845 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164192463 19:22926960-22926982 ACACCCCTCCACCTCCCTCCCGG - Intergenic
1164192517 19:22927090-22927112 GACCCCCCCCGCCTCCCTCCCGG - Intergenic
1164192671 19:22927443-22927465 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1164192827 19:22927799-22927821 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1164192875 19:22927899-22927921 ACACCCCTCCACCTCCCTCCCGG - Intergenic
1164298379 19:23937089-23937111 GACCCCCCCCACCTCCCTCCCGG + Intronic
1164298428 19:23937188-23937210 TGACCCCTCCACCTCCCTCCCGG + Intronic
1164652308 19:29899200-29899222 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164652485 19:29899603-29899625 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1164652852 19:29900412-29900434 CAACCCCCCCACCTCCCTCCCGG + Intergenic
1165192959 19:34079495-34079517 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1165193051 19:34079692-34079714 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1165295378 19:34922112-34922134 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1165861567 19:38911943-38911965 CATCCCCTCCCCATCCCACCCGG + Intronic
1166028152 19:40107813-40107835 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1166028229 19:40107991-40108013 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1166029807 19:40118076-40118098 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1166030053 19:40118626-40118648 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1166030133 19:40118804-40118826 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1166162533 19:40965271-40965293 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1166180291 19:41103371-41103393 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1166180316 19:41103421-41103443 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1166661123 19:44647823-44647845 ATACCCCTCCTCCTCCCTCAGGG - Intronic
1166674808 19:44733642-44733664 GCACCCCTCCCCATCCCAACAGG + Intergenic
1166720524 19:44993396-44993418 GAAAGCCACCTCATCCCTGCTGG - Intergenic
1167970650 19:53186883-53186905 GACCCCCCCCACCTCCCTCCCGG + Intronic
1167970748 19:53187103-53187125 GACCCCCCCCACCTCCCTCCCGG + Intronic
1167970799 19:53187202-53187224 GACCCCCCCCACCTCCCTCCCGG + Intronic
1167971026 19:53187722-53187744 GACCCCCCCCACCTCCCTCCCGG + Intronic
1168658482 19:58147756-58147778 GACCCCCCCCACCTCCCTCCCGG - Intronic
925403197 2:3590486-3590508 GACCCCCCCCACCTCCCTCCCGG + Intergenic
925403276 2:3590663-3590685 GACCCCCCCCACCTCCCTCCCGG + Intergenic
925403602 2:3591386-3591408 GACCCCCCCCACCTCCCTCCCGG + Intergenic
925720514 2:6822208-6822230 GACCCCCACCCCATCCCGCCTGG + Intergenic
926190877 2:10726733-10726755 GGAGCCCGCCTGATCCCTCCTGG + Intronic
926215328 2:10902629-10902651 TAACCCCCCCACCTCCCTCCCGG + Intergenic
926625416 2:15085991-15086013 GGACCCCACCCCTTCCCTCCAGG - Intergenic
926639543 2:15220082-15220104 GACCCCCCCCACCTCCCTCCTGG + Intronic
926667484 2:15541791-15541813 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667509 2:15541841-15541863 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667534 2:15541891-15541913 GAACCCCCCCACCTCCCTCCCGG - Intronic
926667583 2:15541990-15542012 GAACCCCCCCACCTCCCTCCCGG - Intronic
926675016 2:15612140-15612162 GACCCCCCCCACCTCCCTCCTGG + Intronic
926723710 2:15981785-15981807 GAAATCCTACTCTTCCCTCCAGG + Intergenic
927287765 2:21374556-21374578 TAAGCACTCCTCATCTCTCCAGG - Intergenic
927333301 2:21891406-21891428 GATCCCCTCTCCGTCCCTCCCGG + Intergenic
927462131 2:23308325-23308347 GAAACCTCCCTCATCCCTCCAGG - Intergenic
927897714 2:26795330-26795352 TGACCCCTCCTCCTCCCTCCCGG + Intronic
928002914 2:27539870-27539892 GATCCCCCCCACCTCCCTCCCGG + Intronic
928003095 2:27540271-27540293 GACCCCCACCACCTCCCTCCCGG + Intronic
928005211 2:27557597-27557619 GACCCCCCCCACCTCCCTCCCGG + Intronic
928005310 2:27557817-27557839 GACCCCCCCCACCTCCCTCCCGG + Intronic
928005415 2:27558043-27558065 GACCCCCCCCACCTCCCTCCCGG + Intronic
928542044 2:32293894-32293916 GACCCCCCCCACCTCCCTCCCGG + Intronic
928558044 2:32447705-32447727 GACCCCCCCCACCTCCCTCCTGG + Intronic
928585496 2:32754826-32754848 GACCCCCCCCACCTCCCTCCCGG + Intronic
928585522 2:32754877-32754899 GACCCCCCCCACCTCCCTCCCGG + Intronic
928597136 2:32869134-32869156 GACCCCCCCCACCTCCCTCCCGG - Intergenic
928597214 2:32869312-32869334 GACCCCCCCCACCTCCCTCCCGG - Intergenic
928597240 2:32869363-32869385 GACCCCCCCCACCTCCCTCCCGG - Intergenic
928597317 2:32869541-32869563 GACCCCCCCCACCTCCCTCCCGG - Intergenic
928597395 2:32869719-32869741 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929061904 2:37932690-37932712 GACCCCCCCCACCTCCCTCCCGG + Intronic
929151874 2:38755885-38755907 GACCCCCCCCACCTCCCTCCTGG + Intronic
929416135 2:41747199-41747221 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929416237 2:41747425-41747447 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929416315 2:41747603-41747625 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929416341 2:41747654-41747676 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929416417 2:41747832-41747854 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929416443 2:41747883-41747905 GACCCCCCCCACCTCCCTCCCGG - Intergenic
929515803 2:42605216-42605238 GACCCCCCCCACCTCCCTCCCGG + Intronic
929739772 2:44588810-44588832 GACCCCCCCCACCTCCCTCCCGG - Intronic
929922127 2:46180170-46180192 GGAACCCTCCTCATCCCTCCAGG - Intronic
930201477 2:48555323-48555345 GACCCCCCCCACCTCCCTCCCGG + Intronic
930201531 2:48555452-48555474 GACCCCCCCCACCTCCCTCCCGG + Intronic
930396301 2:50828274-50828296 GACCCCCCCCACCTCCCTCCCGG + Intronic
930833795 2:55773566-55773588 GACCCCCCCCACCTCCCTCCCGG + Intergenic
931656069 2:64511851-64511873 GACCCCCCCCACCTCCCTCCCGG + Intergenic
931656272 2:64512319-64512341 GACCCCCCCCACCTCCCTCCCGG + Intergenic
932340692 2:70961135-70961157 GCTCCCATCCTCACCCCTCCTGG - Intronic
932411819 2:71551907-71551929 GAGCCTCTGATCATCCCTCCAGG - Intronic
932592882 2:73077721-73077743 GAAGCCTTCCTGATTCCTCCAGG + Intronic
932710600 2:74061146-74061168 GACCCCCCCCACTTCCCTCCCGG + Intronic
932770479 2:74498318-74498340 GACCCCCTCCCTATCCCTACAGG - Exonic
932807484 2:74796123-74796145 GACCCCCCCCACCTCCCTCCCGG + Intergenic
933289325 2:80420368-80420390 GGATCCATCCTCATCCCTCCTGG - Intronic
933791442 2:85887046-85887068 GACACCCACCTCAGCCCTCCAGG + Intronic
934309679 2:91851929-91851951 GACCCCCCCCACCTCCCTCCCGG - Intergenic
934703756 2:96462285-96462307 GACCCCCCCCACCTCCCTCCCGG - Intergenic
