ID: 1142509693

View in Genome Browser
Species Human (GRCh38)
Location 17:385893-385915
Sequence CCCCGAGGGTCCCCGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142509669_1142509693 17 Left 1142509669 17:385853-385875 CCCCCCCCACCCGCACCCCGAGC 0: 1
1: 0
2: 33
3: 382
4: 1878
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509665_1142509693 23 Left 1142509665 17:385847-385869 CCCCGCCCCCCCCCACCCGCACC 0: 1
1: 2
2: 53
3: 759
4: 4676
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509686_1142509693 0 Left 1142509686 17:385870-385892 CCGAGCTGGGGGCACCACAGGGT 0: 1
1: 0
2: 4
3: 28
4: 467
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509672_1142509693 14 Left 1142509672 17:385856-385878 CCCCCACCCGCACCCCGAGCTGG 0: 1
1: 1
2: 3
3: 60
4: 480
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509681_1142509693 7 Left 1142509681 17:385863-385885 CCGCACCCCGAGCTGGGGGCACC 0: 1
1: 0
2: 1
3: 25
4: 215
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509680_1142509693 8 Left 1142509680 17:385862-385884 CCCGCACCCCGAGCTGGGGGCAC 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509666_1142509693 22 Left 1142509666 17:385848-385870 CCCGCCCCCCCCCACCCGCACCC 0: 1
1: 2
2: 55
3: 745
4: 5026
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509668_1142509693 18 Left 1142509668 17:385852-385874 CCCCCCCCCACCCGCACCCCGAG 0: 1
1: 0
2: 20
3: 260
4: 2012
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509676_1142509693 12 Left 1142509676 17:385858-385880 CCCACCCGCACCCCGAGCTGGGG 0: 1
1: 0
2: 4
3: 27
4: 255
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509670_1142509693 16 Left 1142509670 17:385854-385876 CCCCCCCACCCGCACCCCGAGCT 0: 1
1: 1
2: 9
3: 104
4: 881
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509664_1142509693 29 Left 1142509664 17:385841-385863 CCGCGTCCCCGCCCCCCCCCACC 0: 1
1: 1
2: 54
3: 658
4: 5200
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509684_1142509693 1 Left 1142509684 17:385869-385891 CCCGAGCTGGGGGCACCACAGGG 0: 1
1: 0
2: 1
3: 45
4: 407
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509674_1142509693 13 Left 1142509674 17:385857-385879 CCCCACCCGCACCCCGAGCTGGG 0: 1
1: 0
2: 6
3: 55
4: 374
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509667_1142509693 21 Left 1142509667 17:385849-385871 CCGCCCCCCCCCACCCGCACCCC 0: 2
1: 5
2: 222
3: 1805
4: 9186
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509682_1142509693 2 Left 1142509682 17:385868-385890 CCCCGAGCTGGGGGCACCACAGG 0: 1
1: 0
2: 3
3: 18
4: 205
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509671_1142509693 15 Left 1142509671 17:385855-385877 CCCCCCACCCGCACCCCGAGCTG 0: 1
1: 1
2: 6
3: 70
4: 566
