ID: 1142509639

View in Genome Browser
Species Human (GRCh38)
Location 17:385749-385771
Sequence CCGCACGTGCGCGCCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142509624_1142509639 -2 Left 1142509624 17:385728-385750 CCTGGACCCCCGGGCCCCTCCCC 0: 1
1: 0
2: 11
3: 154
4: 1057
Right 1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1142509620_1142509639 19 Left 1142509620 17:385707-385729 CCAGGTGCAGAGGGGCGGCAGCC 0: 1
1: 0
2: 3
3: 25
4: 240
Right 1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1142509625_1142509639 -8 Left 1142509625 17:385734-385756 CCCCCGGGCCCCTCCCCGCACGT 0: 1
1: 0
2: 0
3: 31
4: 403
Right 1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1142509627_1142509639 -10 Left 1142509627 17:385736-385758 CCCGGGCCCCTCCCCGCACGTGC 0: 1
1: 0
2: 0
3: 30
4: 386
Right 1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1142509626_1142509639 -9 Left 1142509626 17:385735-385757 CCCCGGGCCCCTCCCCGCACGTG 0: 1
1: 0
2: 2
3: 25
4: 248
Right 1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142509639 Original CRISPR CCGCACGTGCGCGCCGGGGC GGG Intronic
900244009 1:1629458-1629480 CTGCACGTGGGCGCCGCGCCGGG + Exonic
900305328 1:2003919-2003941 CCGACCGCGCGGGCCGGGGCCGG + Intergenic
900417250 1:2540772-2540794 CCCCCCGTGCGCCCCGGGGCAGG + Intergenic
901762239 1:11478866-11478888 CCGCCCGCGGGCGCCAGGGCCGG + Intergenic
902476886 1:16693097-16693119 CCGCCCGTGCTGGCCGGAGCTGG - Intergenic
904322586 1:29707250-29707272 CCGCACTAGCGCGGCTGGGCGGG + Intergenic
905960053 1:42035801-42035823 CCTTACCTGCGCGCCGGGCCGGG + Intronic
908501106 1:64744895-64744917 GCGCGCCTGTGCGCCGGGGCCGG + Intergenic
912345901 1:108963236-108963258 CCGCAGGCGCGACCCGGGGCGGG - Intronic
913186124 1:116372686-116372708 CCGCAGGTGGGCGCGGGGCCTGG + Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
922478588 1:225923604-225923626 CAGCACTTGGGCGCAGGGGCCGG + Intronic
923783023 1:237042495-237042517 CCGCGCCTCCTCGCCGGGGCCGG - Exonic
923902059 1:238336656-238336678 CTGCACGTGCACACTGGGGCTGG + Intergenic
924801637 1:247332387-247332409 CCGCACGTGGGCGCCAGGCCCGG - Intergenic
1064209098 10:13348170-13348192 CCGCAGGGCCGCGCCGAGGCAGG - Exonic
1065726050 10:28668824-28668846 GCGCACGGGCGGCCCGGGGCGGG + Intergenic
1068910502 10:62374321-62374343 CCGCACCTCCGCGCCGGGACCGG - Exonic
1069651685 10:70053659-70053681 GCGGGCGTGCGCCCCGGGGCCGG + Intronic
1070793564 10:79203876-79203898 ACGCATGTGTGTGCCGGGGCAGG - Intronic
1077105825 11:842320-842342 CCTGGGGTGCGCGCCGGGGCGGG - Intronic
1077837746 11:5938971-5938993 CATCACCTGCGCGCCGTGGCAGG - Intergenic
1079126171 11:17719992-17720014 CCTCACGTGCGCCCGGGGCCGGG - Exonic
