ID: 1142509769

View in Genome Browser
Species Human (GRCh38)
Location 17:386094-386116
Sequence GGCCGGCGGGGCGCACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142509769_1142509781 11 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509769_1142509782 16 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509782 17:386133-386155 CGCACCCCCCGCCCTCGGACTGG 0: 1
1: 0
2: 1
3: 14
4: 244
1142509769_1142509783 17 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509783 17:386134-386156 GCACCCCCCGCCCTCGGACTGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1142509769_1142509788 23 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509788 17:386140-386162 CCCGCCCTCGGACTGGGCCCCGG 0: 1
1: 0
2: 0
3: 21
4: 222
1142509769_1142509792 29 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509792 17:386146-386168 CTCGGACTGGGCCCCGGACCCGG 0: 1
1: 0
2: 0
3: 13
4: 176
1142509769_1142509793 30 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509793 17:386147-386169 TCGGACTGGGCCCCGGACCCGGG 0: 1
1: 0
2: 1
3: 23
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142509769 Original CRISPR GGCCGGCGGGGCGCACAGGG AGG (reversed) Intronic
900187574 1:1339553-1339575 GGCCCTCGGGGCACACGGGGCGG - Intronic
900349740 1:2228680-2228702 CGCCGCCGGGGCGCGCGGGGCGG + Exonic
900522398 1:3111967-3111989 GGCCGGCGCGGCGGCGAGGGAGG + Intronic
902403007 1:16168046-16168068 GGCTGGCGGGGCCCAAGGGGAGG - Intergenic
902444385 1:16452756-16452778 GGCGGGGGGGGCGCGCGGGGAGG - Intronic
902772258 1:18652110-18652132 GGCCGGCTGGGCCCACAGCCTGG + Intronic
902917010 1:19645179-19645201 GGCCGGCGGGAGGCAGGGGGAGG - Intronic
903332482 1:22603113-22603135 GGCTGGCAGGGGGCACACGGTGG - Exonic
903543845 1:24111416-24111438 GGGCGGCGGGTGGCACAGGCTGG + Intronic
904591414 1:31617622-31617644 GGCCGGCGGGAGGGGCAGGGCGG - Intergenic
905873243 1:41416725-41416747 GGGGGGCGGGGGGCAGAGGGAGG - Intergenic
906244129 1:44261269-44261291 AGCGGGCAGGGCGCACAGCGCGG + Intronic
906403403 1:45521994-45522016 TTCCGGCGGGGCGCGCCGGGCGG - Intronic
906544459 1:46611630-46611652 GGCTGGAGGGGCTCAGAGGGAGG - Intronic
910237219 1:85048327-85048349 GGCGCCCGCGGCGCACAGGGAGG - Intronic
914066854 1:144250433-144250455 GGCGGGCCGGGGGCACCGGGAGG + Intergenic
914112299 1:144715921-144715943 GGCGGGCCGGGGGCACCGGGAGG - Intergenic
915439211 1:155934153-155934175 GGCCGGCGGGGATCCGAGGGAGG - Intronic
915458089 1:156053748-156053770 GGCCGGCCGGGCGGGCGGGGAGG - Exonic
915616926 1:157046043-157046065 GGGGGGCAGGGCGCGCAGGGAGG - Intergenic
916024578 1:160822741-160822763 GGCCGGTGTGGCCCACTGGGTGG - Intronic
916754597 1:167756903-167756925 GGATGTCGGGGAGCACAGGGTGG + Intronic
922262111 1:223951955-223951977 GGCCGACGGGAGGCACAGGCTGG + Intergenic
922467980 1:225857373-225857395 GGCCGGCGGGGCGGGGGGGGGGG + Intronic