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145
1142509678_1142509693 11 Left 1142509678 17:385859-385881 CCACCCGCACCCCGAGCTGGGGG 0: 1
1: 0
2: 3
3: 30
4: 331
Right 1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142509693 Original CRISPR CCCCGAGGGTCCCCGAGGTC GGG Intronic
900180512 1:1309025-1309047 GCCCGCGCGTCCCCGGGGTCCGG + Intronic
900900056 1:5510008-5510030 CTCCTGGGGTCCCCGAGGACAGG + Intergenic
901022047 1:6260658-6260680 CCCCGAAGGTCCCCAAGTTGGGG + Intronic
901139493 1:7019188-7019210 ACCCGAGTGTCCGCGAGTTCAGG - Intronic
901637831 1:10678493-10678515 CCGCGAGGGGGCCCGAGGCCGGG + Intronic
902725739 1:18334885-18334907 CCCCCAGGCTGCCCGAGGTCCGG + Exonic
913384149 1:118241373-118241395 CCCCCTGAGTCCCCGAAGTCTGG - Intergenic
914979395 1:152399346-152399368 CCCTGAGTGTCCCTGAGGACAGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
919471907 1:197989239-197989261 CCCCCATGGTCCCCCAGGGCCGG - Intergenic
919758961 1:201085057-201085079 CCCAGAGGGGCCCCGAAGGCTGG - Intronic
921155027 1:212432836-212432858 CCCAGAGCCTCCCCGAGGGCGGG - Intergenic
923712089 1:236395753-236395775 CCTCGGGGGTCGCCGAGGCCCGG - Intronic
924421876 1:243917351-243917373 TCCCGCGGGCCCCCGAGGCCGGG + Intergenic
1064256674 10:13748157-13748179 CCCCAGGGGTCCCCCAGGGCAGG + Intronic
1067298384 10:44989101-44989123 CCCGGAGTGTCTCCCAGGTCTGG + Intronic
1067321188 10:45222716-45222738 CTCCGAGGAGTCCCGAGGTCAGG + Intergenic
1070768431 10:79069319-79069341 CCCCGAGAGTCCCCGGGGAGCGG - Intronic
1072413894 10:95231065-95231087 CCCCGAGGTTCCTCGCGGGCCGG - Intergenic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1075911761 10:126131181-126131203 CACCCAGGGTCCCCGAGGCAGGG - Intronic
1076847447 10:133076240-133076262 CCCTGAGGGTGCCCAAGGTGGGG - Intronic
1076864307 10:133159796-133159818 CCCCCAGGGTCCCCCAGGACCGG + Intergenic
1077412460 11:2410043-2410065 CCCCGAGGGGCCCTGCGGACGGG + Intronic
1085046361 11:73356039-73356061 CCCCTAGGGACCCTGATGTCAGG - Intronic
1094845259 12:34358715-34358737 CGCCCAGGGTCCCCTAGGCCTGG + Intergenic
1096693101 12:53333069-53333091 CCCAGAGGGCCCTCGAGGGCAGG + Intronic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1102509153 12:113402627-113402649 CCCCGATTGTCCCTGAGGCCAGG - Intronic
1103728995 12:123013652-123013674 CCCCGAAGGTCACCTAGGGCAGG - Intronic
1104029495 12:125054096-125054118 CACAGTGGCTCCCCGAGGTCAGG - Intergenic
1104974537 12:132546502-132546524 CTCCTAGGGTCCCCCCGGTCTGG - Intronic
1104974553 12:132546548-132546570 CTCCTAGGGTCCCCCCGGTCTGG - Intronic
1106037009 13:26052099-26052121 CCGCGGGCGTCCCTGAGGTCGGG - Intergenic
1106754742 13:32811261-32811283 CCCTGCAGGTCCCCCAGGTCAGG + Intergenic
1113660787 13:112105185-112105207 GCCCGGGGGTCCCCGCGGGCAGG + Intergenic