1079284500 11:19116984-19117006 CGGCACGGGCGGGCCGGGGGTGG + Intergenic
1083933375 11:65857917-65857939 GCGCCCGTGGGCGCCGGGGAGGG - Intronic
1084320032 11:68368196-68368218 CCACACGTGTGCCTCGGGGCAGG - Intronic
1084588872 11:70078855-70078877 GCGCACGTGCGTGCCGGGAAGGG + Intronic
1084973024 11:72781678-72781700 CCGCCGGGGCCCGCCGGGGCCGG + Intronic
1085096042 11:73761219-73761241 CCGCACGGCGGCGACGGGGCAGG + Intergenic
1096435893 12:51591067-51591089 CGGCGCTTGCGGGCCGGGGCCGG + Intronic
1097872166 12:64610606-64610628 CCGCCCGCGCGCGACGGGACCGG + Exonic
1099202422 12:79691158-79691180 GCGCACCTGAGCGCCGGGGGCGG - Intergenic
1100611408 12:96194389-96194411 CCGCGGCTGTGCGCCGGGGCTGG - Exonic
1101252688 12:102951213-102951235 CCGAAAGTGCGCCCCGGGGTGGG - Intronic
1103377537 12:120469002-120469024 CGGCCCGTGCTCGCCGTGGCTGG - Intronic
1103749845 12:123151089-123151111 CTGCCCGCGCGCGCCGGGCCGGG + Intergenic
1104661057 12:130611688-130611710 CAGCATGTGTGTGCCGGGGCGGG - Intronic
1104814677 12:131638861-131638883 CCCCACGTGAGCCCAGGGGCTGG - Intergenic
1105349450 13:19602276-19602298 CGGCACGTGTGCGGCGGCGCCGG - Intergenic
1106516945 13:30464650-30464672 CCGCCCGCGGCCGCCGGGGCCGG + Intronic
1107604052 13:42040892-42040914 CAGCACGTGCGCCCCGCGCCCGG + Intronic
1113805853 13:113109770-113109792 CAGCACGGCCGCCCCGGGGCGGG + Intronic
1115545469 14:34462063-34462085 CCGGCCGCGCGCGCGGGGGCCGG - Intronic
1122038085 14:98962749-98962771 CCGCGCGTGCTCCCCTGGGCTGG - Intergenic
1122116632 14:99530809-99530831 CAGCAGGTGAGCGCTGGGGCGGG + Intronic
1123020300 14:105394869-105394891 CCGAACGTTCGGCCCGGGGCTGG + Exonic
1125918585 15:43510844-43510866 CCGCAGGGGCGGGCCGGAGCTGG - Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129539396 15:76338439-76338461 CTGCTCGAGCGCGCCGCGGCCGG + Exonic
1129920001 15:79311640-79311662 CCGCAGGTGCGAGCCCGGGATGG + Intronic
1132585999 16:705964-705986 CCGCGCGCGGGGGCCGGGGCGGG - Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1136178963 16:28538076-28538098 CCTCTCGTGCCCGCCAGGGCTGG + Exonic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136505327 16:30699072-30699094 CCCAACGTGCGCGCCGGGCGGGG - Intronic
1137426393 16:48384870-48384892 CCTCCCGGGCGCGCGGGGGCCGG + Intronic
1139448726 16:67014238-67014260 CCGCACGTCCGCCCCGGCTCTGG - Intergenic
1139631731 16:68235617-68235639 CAGCAGGTGAGCGCCGGGGTGGG - Exonic
1141972142 16:87491704-87491726 CGGCAAGGGCGCGCCCGGGCCGG - Exonic
1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG + Intronic
1144757150 17:17686607-17686629 GTGCACGCGCGCGCCGGGGAGGG + Intronic
1144816691 17:18039897-18039919 CTGCAGGTGAGCGCCGGGCCGGG + Exonic
1150562146 17:66303091-66303113 CGGCGCGTCCGCCCCGGGGCTGG + Intronic