922502917 1:226110171-226110193 GTCCCGCGGGACGCACCGGGCGG - Intergenic
922695310 1:227728425-227728447 GGCAGGCGGGGCAGGCAGGGCGG - Intergenic
922917648 1:229271383-229271405 GGCTGGCGGGGCGCGCGGGTCGG + Intronic
924433941 1:244022092-244022114 GGCCGGCGGGGCAGGCAGGATGG - Intergenic
1062874212 10:931969-931991 GGCGGGCGGGGCGGGCGGGGCGG - Intergenic
1062874217 10:931978-932000 GGCGGGCGGGGCGGGCGGGGCGG - Intergenic
1062878114 10:958174-958196 GGGCTGCGGGGAGCACCGGGTGG - Intergenic
1063067550 10:2624414-2624436 GACCTGCAGGGCGCACAGGAGGG + Intergenic
1069615135 10:69802009-69802031 GGGCGAAGGGGCGCACACGGAGG - Exonic
1070147506 10:73785748-73785770 GGTGGCCGGGGCGCTCAGGGCGG - Exonic
1073049189 10:100656691-100656713 GGCGGGCGGGGCGCAGCGGCGGG + Intergenic
1073250984 10:102120205-102120227 GGCCGGCGGCGAGCGCAGCGGGG - Exonic
1073287902 10:102399456-102399478 GGCCTGCGGCTCGCACTGGGGGG - Exonic
1073305975 10:102503933-102503955 GGGCGGCGGGGCGCTAAGGGGGG - Intergenic
1073325797 10:102643560-102643582 GGCCGGGGGGGCGAAGGGGGAGG + Intergenic
1076149500 10:128150734-128150756 AGCCTGCGGGGCGCACGGAGGGG + Intergenic
1076706469 10:132304789-132304811 GCCCGGCCCGGCGCCCAGGGCGG + Intronic
1076741759 10:132489120-132489142 TGCCTGAGGGGCTCACAGGGAGG - Intergenic
1077056050 11:593729-593751 GGCCGGCGGAGCGCACTGCAAGG - Intronic
1077080352 11:722179-722201 GGCGGCAGGGGCGCGCAGGGTGG + Intronic
1077085296 11:747162-747184 GCCCCGCGGGACGCACCGGGAGG - Intergenic
1077093532 11:789989-790011 GGCGGGCGGGGCGGGCGGGGCGG - Intronic
1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG + Exonic
1077233775 11:1470234-1470256 GGCCGGCGGGGTCCACAGTGGGG - Exonic
1077436136 11:2540090-2540112 GGCCAGTGGGCCCCACAGGGTGG - Intronic
1077474133 11:2778453-2778475 GGCCGGCCGAGGGCTCAGGGAGG + Intronic
1077479642 11:2807630-2807652 AGCCGGCGGTGGGCACAGGCGGG + Intronic
1078057577 11:8019773-8019795 GGCCGGCGGGGCGCAGACGCCGG - Intronic
1079106059 11:17573201-17573223 GGCCAGTGTGGCGCACAGGCAGG - Exonic
1083303760 11:61752555-61752577 GGCGGGCGGGGCGCGTGGGGCGG + Intergenic
1083894029 11:65611370-65611392 GGCTGGTGGGGGGCACAGGCAGG - Intronic
1084028442 11:66467032-66467054 GGCCGCCGGGGCGGAGGGGGCGG + Intronic
1084086420 11:66857242-66857264 GGCCGGCCGGGCTCGCAGGGAGG + Intronic
1084089395 11:66870234-66870256 GGCCGGCAGGCCTCACAGTGGGG - Intronic
1084129114 11:67119585-67119607 GCCCCGGGGGGCGGACAGGGCGG - Intronic
1084539062 11:69775326-69775348 GGCGGGCCTGGCGCTCAGGGAGG - Exonic
1089301889 11:117503977-117503999 GGCCAGTGAGGGGCACAGGGTGG + Exonic
1091759357 12:3077116-3077138 GGGCGGCGGGGCGGGGAGGGAGG + Intergenic
1091937478 12:4445258-4445280 GGCCGTCGGGGAGCACCTGGAGG + Exonic
1095271451 12:40224574-40224596 GGCTGGCGGGTCGCGGAGGGTGG + Intronic