1119226450 14:72947884-72947906 CCCCAAGGGTCCCAGAGGCCAGG - Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1122815882 14:104313781-104313803 CCCTGAGGGTCCCTGAGGGGTGG + Intergenic
1125794963 15:42397295-42397317 CCCCTAAGTTCCCCGAGGACTGG + Intronic
1127480245 15:59371780-59371802 CCCCGAGGGTCTCCGCGCCCCGG - Intronic
1129298095 15:74610788-74610810 TCCCAAGGGTCCCCCAGGCCTGG + Intronic
1129516357 15:76159995-76160017 GCCCCGGGGTCCCAGAGGTCTGG + Intronic
1130048582 15:80464825-80464847 TCCCGAGTGTCACCGAGGTGGGG + Intronic
1130562410 15:84968934-84968956 CCCAGAGGGTGCCCCAGCTCAGG - Intergenic
1131831813 15:96359496-96359518 CCCCAAGACTCCCCGAGGTGGGG + Intergenic
1132660173 16:1057751-1057773 CCTCGAGGGTCCCCAGGGTCGGG + Intergenic
1132677517 16:1126816-1126838 GCCCGAAGGTCCCCGAGGAGGGG + Intergenic
1135864704 16:26090623-26090645 CCCCGAGGGTCTCCAAGGGGAGG - Intronic
1139539220 16:67601569-67601591 CTCAGAGCATCCCCGAGGTCAGG - Intronic
1140664040 16:77212609-77212631 TCCGGAGCGCCCCCGAGGTCGGG + Exonic
1141116782 16:81315589-81315611 GCCTCAGGGTCTCCGAGGTCGGG - Intronic
1141184893 16:81779803-81779825 CTCCGAGCGTCCGCGAGCTCTGG - Intronic
1141810742 16:86373754-86373776 CCCAGAGAGACCCAGAGGTCTGG - Intergenic
1141949549 16:87331750-87331772 CCCCGAGCAGCCCCGAGCTCTGG - Intronic
1142355701 16:89600802-89600824 CCCAGAGGGGCCCCTAGGGCAGG + Intergenic
1142442309 16:90106684-90106706 CCCCGAGGCTGCCCGAGGAAAGG + Intergenic
1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG + Intronic
1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG + Intergenic
1144854545 17:18260763-18260785 CCCCCAGGGTCACCGGGCTCGGG + Intronic
1148323583 17:46771349-46771371 CCCCGAGGCGCCCCCAGGGCTGG - Intronic
1148677035 17:49451606-49451628 CCCCAAGGGCCCCCAAGGGCAGG + Intronic
1152108114 17:78342339-78342361 CCCCGAGGGACCCCGCCGCCCGG + Intergenic
1152353964 17:79797863-79797885 CCCGGAGGGTGGCCGAGGGCAGG - Intronic
1157612874 18:48969274-48969296 TCCCCAGGATCCCTGAGGTCAGG - Intergenic
1161252189 19:3286104-3286126 CCCCGCGGGTCCCAGAGGCCCGG - Intronic
1161973438 19:7596266-7596288 CGCCGGGGGTCCCCGGGCTCGGG + Intronic
1163526540 19:17824855-17824877 CCCCAAGGAACCCTGAGGTCAGG + Exonic
1164725151 19:30461144-30461166 CCCAGAGATTCCCAGAGGTCTGG + Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1166420302 19:42631390-42631412 CCCCGAGGGCCCCCCAGGCCAGG + Intronic
1168150918 19:54448297-54448319 CCCCGAAGGTCCCTGAGGTCAGG - Intergenic
927552262 2:24010487-24010509 CTCCCGGGGTCCCCGAGCTCTGG + Intronic
927683932 2:25158107-25158129 CCCAGAGGAGCCCAGAGGTCTGG - Exonic
931692428 2:64846509-64846531 CTCCCAGGGTCCCAGAGGGCAGG - Intergenic
932725684 2:74178378-74178400 GCCCGAGCGCCCCCGAGGGCGGG - Intronic
932771516 2:74503205-74503227 ACCCGAGTGACCCCGGGGTCCGG + Intronic