1152783556 17:82236895-82236917 CCGCACGTGCCAGGAGGGGCAGG + Intronic
1157610137 18:48950709-48950731 CCTCCGGGGCGCGCCGGGGCCGG - Exonic
1159797962 18:72867234-72867256 GCGCACGGGCGCGGCGGGGAGGG + Intronic
1160789934 19:918663-918685 CAGCAGGTGCGCTCCGGAGCAGG + Exonic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1160990169 19:1857167-1857189 GCGCACGTGGGTGGCGGGGCAGG + Intronic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162022456 19:7874074-7874096 CCGGGCGTGCGCTCCGGGTCTGG - Intronic
1162420928 19:10565685-10565707 CCGCACGTCCAGGACGGGGCGGG + Intronic
1163157984 19:15449553-15449575 CCGCCCGTGCACCCCGGGGCAGG + Intronic
1167955194 19:53058481-53058503 CTGCACGTGCGCGCAGAGCCCGG + Intergenic
1202710901 1_KI270714v1_random:18923-18945 CCGCCCGTGCTGGCCGGAGCTGG - Intergenic
925237406 2:2291957-2291979 CCGCAGGTGCAGGGCGGGGCGGG + Intronic
929501579 2:42494615-42494637 CAGAACGTGGGGGCCGGGGCCGG - Exonic
935645259 2:105329486-105329508 CCGTGCGTGTGCGCTGGGGCAGG - Intronic
940293217 2:152098241-152098263 CCGCACGTGTGGGCCACGGCCGG + Intronic
941906085 2:170716784-170716806 CCGCAGGCGGGCGCCGGGCCGGG + Exonic
943811645 2:192195272-192195294 CCGCGAGTGCGGGCCGCGGCTGG + Exonic
945251952 2:207771266-207771288 GCGCACTTGCGCGCCGCGGGGGG + Intergenic
947669141 2:231925784-231925806 CCCCACGCGCCCGCCGGCGCGGG + Intronic
947741698 2:232487720-232487742 CGGCAGGTGCGCGCCCGAGCCGG + Exonic
1169137218 20:3204432-3204454 CTGCGCGTGCGCACCTGGGCGGG - Intronic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1172277202 20:33686216-33686238 CGGCCCATGCGCGCCGGCGCTGG - Exonic
1174451722 20:50624758-50624780 CCTCACGTGAGGGCTGGGGCCGG - Intronic
1175903005 20:62367359-62367381 GCGCTCGGGCGGGCCGGGGCGGG - Intergenic
1178408758 21:32347136-32347158 CCGCCTGTGTGCGCCGGGCCAGG + Exonic
1178707856 21:34889635-34889657 CCGCTCGAGCGCACGGGGGCGGG - Intronic
1180190695 21:46161197-46161219 CCGCAGGTGCGGGCAGCGGCGGG + Exonic
1180216087 21:46324527-46324549 CCTCTCGGGCGGGCCGGGGCGGG + Intronic
1183401782 22:37609075-37609097 CCGCTGGACCGCGCCGGGGCCGG - Intronic
1183504706 22:38202560-38202582 CCGCCCGCGGGCGCCGGGCCAGG - Intronic
1184562140 22:45269353-45269375 CCGCAAGGGTGGGCCGGGGCCGG - Intergenic
1184617102 22:45645720-45645742 CCGCACGTGGGTCCCAGGGCAGG - Intergenic
1185037948 22:48489508-48489530 CCGCACGTGGAGGCCGGCGCGGG + Exonic
950153821 3:10707967-10707989 CCGCTGGTGCGCGCCCGGCCCGG + Intronic
952476630 3:33717729-33717751 CCGGACGCGAGCGCCGGGCCGGG - Intronic
954110191 3:48429270-48429292 CGGGATGTGCGCGCCGAGGCGGG + Exonic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
966866125 3:184260045-184260067 CCGCCCGCGGGCGCCTGGGCCGG + Exonic