1096260126 12:50085270-50085292 GGCCGGCCGGGGGAACAGGCGGG + Exonic
1096741262 12:53695678-53695700 GGCGGGCGGGCTGCACAGAGGGG + Intergenic
1096779744 12:53984995-53985017 GGCAGGCGGAGCGCGCAGAGTGG - Intergenic
1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG + Intergenic
1098123773 12:67269436-67269458 GGGCGGCGGGGCGTACAGAAGGG - Exonic
1100760065 12:97797466-97797488 TGCAGGTGGGGTGCACAGGGTGG + Intergenic
1102278277 12:111599158-111599180 GGCCGGAGGGGCGCCCGGGCTGG + Exonic
1102278358 12:111599395-111599417 GGCCGGCGCGGCGGAGCGGGCGG - Exonic
1102924926 12:116819375-116819397 AGCCGGCGGCGCGCAGAGCGGGG + Intronic
1103779595 12:123389633-123389655 GCCCGGCCGGGCGCCCCGGGCGG - Intronic
1104969960 12:132526784-132526806 GGCAAGTGGGGCTCACAGGGAGG - Intronic
1105026349 12:132851803-132851825 GGCCGCCGGGAAGCACAGCGAGG + Intronic
1106516912 13:30464548-30464570 GGCCTGCCGGGCGCACGTGGCGG - Intronic
1107884782 13:44866257-44866279 GGGAGGCGGGGCGGAAAGGGAGG - Intergenic
1112652730 13:101416392-101416414 GCCAGGCGCGGCGCCCAGGGCGG + Intronic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1113604275 13:111594545-111594567 GGGCAGGGGGGCGCACATGGTGG - Intronic
1113857481 13:113455676-113455698 GGCTGGCGGGCCACACACGGGGG + Intergenic
1115398582 14:32934893-32934915 GGCCGGCGGGGCGGCCGCGGGGG + Intergenic
1117478331 14:56118833-56118855 GACCGCCGGGGCGCTCGGGGCGG + Intronic
1117723164 14:58646561-58646583 CGCGGGCGGGGGCCACAGGGCGG + Exonic
1117912429 14:60648523-60648545 GGCCGGCGGGGAGGACTTGGTGG + Intronic
1121104341 14:91270966-91270988 GGGTGGAGGGGCGCAGAGGGAGG + Intergenic
1121104355 14:91271002-91271024 GGGTGGAGGGGCGCAGAGGGAGG + Intergenic
1121104426 14:91271177-91271199 GGGTGGAGGGGCGCAGAGGGAGG + Intergenic
1122138901 14:99650447-99650469 GGCCGGCGGCTCTAACAGGGAGG + Intronic
1122270378 14:100566309-100566331 GCCCGGCTGGGTGCACAGGTAGG - Intronic
1122582000 14:102777178-102777200 GGCCCGCGGGGCGCGCGGCGGGG + Intergenic
1122836975 14:104435254-104435276 GGCAGTCGGGGTGCTCAGGGAGG + Intergenic
1123716719 15:23039233-23039255 GGCCGGCGGGGAGCAGGCGGTGG + Intronic
1124822674 15:33063086-33063108 GGCCTGCTGGGCGCCCATGGTGG + Intronic
1130011020 15:80152944-80152966 GGCCGTGGGGGCGGGCAGGGGGG + Intronic
1131484419 15:92808611-92808633 GGCTGGGGAGGCGCACGGGGCGG - Intronic
1131511255 15:93050770-93050792 GGCTGGCAGGGCGCACAGGGAGG - Intronic
1132556527 16:575137-575159 GGCCTGCTGGGGGCACAGGCAGG - Intronic
1132588972 16:718117-718139 GGCGGGCGGGGTGCACAATGGGG + Exonic
1132683809 16:1154048-1154070 GGCCGGCGGGGGGCGGGGGGCGG + Intronic
1132719682 16:1309611-1309633 CGCGGGCGGGGCGCGCGGGGCGG - Intronic
1132807659 16:1782509-1782531 GGCCGGCGGAGCGCGCAGCGGGG - Exonic
1132853810 16:2036034-2036056 GGCCAGCGTGGCGCACAGGCAGG - Intronic