934703835 2:96462463-96462485 GACCCCCCCCACCTCCCTCCCGG - Intergenic
934763252 2:96867748-96867770 GACTTCCTCCTCACCCCTCCAGG + Intronic
935498595 2:103810880-103810902 TAACCCCTGCTCCTCCCTGCAGG + Intergenic
935630659 2:105210773-105210795 GAACTCCCCCACCTCCCTCCCGG + Intergenic
935630680 2:105210820-105210842 GGACCCCCCCACCTCCCTCCCGG + Intergenic
936546130 2:113394337-113394359 GACCCCCCCCACCTCCCTCCCGG - Intergenic
936546376 2:113394886-113394908 GACCCCCCCCACCTCCCTCCCGG - Intergenic
936546532 2:113395239-113395261 GACCCCCCCCACCTCCCTCCCGG - Intergenic
937241015 2:120462834-120462856 GAACCCCTCAACAACCCTCTGGG + Intergenic
937437715 2:121893137-121893159 GACCCCCCCCACCTCCCTCCCGG - Intergenic
937947518 2:127353555-127353577 GACCCCCCCCACCTCCCTCCCGG - Intronic
937947543 2:127353605-127353627 GACCCCCCCCACCTCCCTCCCGG - Intronic
938005558 2:127787489-127787511 GACCCCCCCCACCTCCCTCCCGG + Intronic
938005886 2:127788248-127788270 GACCCCCCCCACCTCCCTCCCGG + Intronic
938005962 2:127788425-127788447 GACCCCCCCCACCTCCCTCCCGG + Intronic
938088782 2:128418553-128418575 GACCCCCCCCACCTCCCTCCCGG + Intergenic
938096441 2:128467192-128467214 GAACCCTTCCCCATCCACCCAGG + Intergenic
938698248 2:133853995-133854017 GAAACCTTCTTCATGCCTCCAGG - Intergenic
939041631 2:137196239-137196261 GAATGCCTCCTCATCCCTAGAGG + Intronic
939458688 2:142470425-142470447 TAACCCCTCCTCATCCCATTTGG - Intergenic
939578542 2:143922263-143922285 GACCCCCCCCACCTCCCTCCCGG + Intergenic
940269517 2:151875624-151875646 TGACCCCTCCACCTCCCTCCCGG + Intronic
940643285 2:156368417-156368439 GACCCCCCCCACCTCCCTCCCGG - Intergenic
940643338 2:156368545-156368567 GACCCCCCCCACCTCCCTCCCGG - Intergenic
940643411 2:156368692-156368714 GACCCCCCCCACCTCCCTCCCGG - Intergenic
941602906 2:167563411-167563433 TGACCCCTCCACCTCCCTCCCGG + Intergenic
941602953 2:167563538-167563560 GACCCCCCCCACCTCCCTCCCGG + Intergenic
941769160 2:169327969-169327991 TAACCCCCCCACCTCCCTCCCGG - Intronic
941814412 2:169785659-169785681 GACCCCCCCCACCTCCCTCCCGG + Intergenic
941814492 2:169785840-169785862 GACCCCCCCCACCTCCCTCCCGG + Intergenic
941814568 2:169786018-169786040 GACCCCCCCCACCTCCCTCCCGG + Intergenic
941814772 2:169786471-169786493 GACCCCCCCCACCTCCCTCCCGG + Intergenic
941827454 2:169916466-169916488 GACACCCTCCTCATCCTGCCTGG + Intronic
942020979 2:171866766-171866788 GACCCCCCCCACCTCCCTCCCGG + Intronic
942024756 2:171900143-171900165 GACCCCCCCCACCTCCCTCCCGG - Intronic
942024832 2:171900319-171900341 GACCCCCCCCACCTCCCTCCCGG - Intronic
942621002 2:177845170-177845192 GACCCCCCCCACCTCCCTCCCGG + Intronic
942630180 2:177945715-177945737 GACCCCCCCCACCTCCCTCCCGG - Intronic
942630452 2:177946315-177946337 GACCCCCCCCACCTCCCTCCCGG - Intronic
942630612 2:177946672-177946694 GACCCCCCCCACCTCCCTCCCGG - Intronic
942630638 2:177946722-177946744 GACCCCCCCCACCTCCCTCCCGG - Intronic
942630688 2:177946821-177946843 GACCCCCCCCACCTCCCTCCCGG - Intronic
943297151 2:186154110-186154132 GACCCCCCCCACCTCCCTCCCGG + Intergenic
943323477 2:186473105-186473127 GACCCCCCCCACCTCCCTCCCGG - Intergenic
943323674 2:186473558-186473580 GATCCCCCCCACCTCCCTCCCGG - Intergenic
943773669 2:191742625-191742647 GACCCCCCCCACCTCCCTCCCGG - Intergenic
944060958 2:195568537-195568559 GACCCCCCCCACCTCCCTCCCGG - Intergenic
944255437 2:197619122-197619144 GACCCCCCCCACCTCCCTCCCGG - Intronic
944262983 2:197696238-197696260 GACCCCCCCCACCTCCCTCCCGG + Intronic
944263102 2:197696510-197696532 GACCCCCCCCACCTCCCTCCCGG + Intronic
944283522 2:197923257-197923279 GACCCCCCCCACCTCCCTCCCGG + Intronic
944360306 2:198846966-198846988 GAAACTCTCCTCTTCCCTTCTGG - Intergenic
944533038 2:200683934-200683956 GACCCCCCCCACCTCCCTCCCGG + Intergenic
944598497 2:201282997-201283019 GACCCCCCCCACCTCCCTCCCGG + Intronic
944598852 2:201283818-201283840 GACCCCCCCCACCTCCCTCCCGG + Intronic
944733022 2:202535184-202535206 GACCCCCCCCACCTCCCTCCCGG + Intronic
945038006 2:205720795-205720817 CAGCCCCAGCTCATCCCTCCAGG + Intronic
945110337 2:206356278-206356300 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945114806 2:206400641-206400663 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945114833 2:206400692-206400714 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945232978 2:207610651-207610673 GACCCCCCCCACCTCCCTCCCGG - Exonic
945233185 2:207611129-207611151 GACCCCCCCCACCTCCCTCCCGG - Exonic
945560923 2:211338946-211338968 AAATACCTCCTCATGCCTCCTGG + Intergenic
945835691 2:214835272-214835294 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945835794 2:214835496-214835518 GACCCCCTCCACCTCCCTCCCGG + Intergenic
945970185 2:216226174-216226196 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945970261 2:216226350-216226372 GACCCCCCCCACCTCCCTCCCGG + Intergenic
945970418 2:216226697-216226719 GACCCCCCCCACCTCCCTCCCGG + Intergenic
946318298 2:218931963-218931985 GACCCCCCCCACCTCCCTCCTGG - Intergenic
946751021 2:222896158-222896180 TGACCCCTCCACCTCCCTCCCGG + Intronic
946751168 2:222896477-222896499 GACCCCCCCCACCTCCCTCCCGG + Intronic
946984370 2:225255802-225255824 GAACATGTCCTCATCCCTCAGGG + Intergenic
947742146 2:232489571-232489593 CATCCCTTCCTCCTCCCTCCCGG + Intergenic
947742533 2:232491170-232491192 GAACCCCTCCTCACCCCTCACGG + Intergenic
947901365 2:233724339-233724361 GACCCCCCCCACCTCCCTCCCGG + Intronic
948377276 2:237529842-237529864 GAGCCCCTCCTCCCTCCTCCTGG + Intronic
948683487 2:239654676-239654698 GAAACCCTCCACATCCCTAGAGG - Intergenic
1169085686 20:2823923-2823945 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1169085943 20:2824499-2824521 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1169085996 20:2824626-2824648 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1169086069 20:2824802-2824824 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1169168062 20:3441210-3441232 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1169208754 20:3754224-3754246 GGACCCCTCCCCTTCCCTCAGGG + Intronic
1169370990 20:5028015-5028037 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1170104108 20:12735307-12735329 GATCTGCTCCTCATCTCTCCTGG - Intergenic
1170248204 20:14247853-14247875 GAATTCCTCCTCATCCCTATAGG + Intronic
1170623075 20:18010573-18010595 GACCCCCCCCACCTCCCTCCCGG + Intronic
1170811462 20:19678339-19678361 GACCCCCCCCACCTCCCTCCCGG + Intronic
1171848372 20:30291613-30291635 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1171861614 20:30405917-30405939 TGACCCCTCCACCTCCCTCCCGG - Intergenic
1171957243 20:31471056-31471078 GACCCCCCCCACCTCCCTCCCGG + Intronic