935361595 2:102250703-102250725 ACCCTAGGGTCCCCGCGGCCTGG - Intergenic
939894922 2:147779909-147779931 CCACGAGGTTCCCCGTGATCTGG + Intergenic
941666542 2:168247907-168247929 CCCCTGGGGACCCCGAGGGCGGG + Exonic
946163106 2:217847928-217847950 CCCAGAGTGTCCCCGGGGCCTGG - Exonic
948777618 2:240297794-240297816 TCCCGAGAGACCCCGAGGCCAGG - Intergenic
949040129 2:241844173-241844195 CCCCGGGGAGCCCCGAGGCCCGG + Intergenic
1168916498 20:1492513-1492535 TCCCCTGGGTCCCAGAGGTCTGG + Intergenic
1172474635 20:35227165-35227187 CGCCGAGGGCCGCCGAGGCCGGG + Intronic
1174393806 20:50233897-50233919 CCCCCAGAGACCCCCAGGTCCGG - Intergenic
1175691048 20:61066235-61066257 CCCAGAGGGACCCCAAGGTGTGG - Intergenic
1175819243 20:61899776-61899798 CCCACAGGGTCTCCGAGGACAGG + Intronic
1175828484 20:61949935-61949957 CACTGAGGGCCTCCGAGGTCAGG - Intergenic
1176547872 21:8209214-8209236 CCCCGCGGCGCCCCGACGTCCGG - Intergenic
1176566807 21:8392247-8392269 CCCCGCGGGCACCCGACGTCCGG - Intergenic
1180039170 21:45267067-45267089 CCGTGAGCGTCCCCGAGGCCGGG - Intronic
1180039199 21:45267185-45267207 CCGTGAGCGTCCCCGAGGCCGGG - Intronic
1180042668 21:45288158-45288180 TCCTGAGGGTCCGCGAGGCCGGG + Intergenic
1180067183 21:45418324-45418346 CGCTGAGGGTCCCCGAGCTGGGG + Intronic
1180181519 21:46120526-46120548 CCCTGAGGGGCCCCGCGGCCTGG + Exonic
1180785822 22:18547159-18547181 CCCTGAGGGTGCCAGAGGTAGGG - Intergenic
1180843801 22:18970917-18970939 GCCCGGGGGTCCCCGAGGCTGGG + Intergenic
1180951629 22:19723076-19723098 CCCCGGGGGCCCTCCAGGTCGGG - Exonic
1181131105 22:20732884-20732906 CCCCGAGGGTGCCAGAGGTAGGG - Intronic
1181242747 22:21486713-21486735 CCCTGAGGGTGCCAGAGGTAGGG - Intergenic
1181737366 22:24892352-24892374 CCCCGTGGTGCCCAGAGGTCTGG + Intronic
1183482307 22:38071833-38071855 CCCAGAGGGAGCCTGAGGTCAGG - Intronic
1184089244 22:42283708-42283730 GCCCGAGGCTCCCCGGGGGCGGG - Intronic
1184495580 22:44839273-44839295 CCCCGAGGTGCCCTGAGGGCTGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1184720418 22:46309399-46309421 CACTGAGGGTCCTGGAGGTCTGG + Intronic
1184734340 22:46389249-46389271 CCCCGAGTGTCCCCGAGCCAGGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
957078425 3:75618928-75618950 CCCCGCGGCCCCCCTAGGTCAGG + Intergenic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
963335515 3:143971007-143971029 CCCTGAGGGTCCCTGAGGAGCGG - Intergenic
967916487 3:194582387-194582409 CCCGGAGGATTCCCTAGGTCTGG - Intergenic
968362581 3:198157648-198157670 CCCCGAGGCTGCCCGAGGAAAGG + Intergenic
969021504 4:4142902-4142924 CCCCGCGGTCCCCCTAGGTCAGG + Intergenic
969713578 4:8858068-8858090 CCACGCCGGTCCCCGAGGCCCGG - Intronic
969732361 4:8964515-8964537 CCCCGTGGTCCCCCTAGGTCAGG - Intergenic