1133323496 16:4929405-4929427 AGCTGGCGGGGGGCACAGCGTGG - Intronic
1133784404 16:8963527-8963549 GGCCGGCGGGCCGGGCCGGGCGG + Intronic
1133784451 16:8963636-8963658 GGCCGGCCGGGGGCGGAGGGCGG + Intronic
1134536683 16:15032082-15032104 GGCCAGCGTGGCGCTCAGGGAGG + Intronic
1134656125 16:15949668-15949690 GGGCGGCGGCGGGCACCGGGCGG - Exonic
1134656143 16:15949718-15949740 GGGCGGCGGCGGGCACCGGGCGG - Exonic
1135342901 16:21664175-21664197 GGCGGGCGGGTGGCGCAGGGCGG - Intergenic
1136230760 16:28883920-28883942 AGGCAGCGGGGGGCACAGGGTGG - Intronic
1136281967 16:29218617-29218639 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1136719764 16:32310600-32310622 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1136838139 16:33516880-33516902 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1138229047 16:55324434-55324456 GGCCTGCGCGGCTCAGAGGGAGG + Exonic
1141054750 16:80804559-80804581 GGCCGGCGGCGGGCGCCGGGCGG - Intergenic
1141490357 16:84368453-84368475 GGGCGGGGCTGCGCACAGGGAGG - Intergenic
1141625537 16:85259286-85259308 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141625545 16:85259308-85259330 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141682572 16:85553221-85553243 GCCCGGCGGGGCGCGCGGGGTGG + Intergenic
1142086343 16:88184533-88184555 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1142255252 16:89010822-89010844 GGACAGCGGGGCTCACAGGCGGG - Intergenic
1142350104 16:89575858-89575880 GCCCGGCTGGGCGCACTGAGGGG - Exonic
1142429834 16:90019812-90019834 GGCTGGCGAGGGGCACAGGAGGG + Intronic
1203006667 16_KI270728v1_random:207169-207191 GTGAGGCGGGGCGCACGGGGAGG + Intergenic
1203148308 16_KI270728v1_random:1817160-1817182 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1142509769 17:386094-386116 GGCCGGCGGGGCGCACAGGGAGG - Intronic
1142664731 17:1456150-1456172 GGCCGGAGGGGCGCGCGCGGCGG - Exonic
1143480754 17:7226258-7226280 GGGGGGCAGGGCGCACGGGGAGG - Exonic
1143904429 17:10198091-10198113 GGTCGGAGGGGCGCCCCGGGGGG - Intronic
1144495262 17:15741681-15741703 CGCCAGCGGGGAGAACAGGGTGG - Intronic
1146957210 17:36942684-36942706 GGCCGGCGGGACCGAAAGGGAGG - Intronic
1147429537 17:40363024-40363046 GGCCGGCGGGGCGCACGGCTCGG + Exonic
1148341774 17:46877549-46877571 GGCCAGCAGGGAACACAGGGAGG - Intronic
1148664173 17:49362158-49362180 GGCCGGCGGGGCGGGCAGCGCGG + Intronic
1148775892 17:50095587-50095609 GGCCGGCGGGGCGCTGGGAGGGG + Intronic
1148777306 17:50102791-50102813 GGCAGGAGGGAAGCACAGGGTGG + Intronic
1149270076 17:54968253-54968275 GGCCGGCGCCGCCCGCAGGGTGG - Intronic
1149490970 17:57085137-57085159 GGCCGGCGGCGCGCACGCGCAGG + Intronic
1149512622 17:57256247-57256269 GGCCGGCAGGGCGCAGGGCGAGG - Intronic
1150249874 17:63699605-63699627 AGCCCGCGGGACGCACACGGCGG - Intronic