1171957353 20:31471314-31471336 GACCCCCCCCACCTCCCTCCCGG + Intronic
1171957427 20:31471461-31471483 GACCCCCCCCACCTCCCTCCCGG + Intronic
1172033224 20:31995770-31995792 CATCCCCTCCTCCTCCCTACAGG + Intronic
1172051596 20:32122305-32122327 GACCCCCCCCACCTCCCTCCCGG + Intronic
1172103032 20:32497194-32497216 GAAACCCTCCTGCACCCTCCAGG + Intronic
1172160756 20:32866507-32866529 GAAGCCTTCCCCACCCCTCCAGG - Intronic
1172209090 20:33185144-33185166 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1172402014 20:34658935-34658957 TGACCCCTCCGCCTCCCTCCCGG - Intronic
1172426604 20:34860077-34860099 GGACCCCTCCTCATTCCCCCAGG - Intronic
1172465751 20:35154092-35154114 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1172721052 20:37000452-37000474 GACCCCCCCCACCTCCCTCCCGG - Intronic
1172721284 20:37001011-37001033 GACCCCCCCCACCTCCCTCCCGG - Intronic
1172728927 20:37069734-37069756 GACCCCCCCCACCTCCCTCCCGG - Intronic
1172819468 20:37718591-37718613 GACCCCCCCCACCTCCCTCCCGG + Intronic
1173859034 20:46270034-46270056 GAACCCCTACTTATCCTTCAAGG - Intronic
1174020456 20:47525565-47525587 GACCCCCCCCACCTCCCTCCTGG + Intronic
1174020506 20:47525665-47525687 GACCCCCCCCACCTCCCTCCCGG + Intronic
1174218813 20:48936300-48936322 GACCCCCCCCACCTCCCTCCCGG + Intronic
1174344942 20:49922433-49922455 TGACCCCCCCACATCCCTCCCGG - Intergenic
1174344967 20:49922482-49922504 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1174878382 20:54250692-54250714 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1175264779 20:57695986-57696008 GACTCTCTCCTCACCCCTCCTGG + Intronic
1175361388 20:58414324-58414346 GACCCCCCCCACCTCCCTCCCGG + Intronic
1175538245 20:59730273-59730295 GAACTCCTATTCATCCCTCATGG - Intronic
1175626469 20:60492346-60492368 GAAGCCCTCCAGATCCCTCCTGG + Intergenic
1176445513 21:6816828-6816850 GACCCCCGCCTCTCCCCTCCCGG - Intergenic
1176823681 21:13681861-13681883 GACCCCCGCCTCTCCCCTCCCGG - Intergenic
1177178146 21:17719811-17719833 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1177178394 21:17720363-17720385 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1178075573 21:29011575-29011597 GACCCCCCCCACCTCCCTCCCGG - Intronic
1179821649 21:43940490-43940512 GAACTCATTCTGATCCCTCCTGG + Intronic
1181033633 22:20159690-20159712 GGCCCCCTCCTGATCACTCCTGG - Intergenic
1181084169 22:20431680-20431702 GGACCCCGCCCCATCTCTCCAGG + Intronic
1181509676 22:23383555-23383577 GGCCCCCTCCTGATCACTCCTGG + Intergenic
1181586140 22:23854669-23854691 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1181586366 22:23855168-23855190 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1181586468 22:23855393-23855415 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1181657819 22:24317264-24317286 GACCCCCCCCACCTCCCTCCCGG + Intronic
1181657844 22:24317314-24317336 GACCCCCCCCACCTCCCTCCCGG + Intronic
1182538996 22:31027313-31027335 GACCCCCACCACCTCCCTCCCGG - Intergenic
1182539150 22:31027663-31027685 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1182569429 22:31225525-31225547 CAACCTCTGCTCATCTCTCCAGG - Intronic
1182616133 22:31591600-31591622 GACCCCCCCCACCTCCCTCCCGG + Intronic
1182616211 22:31591778-31591800 GACCCCCCCCACCTCCCTCCCGG + Intronic
1182616464 22:31592359-31592381 GACCCCCCCCACCTCCCTCCCGG + Intronic
1182976217 22:34626004-34626026 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1183135928 22:35887629-35887651 AAACCACTTCTCTTCCCTCCAGG + Intronic
1183500368 22:38175219-38175241 GAGCCCCTGCTCATCCTTCAAGG + Intronic
1183595257 22:38807191-38807213 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1183595431 22:38807593-38807615 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1183665120 22:39242526-39242548 GAGCCCCGCGTCCTCCCTCCCGG + Intronic
1183754921 22:39752804-39752826 GCAGCCTTCATCATCCCTCCAGG - Intronic
1183841056 22:40501152-40501174 GACCCCCCCCACCTCCCTCCCGG + Intronic
1183841482 22:40502160-40502182 GACCCCCCCCACCTCCCTCCCGG + Intronic
1183871496 22:40745087-40745109 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1183871700 22:40745537-40745559 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1184202646 22:42981340-42981362 GACCCCCCCCACCTCCCTCCCGG - Intronic
1185379732 22:50502905-50502927 AATCCCATCCTCATGCCTCCTGG + Intergenic
950060928 3:10070491-10070513 GACCCCCCCCACCTCCCTCCCGG - Intronic
950434443 3:12970300-12970322 GGGGCCCTCCTCATCCCTCAAGG - Intronic
950742593 3:15062431-15062453 GACCCCCCCCACCTCCCTCCCGG - Intronic
951013225 3:17704553-17704575 GACCCCCCCCACCTCCCTCCCGG + Intronic
953118845 3:40019406-40019428 GAACTCCTGCACATCCTTCCTGG + Intronic
953426248 3:42798295-42798317 GACCCCCCCCACCTCCCTCCCGG - Intronic
953426324 3:42798473-42798495 GACCCCCCCCACCTCCCTCCCGG - Intronic
953426400 3:42798650-42798672 GACCCCCCCCACCTCCCTCCCGG - Intronic
953511007 3:43539139-43539161 TCACCCCTCCTGCTCCCTCCTGG + Intronic
953652648 3:44821081-44821103 GACCCCCCCCACCTCCCTCCCGG + Intronic
953855239 3:46494995-46495017 GACCCCCCCCACCTCCCTCCCGG - Intergenic
954059510 3:48056475-48056497 GACCCCCCCCACCTCCCTCCCGG - Intronic
954059730 3:48056971-48056993 GACCCCCCCCACCTCCCTCCCGG - Intronic
954099569 3:48358721-48358743 ACACCCCTCCTCATCCCTATTGG + Intergenic
954355933 3:50084278-50084300 GACCCCCCCCACCTCCCTCCCGG + Intronic
954356011 3:50084458-50084480 TGACCCCTCCACCTCCCTCCCGG + Intronic
954356061 3:50084587-50084609 GACCCCCCCCACCTCCCTCCCGG + Intronic
954523376 3:51249088-51249110 GACCCCCCCCACCTCCCTCCCGG - Intronic
954523496 3:51249362-51249384 TAACCCCCCCACCTCCCTCCCGG - Intronic
955297647 3:57748120-57748142 GACCCCCCCCACCTCCCTCCCGG - Intergenic
955362979 3:58290297-58290319 GACCCCCCCCACCTCCCTCCCGG + Intronic
955394650 3:58549703-58549725 GACCCCCCCCACCTCCCTCCCGG + Intergenic
955394676 3:58549752-58549774 TGACCCCTCCACCTCCCTCCCGG + Intergenic
955434852 3:58890439-58890461 GACCCCCCCCACGTCCCTCCCGG + Intronic
956270412 3:67444047-67444069 TGACCCCTCCACCTCCCTCCCGG - Intronic
956270755 3:67444853-67444875 GACCCCCCCCACCTCCCTCCCGG - Intronic
957035519 3:75289649-75289671 GACCCCCCCCACCTCCCTCCCGG - Intergenic
957316766 3:78583437-78583459 GACCCCCCCCACCTCCCTCCCGG + Intergenic
958808882 3:98838146-98838168 GACCCCCCCCACCTCCCTCCCGG + Intronic
958957217 3:100477539-100477561 TGACCCCTCCACCTCCCTCCCGG + Intergenic
959415724 3:106074928-106074950 GACCCCCCCCACCTCCCTCCCGG + Intergenic
960030068 3:113046673-113046695 GACCCCCCCCACCTCCCTCCCGG + Intergenic
960780381 3:121313218-121313240 GACCCCCCCCACCTCCCTCCCGG + Intronic