975701875 4:77075305-77075327 CCCCGAGGTTCCCCGGGCTGGGG + Intronic
981616300 4:146647989-146648011 CCCCGAGGGGCCCCCAGAGCTGG + Intergenic
985635429 5:1033454-1033476 CCGCGAGGGCCCGCGAGGACCGG + Exonic
1002046186 5:176543030-176543052 CCCCGGGGCTCCCCGAGTTGGGG + Intronic
1002183028 5:177441284-177441306 GCCCGTGGCTCCCCGAGGCCAGG - Intronic
1006296126 6:33170879-33170901 TCCCTGGGGTCCCCGAGCTCCGG + Exonic
1006784967 6:36660333-36660355 CCCCGGGGGTCCCGGAAGTGAGG - Intergenic
1012400870 6:98842479-98842501 CGGCCAGGGTCCCCGAGGTGGGG - Intergenic
1015806899 6:137118907-137118929 TCCCAGGGGACCCCGAGGTCAGG + Intergenic
1016163225 6:140907613-140907635 GCTCGAGGATCCCCTAGGTCTGG + Intergenic
1018185857 6:161264878-161264900 CCCCTAGAGTCCCCCAGGGCTGG + Intronic
1019253101 7:31059-31081 CCCCGAGGCTGCCCGAGGAAAGG - Intergenic
1019521215 7:1461334-1461356 CCTCCAGGGTCCCCGAAGCCAGG + Intergenic
1019523437 7:1470516-1470538 CCTCGAGGATCCCCGGGGACGGG + Exonic
1019740388 7:2670146-2670168 CCCTGAGGCCCCCTGAGGTCTGG + Intergenic
1020308927 7:6854931-6854953 CCCCGCGGTCCCCCTAGGTCAGG + Intergenic
1022088959 7:27095651-27095673 CCCCCAGGTTCCCGGAAGTCTGG + Exonic
1028334546 7:89636082-89636104 CCACCAGGGTCCCTGAGGACAGG - Intergenic
1029170612 7:98627100-98627122 CCCTCAGGGTCCCCCAGGGCAGG - Intronic
1034467423 7:151238268-151238290 CCCCCAGGGCCCCCGGGGGCTGG + Exonic
1045222631 8:100213479-100213501 CCACGGGGGCCCCGGAGGTCGGG - Intronic
1047581850 8:126224405-126224427 CCCCGATGGTAGCCCAGGTCAGG - Intergenic
1049435673 8:142585157-142585179 CCACGTGGGTCCCCCAGGCCGGG - Intergenic
1049785985 8:144451075-144451097 CCCCGGGTGTCCCCCAGGGCGGG + Intronic
1056338839 9:85603677-85603699 CCCCTAGGGTCCCCAATTTCAGG + Intronic
1057222078 9:93262855-93262877 CCCTGAGGCTCCACCAGGTCAGG - Intronic
1060855954 9:126915098-126915120 CCCCGAGGGCCGCCGAAGCCGGG + Intronic
1061008866 9:127943630-127943652 CCCCGAGAGTCCCCGACTCCAGG - Intronic
1061338574 9:129960584-129960606 CCCCGAGGCTCCTCCAGATCTGG - Intronic
1061489990 9:130939376-130939398 CCCTGCGGGCCCCCGAGGTCTGG + Intergenic
1062101053 9:134728791-134728813 CCACAGAGGTCCCCGAGGTCTGG + Exonic
1062111591 9:134785068-134785090 CCCAGGGGGTCCCAGAGGACCGG - Exonic
1062373948 9:136253695-136253717 CCTCAAGGGGCCCCGAGGGCGGG + Intergenic
1062747269 9:138221307-138221329 CCCCGAGGCTGCCCGAGGAAAGG + Intergenic
1197746070 X:129932690-129932712 CGCCGAGGCTCCCCGAGGACGGG - Intergenic
1200039745 X:153356265-153356287 CTCAGAAGGTCCCCAAGGTCAGG + Intronic
1200706551 Y:6447819-6447841 CCTGAAGGGTCCCTGAGGTCGGG - Intergenic
1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG + Intergenic
1202180163 Y:22132980-22133002 CCTGGAGGGTCCCTGAGGTTGGG - Intergenic
1202211197 Y:22453419-22453441 CCTGGAGGGTCCCTGAGGTTGGG + Intergenic