1150267830 17:63842476-63842498 GGCCCGCGGGGCCCATGGGGCGG + Exonic
1150624844 17:66835184-66835206 CGCCGGCTGGGCGCGCGGGGCGG - Exonic
1152657873 17:81528321-81528343 GGCCCGCGGGCAGCAGAGGGCGG - Intergenic
1152697306 17:81803714-81803736 GGGCGAGGGGGCGCCCAGGGAGG + Intergenic
1152721872 17:81927446-81927468 GGCCGAGGGGGCGCGCAGGCAGG - Intronic
1152744183 17:82031591-82031613 GGCCGGCGGGGGGCGGGGGGCGG - Intergenic
1152745674 17:82037582-82037604 GGCCGGCGGCGGGCAGAGGCGGG - Intronic
1152924007 17:83079475-83079497 GTCCGGCCGGGCGCCCCGGGAGG + Intergenic
1153479103 18:5529403-5529425 GGAGGGCGGTGCGCACAGAGGGG - Intronic
1154125562 18:11689504-11689526 GGCAGGCTGGGCGCCGAGGGCGG - Exonic
1154202459 18:12308598-12308620 GGCCGCCGGGGCGCCTGGGGTGG + Intronic
1154266458 18:12883493-12883515 GGCCGGCCCGGCGCCCAGAGCGG + Intronic
1156651966 18:39235598-39235620 GGCCGGGGGGCCGTGCAGGGAGG - Intergenic
1157610310 18:48951527-48951549 GCCCGGCGGGGCTGACAGCGCGG + Intergenic
1158931013 18:62325210-62325232 GGCCGGAGGGGGGCGCAGGAGGG + Intergenic
1159921978 18:74234834-74234856 GGCTGGCGAGGGGTACAGGGAGG + Intergenic
1160256201 18:77250505-77250527 GAGCGGCGGGGCGCGCGGGGAGG - Intergenic
1160499630 18:79395586-79395608 GGGAGGGGGGGCGCACGGGGAGG - Intergenic
1160499647 18:79395619-79395641 GGGAGGGGGGGCGCACGGGGAGG - Intergenic
1160499677 18:79395669-79395691 GGAGGGGGGGGCGCACGGGGAGG - Intergenic
1160499687 18:79395687-79395709 GGGAGGGGGGGCGCACGGGGAGG - Intergenic
1160809030 19:1005064-1005086 GGCCGGCCGGGCCCACATGGCGG + Exonic
1160967993 19:1754956-1754978 GGCTGCCGGGGCGCACGGGCGGG - Intronic
1161015081 19:1979423-1979445 GGGGGGTGGGGGGCACAGGGCGG - Intronic
1161293086 19:3506269-3506291 GGCCGGCCGGGCGCGCGCGGCGG + Intronic
1161308098 19:3578298-3578320 GGCCGGCGGGACCCACTCGGGGG + Intronic
1161312893 19:3604552-3604574 GGCAGGCGGGGCGGGCAGGGTGG - Intronic
1161352843 19:3803464-3803486 GGCAGGCGGGGAGCAGAGTGGGG - Intergenic
1161380237 19:3960978-3961000 GGCCGGCAGGGGGCACGGGGTGG - Intronic
1161397581 19:4052617-4052639 GGCGGGCGGGGGGCAGGGGGTGG + Intronic
1161959610 19:7516359-7516381 GGCCGGCGGCGCGCAGGGCGGGG - Intronic
1162079027 19:8208210-8208232 GGGGGGCGGGGCGGTCAGGGAGG - Intronic
1162464249 19:10830985-10831007 GGCCGGCTGGGCGCAGCAGGGGG - Exonic
1163138657 19:15331987-15332009 GGCCGGCGGGGCGCGGGTGGGGG - Intronic
1163442546 19:17329053-17329075 CTCCGGCGGGGCGCCCAGGGAGG - Intronic
1163453039 19:17390512-17390534 GGCCGGCGCGGCGCGCACGAGGG - Intergenic
1164120557 19:22261754-22261776 GGCGGGCGGGGCGGGCGGGGCGG + Intergenic
1164189882 19:22904262-22904284 GGCCTGAGGGGGGCACAGAGAGG - Intergenic
1164757337 19:30699921-30699943 GGCCGGCGGGGCCCACTCTGGGG + Intronic
1165199854 19:34134719-34134741 AGCCGGAGGGGCGCGCAGGAGGG - Intergenic
1165822707 19:38686660-38686682 GGCAGGTGGGGCCCACAGAGCGG - Intronic