960780607 3:121313736-121313758 GACCCCCCCCACCTCCCTCCCGG + Intronic
960862094 3:122164691-122164713 GACCCCCCCCACCTCCCTCCTGG - Intergenic
960924354 3:122780605-122780627 TGACCCCCCCACATCCCTCCCGG + Intronic
961120702 3:124368142-124368164 GACCCCCCCCACCTCCCTCCCGG + Intronic
961729525 3:128955129-128955151 GACCCCCCCCACCTCCCTCCCGG - Intronic
961729551 3:128955180-128955202 GACCCCCCCCACCTCCCTCCCGG - Intronic
961784454 3:129339893-129339915 GACCCCCTCCACCTCCCTCCCGG + Intergenic
961962427 3:130868107-130868129 GAGCCCCCCCACCTCCCTCCGGG - Intronic
962245227 3:133785482-133785504 GACCCCCCCCACCTCCCTCCCGG - Intronic
963244663 3:143047577-143047599 GACCCCCCCCACCTCCCTCCCGG + Intronic
963248856 3:143086247-143086269 GACCCCCCCCACCTCCCTCCCGG + Intergenic
963451216 3:145483049-145483071 GACCCCCCCCACCTCCCTCCTGG - Intergenic
963498407 3:146096740-146096762 GACCCCCCCCACCTCCCTCCCGG - Intronic
963911309 3:150820378-150820400 GACCCCCCCCACCTCCCTCCCGG + Intergenic
963911433 3:150820652-150820674 GACCCCCCCCACCTCCCTCCCGG + Intergenic
966015083 3:175131823-175131845 GACCCCCCCCACCTCCCTCCCGG + Intronic
966015433 3:175132660-175132682 TGACCCCTCCACCTCCCTCCCGG + Intronic
966420125 3:179728025-179728047 GATCCCCACCACCTCCCTCCCGG + Intronic
966491415 3:180531863-180531885 GACCCCCCCCCCATCCCTGCAGG + Intergenic
966784124 3:183608730-183608752 GACCCCCCCCACCTCCCTCCCGG - Intergenic
966784254 3:183609008-183609030 TGACCCCTCCACCTCCCTCCCGG - Intergenic
968411676 4:395810-395832 GACCCCCCCCACCTCCCTCCCGG - Intergenic
968411819 4:396133-396155 GACCCCCTCCACCTCCCTCCCGG - Intergenic
968448036 4:662308-662330 GACCCCCATCTCATCCCTCGGGG - Intronic
968667040 4:1828048-1828070 GACCCCCCCCACCTCCCTCCCGG + Intronic
968667170 4:1828329-1828351 GACCCCCCCCACCTCCCTCCCGG + Intronic
968667388 4:1828814-1828836 GACCCCCCCCACCTCCCTCCCGG + Intronic
969136485 4:5033318-5033340 GAAACCCTGCTTCTCCCTCCAGG + Intergenic
969374793 4:6755972-6755994 GACCCCCCCCACCTCCCTCCCGG - Intergenic
970409409 4:15791337-15791359 GACCCCCACCACCTCCCTCCCGG - Intronic
970472590 4:16393212-16393234 GACCCCCCCCACCTCCCTCCTGG + Intergenic
970472685 4:16393431-16393453 GACCCCCCCCACCTCCCTCCCGG + Intergenic
972832290 4:42828132-42828154 GAATGCCTCCTCATCCCTGGAGG - Intergenic
973109176 4:46377717-46377739 GACCCCCCCCACCTCCCTCCCGG - Intronic
973281373 4:48363748-48363770 GACCCCCCCCACCTCCCTCCCGG + Intronic
973281472 4:48363975-48363997 GACCCCCCCCACCTCCCTCCCGG + Intronic
973593455 4:52465000-52465022 GACCCCCCCCACCTCCCTCCCGG - Intergenic
973593718 4:52465591-52465613 GACCCCCCCCACCTCCCTCCTGG - Intergenic
973593874 4:52465948-52465970 GACCCCCCCCACCTCCCTCCTGG - Intergenic
973676497 4:53268650-53268672 GAGGCCCTCCTCATGCCTCTCGG - Intronic
973784976 4:54325523-54325545 TGACCCCTCCACCTCCCTCCCGG + Intergenic
974076663 4:57173450-57173472 GACCCCCCCCACCTCCCTCCCGG - Intergenic
974588911 4:63918705-63918727 GACCCCCCCCACCTCCCTCCCGG + Intergenic
975042530 4:69762302-69762324 GACCCCCCCCACCTCCCTCCTGG - Intronic
975685610 4:76916907-76916929 GACCCCCCCCACCTCCCTCCCGG - Intergenic
975685739 4:76917211-76917233 GACCCCCACCACCTCCCTCCCGG - Intergenic
975685913 4:76917607-76917629 GACCCCCCCCACCTCCCTCCCGG - Intergenic
975686040 4:76917882-76917904 GACCCCCCCCACCTCCCTCCCGG - Intergenic
976148548 4:82068415-82068437 GAACTCCTATTCATCCCTCAAGG + Intergenic
976154008 4:82123182-82123204 GAACCCCACCTGATCCAGCCTGG + Intergenic
976265622 4:83185363-83185385 TGACCCCTCCACCTCCCTCCTGG + Intergenic
976340730 4:83943509-83943531 TGACCCCTCCACCTCCCTCCCGG + Intergenic
976508301 4:85876520-85876542 AAACTCCTCCTCTTCCCTCAAGG + Intronic
977355948 4:95946753-95946775 AAACACTTCCTCATCCCTTCAGG + Intergenic
978729611 4:112010161-112010183 GAATGCCTCCTCAGCCCTGCAGG - Intergenic
980056353 4:128083448-128083470 GACCCCCCCCACCTCCCTCCCGG + Intronic
980056450 4:128083674-128083696 GAGCCCCCCCACCTCCCTCCCGG + Intronic
980701829 4:136442125-136442147 GCAGCCCTCCCCATGCCTCCTGG - Intergenic
981523969 4:145693665-145693687 GACCCCCCCCACCTCCCTCCCGG + Intronic
981524050 4:145693843-145693865 GACCCCCCCCACCTCCCTCCCGG + Intronic
981970782 4:150660337-150660359 GACCCCCCCCACCTCCCTCCCGG - Intronic
981970836 4:150660466-150660488 GACCCCCCCCACCTCCCTCCCGG - Intronic
982022159 4:151214637-151214659 GACCCCCCCCACCTCCCTCCCGG + Intronic
982053595 4:151526663-151526685 TGACCCCCCCTCCTCCCTCCCGG + Intronic
982072782 4:151710009-151710031 GTCCCTCTCCTCATCCCTCAAGG + Intronic
982106375 4:152015231-152015253 GAACACCACCACTTCCCTCCCGG - Intergenic
982820623 4:159939168-159939190 GACCCCCCCCACCTCCCTCCCGG + Intergenic
982820903 4:159939794-159939816 GACCCCCCCCACCTCCCTCCCGG + Intergenic
983278469 4:165649280-165649302 GAATACCTCCTCATCCCTAGAGG + Intergenic
983652280 4:170046619-170046641 GACCCCCCCCACCTCCCTCCCGG - Intergenic
983971123 4:173875698-173875720 CAACTCCTGCTCTTCCCTCCAGG + Intergenic
985344963 4:188994555-188994577 GATCCCTTCCTCGCCCCTCCCGG + Intergenic
985489173 5:169227-169249 GTGACCCTGCTCATCCCTCCGGG + Intronic
985733630 5:1565156-1565178 CAAGGCCTCCTCACCCCTCCTGG + Intergenic
985736488 5:1586315-1586337 GACCCCCCCCACCTCCCTCCTGG - Intergenic
986395910 5:7330339-7330361 GAATGCCTCCTCATCCCTAGAGG + Intergenic
986449615 5:7851210-7851232 GACCCTCCCCTCCTCCCTCCCGG + Exonic
986682871 5:10249809-10249831 GCACCCCTTCTCATGCCCCCAGG + Intronic
987937891 5:24491629-24491651 GAAGCCCTGCTCCTCCCTGCCGG - Exonic
988544510 5:32142813-32142835 GACCCCCCCCACCTCCCTCCTGG - Intronic
988760203 5:34305822-34305844 GACCCCCCCCACCTCCCTCCCGG + Intergenic
988760280 5:34306000-34306022 GACCCCCCCCACCTCCCTCCCGG + Intergenic
988760354 5:34306178-34306200 GACCCCCCCCACCTCCCTCCCGG + Intergenic
988760380 5:34306229-34306251 GACCCCCCCCACCTCCCTCCCGG + Intergenic
988760458 5:34306407-34306429 GACCCCCCCCACCTCCCTCCCGG + Intergenic
989048523 5:37295990-37296012 GACCCCCCCCTCCTCCCTCCCGG - Intronic
989061535 5:37415614-37415636 GACCCCCCCCACCTCCCTCCCGG + Intronic
989075717 5:37563079-37563101 GACCCCCCCCGCCTCCCTCCCGG + Intronic
989379728 5:40800583-40800605 GACCCCCCCCACCTCCCTCCCGG - Intergenic
989540347 5:42610828-42610850 AATCCCCTCATCATCCCTCTAGG + Intronic
989587540 5:43087284-43087306 TGACCCCTCCACCTCCCTCCCGG + Intronic
989587985 5:43088300-43088322 GACCCCCCCCACCTCCCTCCTGG + Intronic
990426633 5:55695898-55695920 TAACCCCCCCACCTCCCTCCCGG + Intronic
990458856 5:56014601-56014623 GACCCCCCCCACCTCCCTCCCGG + Intergenic
991907106 5:71525266-71525288 GACCCCCCCCACCTCCCTCCCGG + Intronic
992374031 5:76171972-76171994 GACCCCCCCCACCTCCCTCCCGG - Intronic