968433830 4:575214-575236 CCTCTCGGGCGCGCCGGGGCCGG - Intergenic
968500269 4:946728-946750 CCGCCTGTGGGAGCCGGGGCTGG - Intronic
968593826 4:1472482-1472504 CAGCAGGAGCGCGGCGGGGCTGG - Intergenic
968609008 4:1548581-1548603 CCACACGTGGCCGCGGGGGCAGG - Intergenic
968640541 4:1712372-1712394 CCTCCCGCGCGCGCCGGGTCGGG + Exonic
973613893 4:52659995-52660017 CCGCCCGAGCGCGCCGCTGCTGG - Intergenic
977231012 4:94451799-94451821 CCGCCCCTGCGCGGCGCGGCTGG + Intergenic
981300806 4:143184711-143184733 CCGCACCTGCGCGGCGGGGCGGG + Intergenic
982232673 4:153223133-153223155 CCGGACGGGCGCTGCGGGGCTGG + Intronic
990003875 5:50923258-50923280 CTGCACGTGGCCGCCGGGGCAGG + Intergenic
1002349954 5:178576847-178576869 CCTCCCGTGCGCGCAGGGGGAGG - Intronic
1004262065 6:14117536-14117558 CCGCCCCCGCGCGCCCGGGCCGG - Intronic
1004262067 6:14117537-14117559 CGGCCCGGGCGCGCGGGGGCGGG + Intronic
1011277472 6:85643860-85643882 GCGCACGTGTCCCCCGGGGCGGG + Intergenic
1013463886 6:110400329-110400351 GCGCAGGAGCGGGCCGGGGCGGG + Intronic
1015910269 6:138162181-138162203 CGGCACCTGCTCGCCGCGGCGGG + Intronic
1019358200 7:591910-591932 CCGTGCGTGGGAGCCGGGGCTGG - Intronic
1019606631 7:1913417-1913439 CCGCGCGTGCACGCCCGGCCTGG + Intronic
1019711355 7:2519578-2519600 GTGCACGTGCGCGCCGGGGGCGG + Intronic
1024317584 7:48035710-48035732 CGGGCAGTGCGCGCCGGGGCTGG + Intronic
1025033029 7:55572532-55572554 CCGCAGGCGCGCGCCCGGCCGGG - Intronic
1026048031 7:66921439-66921461 GCGCAGCTGCCCGCCGGGGCGGG + Exonic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1035422819 7:158743386-158743408 CCGCAGGAGGGCGCCGGTGCAGG - Intronic
1035627260 8:1080275-1080297 CAGCACGCGGGCGGCGGGGCGGG - Intergenic
1039493670 8:37965670-37965692 GCGCACGTCCCCACCGGGGCCGG + Exonic
1040512246 8:48105672-48105694 CCACAGGTGTGCGCCGGGGGAGG + Intergenic
1041369475 8:57143518-57143540 GCGCACGGGCGCGCACGGGCTGG + Intergenic
1049693708 8:143973604-143973626 CCCCACGGGCGGGGCGGGGCCGG + Intronic
1049791089 8:144473046-144473068 CTGCAGGTGGGCGCCGGGGCGGG + Exonic
1049848978 8:144820679-144820701 CCGCGCGAGTGCGCAGGGGCAGG + Intergenic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057733580 9:97633081-97633103 CCGCACGCTCGCGTCAGGGCCGG + Intronic
1059611958 9:115908062-115908084 CTGCACGTGGGTGCTGGGGCGGG + Intergenic
1060952322 9:127612201-127612223 CCGCCGGCGCGCGCGGGGGCGGG - Intergenic
1061365864 9:130172300-130172322 CCGCACCCGCGCGCCAGGGGTGG - Intergenic
1062022396 9:134325855-134325877 CCCCACGTGTCCGCCGCGGCGGG + Intronic
1190385642 X:49879968-49879990 CCCCAGGGCCGCGCCGGGGCCGG - Exonic
1198177648 X:134172277-134172299 CAGCTCGAGCGCTCCGGGGCCGG + Intergenic
1200138512 X:153886185-153886207 GCGGGCGTGCGCGCAGGGGCGGG + Intronic