992374213 5:76172408-76172430 GACCCCCCCCACCTCCCTCCCGG - Intronic
992391646 5:76336102-76336124 GACCCCCCCCACCTCCCTCCCGG + Intronic
992443250 5:76813031-76813053 GACCCCCCCCACCTCCCTCCCGG - Intergenic
992469508 5:77042443-77042465 GACCCCCCCCACCTCCCTCCCGG + Intronic
992469534 5:77042493-77042515 GACCCCCCCCACCTCCCTCCCGG + Intronic
992469654 5:77042764-77042786 GACCCCCCCCACCTCCCTCCCGG + Intronic
992470077 5:77043679-77043701 GATCCCCCCCACCTCCCTCCCGG + Intronic
992494209 5:77276305-77276327 GAATCACTCCTCATCCTTCAGGG + Intronic
992544236 5:77794995-77795017 GACCCCCCCCACCTCCCTCCCGG + Intronic
992914342 5:81432920-81432942 GACCCCCCCCACCTCCCTCCCGG - Intronic
992914367 5:81432970-81432992 GACCCCCCCCACCTCCCTCCCGG - Intronic
992964113 5:81983463-81983485 GACCCCCCCCACCTCCCTCCCGG + Intronic
992964138 5:81983513-81983535 GACCCCCCCCACCTCCCTCCCGG + Intronic
993635902 5:90343457-90343479 TACCTCCTCCTCATCCCTCAGGG - Intergenic
993657842 5:90595889-90595911 GACCCCCCCCACCTCCCTCCCGG + Intronic
994943974 5:106361427-106361449 GAATGCCTCCTCATCCCTAGAGG - Intergenic
995193787 5:109342510-109342532 GACCCCCCCCACCTCCCTCCCGG - Intronic
995516016 5:112955106-112955128 GACCCCCCCCACCTCCCTCCCGG - Intergenic
996069807 5:119121913-119121935 GACCCCCCCCACCTCCCTCCCGG + Intronic
997335907 5:133108880-133108902 GACCCCCCCCACCTCCCTCCCGG - Intergenic
997874683 5:137537626-137537648 GACCCCCCCCACCTCCCTCCTGG + Intronic
997892264 5:137687057-137687079 GACCCCCCCCACCTCCCTCCCGG - Intronic
998239176 5:140427148-140427170 GACCCCCCCCACCTCCCTCCCGG + Intronic
998431703 5:142075464-142075486 GACCCCCCCCACCTCCCTCCCGG + Intergenic
998431806 5:142075666-142075688 GACCCCCCCCACCTCCCTCCCGG + Intergenic
998432162 5:142076442-142076464 GACCCCCCCCACCTCCCTCCCGG + Intergenic
998621650 5:143801055-143801077 GATCCCTTCCTCACCCCTCTGGG - Intergenic
998630686 5:143894957-143894979 GAATGCCTCCTCATCCCTTGAGG + Intergenic
999180929 5:149670150-149670172 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1000985388 5:167859366-167859388 GACCCCCCCCACCTCCCTCCCGG - Intronic
1000985666 5:167859994-167860016 GACCCCCCCCACCTCCCTCCCGG - Intronic
1001077871 5:168643532-168643554 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1001393942 5:171403639-171403661 GACCCCCCCCACCTCCCTCCCGG + Intronic
1001595414 5:172895718-172895740 GAACTCCTACTCATCCTCCCAGG - Intronic
1001958966 5:175868443-175868465 GAACCCCTCCTCCTGCCCCCAGG + Intronic
1002014010 5:176305841-176305863 GACCCCCCCCACCTCCCTCCCGG - Intronic
1002116077 5:176962155-176962177 GACCCCCCCCACCTCCCTCCCGG - Intronic
1002116155 5:176962333-176962355 GACCCCCCCCACCTCCCTCCCGG - Intronic
1002116230 5:176962510-176962532 GACCCCCCCCACCTCCCTCCCGG - Intronic
1002647849 5:180669990-180670012 GAGCCCATCCTCAACCATCCAGG + Intergenic
1002701406 5:181127700-181127722 AATCCCCTCCACATCACTCCAGG - Intergenic
1002988968 6:2220183-2220205 GAACGCCTCCTTATCCCTAGAGG + Intronic
1003240225 6:4338393-4338415 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1003512073 6:6790090-6790112 GCACCCCTGCTCATACTTCCAGG + Intergenic
1003672750 6:8174592-8174614 GAACACCAGCTCACCCCTCCGGG - Intergenic
1004388454 6:15189803-15189825 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1004388510 6:15189932-15189954 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1004414850 6:15415596-15415618 TGACCCCTCCACCTCCCTCCCGG + Intronic
1004414873 6:15415646-15415668 GACCCCCCCCACCTCCCTCCCGG + Intronic
1004664139 6:17735427-17735449 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1005063261 6:21796762-21796784 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1005158854 6:22836766-22836788 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1005158980 6:22837070-22837092 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1005606646 6:27484734-27484756 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1005606673 6:27484784-27484806 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1005606727 6:27484913-27484935 GACCCCCGCCACCTCCCTCCCGG + Intergenic
1005837228 6:29718751-29718773 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1005837409 6:29719146-29719168 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1005864349 6:29926960-29926982 CGACCCCTCCTCATCCCCCACGG + Intergenic
1005865458 6:29933054-29933076 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1005900469 6:30213169-30213191 GACCCCCTCCTGAGCCCGCCCGG + Intronic
1006039710 6:31244017-31244039 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1006064696 6:31454780-31454802 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1006064836 6:31455115-31455137 TAACCCCCCCACCTCCCTCCCGG + Intergenic
1006128241 6:31853916-31853938 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1006128486 6:31854466-31854488 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1006232221 6:32595600-32595622 GACCCCCCCCACTTCCCTCCCGG + Intergenic
1006492282 6:34397556-34397578 GACCCCCCCCACCTCCCTCCCGG - Intronic
1006492605 6:34398310-34398332 GACCCCCCCCACCTCCCTCCCGG - Intronic
1006492631 6:34398361-34398383 GACCCCCCCCACCTCCCTCCCGG - Intronic
1006546779 6:34786902-34786924 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1006623599 6:35383925-35383947 GACCCCCCCCACCTCCCTCCCGG - Intronic
1006646628 6:35519503-35519525 GAACTCCACCTCAGGCCTCCAGG + Intergenic
1007063396 6:38964329-38964351 GACCCCCCCCACCTCCCTCCCGG + Intronic
1007740687 6:44007911-44007933 CACCCCCTCCTCATCCTTTCGGG - Intergenic
1008112041 6:47505625-47505647 GACCCCCCCCACCTCCCTCCCGG + Intronic
1008112167 6:47505901-47505923 GACCCCCCCCACCTCCCTCCCGG + Intronic
1008553523 6:52655612-52655634 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1008553597 6:52655761-52655783 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1008624585 6:53305057-53305079 GACCCCCCCCACCTCCCTCCCGG + Intronic
1008926317 6:56894533-56894555 GACCCCCCCCACCTCCCTCCTGG + Intronic
1008926392 6:56894709-56894731 GACCCCCCCCACCTCCCTCCCGG + Intronic
1008926593 6:56895159-56895181 GACCCCCCCCACCTCCCTCCCGG + Intronic
1010245939 6:73660797-73660819 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1011405275 6:87010317-87010339 GACCCCCCCCACCTCCCTCCCGG + Intronic
1013326036 6:109046979-109047001 GACCCCCCCCACCTCCCTCCCGG - Intronic
1013369263 6:109455659-109455681 GCACCCCACCTCACCCCACCCGG + Intronic
1013679567 6:112508968-112508990 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014556665 6:122848419-122848441 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014556720 6:122848548-122848570 GACCCCCCCCACCTCCCTCCGGG + Intergenic
1014556797 6:122848725-122848747 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014556874 6:122848904-122848926 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014556900 6:122848954-122848976 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014763932 6:125388621-125388643 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014764217 6:125389269-125389291 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1014908241 6:127057053-127057075 GAATGCCTCCTCATCCCTACAGG - Intergenic
1015476984 6:133665545-133665567 GAATCCCCCCACCTCCCTCCCGG - Intergenic
1015643596 6:135363895-135363917 GACCCCCCCCACCTCCCTCCCGG + Intronic
1015951852 6:138561369-138561391 TATTCCCTCCTCTTCCCTCCAGG + Intronic
1016802097 6:148178778-148178800 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1016821324 6:148349000-148349022 GAACTCCTACTTATCCCTCAGGG - Intronic
1016973497 6:149786270-149786292 GACCCCCCCCACCTCCCTCCAGG + Intronic
1017465253 6:154687615-154687637 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1017493723 6:154966231-154966253 GGCCCCCTCCACCTCCCTCCCGG + Intronic
1017660749 6:156670528-156670550 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1017817776 6:158027824-158027846 GAACTCCTCCTCATCCTTCTGGG - Intronic
1017843277 6:158239186-158239208 GACCCCCCCCACCTCCCTCCCGG + Intronic
1017843457 6:158239591-158239613 GACCCCCCCCACCTCCCTCCCGG + Intronic
1017843612 6:158239945-158239967 GACCCCCCCCACCTCCCTCCCGG + Intronic
1017843935 6:158240699-158240721 GACCCCCCCCACCTCCCTCCCGG + Intronic
1017973770 6:159336240-159336262 GAAGCCCTCCTCATCCTGCTTGG - Intergenic
1018009901 6:159660543-159660565 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1018295384 6:162339228-162339250 GACCCCCACCACCTCCCTCCCGG - Intronic
1018591928 6:165435316-165435338 AAACCCCGCCTCATCCCTGCTGG - Exonic
1018851498 6:167643735-167643757 GACACCCTCCTCATTCCACCTGG - Intergenic
1019439530 7:1039045-1039067 GACCCCCCCCACCTCCCTCCCGG - Intronic
1019439606 7:1039223-1039245 GACCCCCCCCACCTCCCTCCCGG - Intronic
1019445782 7:1070244-1070266 GACCCCCCCCACCTCCCTCCCGG - Intronic
1019458806 7:1146415-1146437 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1019459107 7:1147104-1147126 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1019569757 7:1705430-1705452 GAGCTCCTCCTCCTCCTTCCAGG - Intronic
1019669140 7:2268437-2268459 GACCCCCCCCACCTCCCTCCCGG - Intronic
1019669261 7:2268712-2268734 GACCCCCCCCACCTCCCTCCCGG - Intronic
1019674609 7:2303318-2303340 TGACCCCTCCACCTCCCTCCCGG - Intronic
1020284691 7:6671127-6671149 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1020325875 7:6975039-6975061 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1021120205 7:16789780-16789802 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1021672320 7:23046231-23046253 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1021735482 7:23637063-23637085 GACCCCCACCACCTCCCTCCCGG - Intronic
1021735762 7:23637692-23637714 GACCCCCCCCACCTCCCTCCTGG - Intronic
1022083507 7:27045384-27045406 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1022663508 7:32387681-32387703 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1022663563 7:32387809-32387831 GACCCCCACCACCTCCCTCCAGG + Intergenic
1023148925 7:37181336-37181358 GATGCCCGCCTCATCCCTGCAGG + Intronic
1024309910 7:47959733-47959755 TGACCCCTCCACCTCCCTCCCGG - Intronic
1024625910 7:51208424-51208446 GACCCCCCCCACCTCCCTCCCGG - Intronic
1024959268 7:54957770-54957792 GAAGCTCTCCTCATCCCGTCAGG - Intergenic
1024988909 7:55219709-55219731 GACCCCCCCCACCTCCCTCCCGG + Intronic
1024988987 7:55219887-55219909 GACCCCCCCCACCTCCCTCCCGG + Intronic
1025000637 7:55312117-55312139 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1025000687 7:55312216-55312238 GGACCCCCCCACCTCCCTCCCGG - Intergenic
1025103451 7:56151892-56151914 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1025821611 7:64968242-64968264 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1025852874 7:65258286-65258308 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1025853100 7:65258779-65258801 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1025853284 7:65259180-65259202 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1025979227 7:66393615-66393637 GACCCCCTCCACCTCCCTCCCGG + Intronic
1025979506 7:66394254-66394276 GACCCCCCCCACCTCCCTCCCGG + Intronic
1026783186 7:73283921-73283943 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1026783261 7:73284098-73284120 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1026862053 7:73797221-73797243 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1026868503 7:73836645-73836667 GACCCCCCCCACCTCCCTCCCGG - Intronic
1026898728 7:74025775-74025797 GTGCCCCTCCACACCCCTCCTGG + Intergenic
1027371102 7:77509268-77509290 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1027373833 7:77533756-77533778 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1027373975 7:77534076-77534098 GACCCCCCCCACCTCCCTCCGGG + Intergenic
1028498233 7:91486734-91486756 GAATGCCTCCTCATCCCTAGAGG - Intergenic
1029279660 7:99427467-99427489 GACCCCCCCCACCTCCCTCCCGG - Intronic
1029285668 7:99464333-99464355 GAACCCCTCTTCATTTCTCTAGG + Intronic
1029430013 7:100523527-100523549 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1029468469 7:100740932-100740954 GACCCCCCCCACCTCCCTCCCGG + Intronic
1029468622 7:100741286-100741308 GACCCCCCCCACCTCCCTCCCGG + Intronic
1029468648 7:100741337-100741359 GACCCCCCCCACCTCCCTCCCGG + Intronic
1029468726 7:100741515-100741537 GACCCCCCCCACCTCCCTCCCGG + Intronic
1029688618 7:102165706-102165728 CAACCCCTGCCCATCCCTCAAGG - Intronic
1030036179 7:105410637-105410659 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1030036254 7:105410813-105410835 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1030602842 7:111610246-111610268 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1030652219 7:112128280-112128302 GACCCCCCCCACCTCCCTCCCGG - Intronic
1031920392 7:127595911-127595933 GAACCACTCCTCACCCCTCATGG - Exonic
1032042747 7:128576691-128576713 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1032081376 7:128860133-128860155 GGACCCCTCCCTACCCCTCCTGG + Intergenic
1032291402 7:130591764-130591786 TGACCCCTCCACTTCCCTCCCGG - Intronic
1033376107 7:140763288-140763310 GACCCCCCCCACCTCCCTCCTGG + Intronic
1034234185 7:149554779-149554801 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1034234235 7:149554907-149554929 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1034234312 7:149555084-149555106 CAACCCCCCCACCTCCCTCCCGG - Intergenic
1034322648 7:150198967-150198989 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1034412409 7:150948228-150948250 GAAGCCCTCTTCCACCCTCCAGG - Intronic
1034638549 7:152585758-152585780 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1034638822 7:152586375-152586397 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1034940927 7:155229725-155229747 GAAGTCCTCCTGATCACTCCTGG + Intergenic
1034961368 7:155366713-155366735 GACCCCCGCCACCTCCCTCCCGG + Intronic
1035507707 8:149479-149501 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1035596393 8:861361-861383 GAACCCCTCCTCACACATACCGG + Intergenic
1035701017 8:1639295-1639317 TGGCCCCTCCCCATCCCTCCTGG - Intronic
1037817726 8:22120688-22120710 GCACCCCTCCCCTCCCCTCCCGG - Intronic
1038007398 8:23444396-23444418 GAACACCCCCTCTCCCCTCCAGG + Intronic
1038284545 8:26195319-26195341 TAAACCATCCTCATCCTTCCAGG - Intergenic
1038595295 8:28881464-28881486 GACCCCCCCCTCCCCCCTCCCGG - Intronic
1038595321 8:28881514-28881536 GACCCCCCCCACCTCCCTCCCGG - Intronic
1038744858 8:30247062-30247084 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1039563229 8:38529604-38529626 GGACCCCTTCTCCTCTCTCCAGG - Intergenic
1040069662 8:43179495-43179517 GACCCCCCCCACCTCCCTCCCGG + Intronic
1040069984 8:43180235-43180257 GACCCCCCCCACCTCCCTCCCGG + Intronic
1040093287 8:43419527-43419549 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1040121230 8:43687632-43687654 GAGCCCCCCCACCTCCCTCCCGG + Intergenic
1041070964 8:54125803-54125825 GACCCCCGCCACCTCCCTCCCGG - Intergenic
1041286889 8:56272009-56272031 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1041358194 8:57022364-57022386 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1041796318 8:61752505-61752527 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1041796345 8:61752556-61752578 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1041920816 8:63180074-63180096 GACCCCCCCCACCTCCCTCCCGG + Intronic
1042049298 8:64686490-64686512 GACCCCCCCCACCTCCCTCCCGG - Intronic
1042303705 8:67311274-67311296 GACCCCCCCCACCTCCCTCCCGG - Intronic
1042508096 8:69582726-69582748 GGCCTCCTCCTCATCCCTACGGG - Intronic
1042663261 8:71178830-71178852 ATCCCTCTCCTCATCCCTCCTGG + Intergenic
1043985880 8:86694177-86694199 GACCCCCCCCACCTCCCTCCCGG + Intronic
1044223930 8:89699492-89699514 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1044606994 8:94056607-94056629 GAAACTTTCTTCATCCCTCCTGG + Intergenic
1044660840 8:94591285-94591307 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1044660969 8:94591587-94591609 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1044966500 8:97579111-97579133 AAAGCCCTCCTCACCCCACCTGG + Intergenic
1045120192 8:99028393-99028415 GACCCCCCCCACCTCCCTCCCGG + Intronic
1045120298 8:99028622-99028644 GACCCCCCCCACCTCCCTCCCGG + Intronic
1045120406 8:99028877-99028899 GACCCCCCCCACCTCCCTCCCGG + Intronic
1045524077 8:102928321-102928343 GACCCCCCCCACCTCCCTCCCGG - Intronic
1046636429 8:116679154-116679176 GACCCCCACCACCTCCCTCCCGG - Intronic
1046636741 8:116679846-116679868 GACCCCCCCCACCTCCCTCCCGG - Intronic
1047266603 8:123314828-123314850 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1047687265 8:127316417-127316439 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1047847683 8:128825614-128825636 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1047847839 8:128825940-128825962 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1048683730 8:136877405-136877427 AAATGCCTCCTCATCCCTCGAGG - Intergenic
1048818254 8:138354477-138354499 TAACCCATCCTGATACCTCCTGG + Intronic
1049021725 8:139961658-139961680 GACCCTCCCCTCATCCCTGCAGG + Intronic
1049437879 8:142596020-142596042 GGACCCCTCCTGACCCCTCCTGG + Intergenic
1049675347 8:143886635-143886657 TGACCCCTCCTCTTCTCTCCTGG + Intergenic
1050262366 9:3854106-3854128 GAAGCCATCCTCACCACTCCAGG - Intronic
1050558305 9:6807977-6807999 GACCCCCCCCACCTCCCTCCCGG - Intronic
1051186288 9:14464652-14464674 GCACCCCACCTCCTCCATCCTGG - Intergenic
1053008879 9:34622333-34622355 AAGCCCCTCCTCACCCCTCAGGG + Exonic
1053358175 9:37464879-37464901 GATCCTCTCTTCATCCCGCCAGG + Intronic
1053457225 9:38242127-38242149 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1053468239 9:38325329-38325351 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1053634495 9:39983230-39983252 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1054209392 9:62267467-62267489 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1054856006 9:69900385-69900407 AAAACCCTCCTCCTCCCTTCTGG - Intronic
1055137009 9:72840352-72840374 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1055586401 9:77761836-77761858 GACCCCCCCCACCTCCCTCCCGG - Intronic
1055948582 9:81711028-81711050 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1055948653 9:81711176-81711198 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1056002430 9:82231118-82231140 GGACCAGTCCTCAGCCCTCCTGG - Intergenic
1056152651 9:83804383-83804405 GACCCCCCCCACCTCCCTCCCGG - Intronic
1056152751 9:83804609-83804631 GACCCCCCCCACCTCCCTCCTGG - Intronic
1056152775 9:83804659-83804681 GGACCCCCCCACCTCCCTCCCGG - Intronic
1056510004 9:87295611-87295633 CAACAGCTCCTCATCCCCCCAGG + Intergenic
1056564226 9:87758695-87758717 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1057034462 9:91801672-91801694 GAATTCCTCCTCTCCCCTCCTGG - Intronic
1057154681 9:92830696-92830718 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1057155075 9:92831593-92831615 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1057629348 9:96707470-96707492 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1057629482 9:96707778-96707800 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1058659485 9:107256651-107256673 GACCCCCCCCACCTCCCTCCTGG + Intergenic
1058659562 9:107256829-107256851 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1058659617 9:107256958-107256980 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1058661661 9:107272450-107272472 GACCCCCCCCACCTCCCTCCTGG - Intergenic
1058722757 9:107776703-107776725 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1058722835 9:107776881-107776903 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1058722861 9:107776932-107776954 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1058722937 9:107777110-107777132 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1058723015 9:107777288-107777310 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1058723093 9:107777465-107777487 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1059121255 9:111641793-111641815 GACCCCCCCCACCTCCCTCCCGG - Intronic
1059121334 9:111641971-111641993 GACCCCCCCCACCTCCCTCCCGG - Intronic
1059707746 9:116840508-116840530 GACCCCCCCCACCTCCCTCCTGG + Intronic
1060065440 9:120496772-120496794 GACCCCCCCCACCTCCCTCCTGG - Intronic
1060249196 9:121971431-121971453 GACCCCCCCCACCTCCCTCCCGG - Intronic
1060350232 9:122852618-122852640 TGACCCCTCCACCTCCCTCCCGG - Intronic
1060682465 9:125577599-125577621 GACCCCCCCCACCTCCCTCCCGG - Intronic
1060687413 9:125624420-125624442 GACCCCCCCCACCTCCCTCCCGG - Intronic
1060703743 9:125780467-125780489 GACCCCCCCCACCTCCCTCCCGG + Intronic
1060703857 9:125780726-125780748 GACCCCCCCCACCTCCCTCCCGG + Intronic
1060909996 9:127341885-127341907 CAACCCCTCCTGGTCCTTCCTGG - Intronic
1062133603 9:134913215-134913237 GTGGCCCTCCTCCTCCCTCCTGG - Intronic
1062343121 9:136102521-136102543 CCAGCCCTCCTCATTCCTCCGGG - Intergenic
1062375912 9:136261853-136261875 GAAGGCCTCCTCGGCCCTCCAGG + Intergenic
1062593855 9:137288509-137288531 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1203775938 EBV:73255-73277 TGACCCCTTCTCATCCCACCTGG - Intergenic
1203523682 Un_GL000213v1:67697-67719 GACCCCCGCCTCTCCCCTCCCGG + Intergenic
1203405581 Un_KI270539v1:359-381 TGACCCCTCCACCTCCCTCCCGG - Intergenic
1185584929 X:1236188-1236210 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1185584981 X:1236316-1236338 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1186244909 X:7608935-7608957 GGACCCCCCCACCTCCCTCCCGG + Intergenic
1186786938 X:12963509-12963531 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1187183408 X:16964661-16964683 GACCCCCCCCACCTCCCTCCTGG + Intronic
1187184222 X:16968698-16968720 GACCCCCCCCACCTCCCTCCCGG + Intronic
1187976540 X:24709489-24709511 GACCCCCCCCACCTCCCTCCCGG + Intronic
1188367655 X:29333759-29333781 GACCCCCCCCACCTCCCTCCCGG + Intronic
1188367959 X:29334455-29334477 GACCCCCCCCACCTCCCTCCCGG + Intronic
1188477128 X:30602387-30602409 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1188477324 X:30602837-30602859 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1188477401 X:30603015-30603037 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1188477427 X:30603065-30603087 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1188477506 X:30603243-30603265 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1189377997 X:40480735-40480757 CAGCCCCTCATCATGCCTCCCGG - Intergenic
1189837617 X:45040449-45040471 GACCCCCCCCACCTCCCTCCCGG + Intronic
1189837714 X:45040675-45040697 GACCCCCCCCACCTCCCTCCCGG + Intronic
1189837920 X:45041126-45041148 GACCCCCACCACCTCCCTCCCGG + Intronic
1189837943 X:45041176-45041198 GACCCCCCCCTCCCCCCTCCCGG + Intronic
1189955844 X:46275605-46275627 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1189968207 X:46395289-46395311 GACCCCCACCACCTCCCTCCCGG + Intergenic
1190779365 X:53579184-53579206 GACCCCCCCCACCTCCCTCCCGG - Intronic
1190891486 X:54572685-54572707 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1191010103 X:55749173-55749195 GACCCCCCCCACTTCCCTCCCGG - Intronic
1191617918 X:63189244-63189266 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1191617996 X:63189422-63189444 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1192107065 X:68326841-68326863 GACCCCCCCCACCTCCCTCCCGG - Intronic
1192386911 X:70679944-70679966 GACCCCCCCCACCTCCCTCCCGG - Intronic
1192464038 X:71341660-71341682 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1192567726 X:72178799-72178821 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192567822 X:72178995-72179017 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192621528 X:72682064-72682086 GACCCCCCCCACCTCCCTCCCGG - Intronic
1192621624 X:72682274-72682296 GACCCCCCCCACCTCCCTCCCGG - Intronic
1192768576 X:74166639-74166661 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192768750 X:74167040-74167062 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192768897 X:74167364-74167386 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192768949 X:74167492-74167514 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1192813344 X:74568539-74568561 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1192969621 X:76217787-76217809 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1192969702 X:76217965-76217987 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1193068087 X:77279517-77279539 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1193132262 X:77931772-77931794 GACCCCCCCCACCTCCCTCCTGG + Intronic
1193132287 X:77931822-77931844 GACCCCCCCCACCTCCCTCCCGG + Intronic
1193132672 X:77934078-77934100 GAATGCCTCCTCATCCCTACAGG - Intronic
1193362383 X:80591609-80591631 TGACCCCTCCACCTCCCTCCCGG - Intergenic
1194991856 X:100555464-100555486 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1194991910 X:100555592-100555614 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1194991963 X:100555720-100555742 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1195009879 X:100724002-100724024 GACCCCCCCCACCTCCCTCCCGG - Intronic
1195009933 X:100724130-100724152 GACCCCCCCCACCTCCCTCCCGG - Intronic
1195009980 X:100724233-100724255 GACCCCCCCCACCTCCCTCCTGG - Intronic
1195036029 X:100972489-100972511 GACCCCCCCCACCTCCCTCCCGG + Intronic
1196408902 X:115395514-115395536 TAACCACTCCTCCTGCCTCCAGG - Intergenic
1197241757 X:124128704-124128726 GACCCCCCCCACCTCCCTCCCGG + Intronic
1197400596 X:125984335-125984357 CCACTCCTCTTCATCCCTCCTGG - Intergenic
1197449061 X:126588552-126588574 TAACCCCTCATCATCTTTCCAGG + Intergenic
1197736240 X:129851284-129851306 GACCCCCCCCACCTCCCTCCCGG - Intergenic
1198476293 X:137000286-137000308 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1198476393 X:137000512-137000534 GACCCCCCCCACCTCCCTCCCGG + Intergenic
1198552833 X:137762642-137762664 GAAATCCTCCTCATCCCCTCAGG + Intergenic
1199104636 X:143849714-143849736 GAATGCCTCCTCATCCCTCAAGG + Intergenic
1199354793 X:146849484-146849506 CACTCCTTCCTCATCCCTCCAGG - Intergenic
1199398399 X:147367494-147367516 GAACCCCTCCCCCTACTTCCTGG - Intergenic
1199452669 X:147992516-147992538 GACCCCCCCCACCTCCCTCCCGG + Intronic
1199717278 X:150515659-150515681 GACCCTATCCTCATTCCTCCTGG + Intergenic
1199789047 X:151133041-151133063 GAATGCCTCCTCATCCCTAAAGG + Intergenic