1166304206 19:41928423-41928445 GGCCGGCTGGGGGCGCGGGGCGG + Intronic
1166373142 19:42313511-42313533 GGCCGGCGGGCCGCAGAGGAGGG - Intronic
1166564338 19:43754591-43754613 GGCGGGCGGGGCGCTCCGGCAGG - Intronic
1166571410 19:43799166-43799188 GGTGGGAGAGGCGCACAGGGAGG - Intronic
1166658174 19:44627353-44627375 GGAGGGAGGGGTGCACAGGGAGG + Intronic
1166984043 19:46649243-46649265 GGCGGGCGGCGCGGCCAGGGAGG + Exonic
1167056278 19:47113060-47113082 GGCAGCCGGGGCACCCAGGGCGG - Intronic
1168239200 19:55080822-55080844 GGGCCGCGGGGAGCGCAGGGCGG + Exonic
1168282502 19:55312889-55312911 GGCCGGCGGGGGGCTGAGGCTGG + Exonic
1168428032 19:56255314-56255336 AGCCGGCTGAGCGCACAAGGTGG + Intronic
926089872 2:10043189-10043211 GGGCGGCGGGGCGGAGGGGGCGG - Intronic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
932329498 2:70889624-70889646 GGCCGGCGAGGCGGGCAGGCAGG + Intergenic
932591734 2:73071557-73071579 GGCCGGCGGGTGGCAAAGAGAGG - Intronic
933893511 2:86790885-86790907 AGCCGGTGGGGCGCCGAGGGGGG + Exonic
934079107 2:88452440-88452462 TGCCGGGGGGGCGCCCGGGGCGG + Exonic
934736434 2:96692017-96692039 GGCGGGGGGGGGGGACAGGGTGG + Intergenic
934966860 2:98731129-98731151 AGCCGGCGGGGCGGGCGGGGCGG - Intergenic
935590576 2:104843314-104843336 GGTCGGCGGGGCCCTCAGGCTGG + Intergenic
935820169 2:106886472-106886494 GGGCGGCGGGGCACAGCGGGTGG + Exonic
937045150 2:118847182-118847204 GGCCGGCGCGGCGGCCGGGGCGG - Exonic
937047126 2:118857737-118857759 GGCCCGCGGAGAGCCCAGGGCGG + Intergenic
937221675 2:120345930-120345952 GGCCCGAGGGGCGCGCCGGGCGG - Intergenic
937228493 2:120383487-120383509 GGGGGGCGGGGGGCACCGGGAGG - Intergenic
938263728 2:129912016-129912038 GGCCGGTGGGAGGCACAGGCAGG - Intergenic
938416240 2:131105651-131105673 GGCCGGGGGGGCCCACTGGGAGG - Intronic
938460446 2:131492948-131492970 GGCCGGCCGGCCGGCCAGGGAGG - Intergenic
941164929 2:162074275-162074297 GGCAGCCGGGGCGCAGAGTGCGG + Exonic
941929875 2:170929091-170929113 GGCCGGGAGGGCGGAGAGGGAGG - Exonic
945289428 2:208112623-208112645 GGCTGGCTGGGCGCACGGCGGGG + Intergenic
946337672 2:219049430-219049452 GGCCGGTGAGGCACTCAGGGAGG + Intergenic
947549768 2:231037799-231037821 GGCGCGCGGGGCGCAGAGGGCGG + Exonic
947593055 2:231395921-231395943 GGCCGGCGCGGCGCGCGCGGGGG - Intronic
947765211 2:232633534-232633556 GGCGGGCGGGGCGGTCGGGGCGG - Exonic
948140604 2:235669918-235669940 GGGCGGCGCGGCGCACGGGCCGG + Intronic
948645465 2:239401196-239401218 GGCCGGCCAGGCGCCCGGGGCGG - Intronic
948710538 2:239822322-239822344 GGCAGGTGGGGTGCACAGAGAGG + Intergenic
948902998 2:240965555-240965577 GGGCGTCGGGGAGCAGAGGGAGG + Intronic
948904793 2:240973680-240973702 GGCCAGCGGGGCCCACAAGGTGG + Intronic
948957762 2:241307072-241307094 GGGGGGCGGGGGGGACAGGGGGG + Intronic
1169132531 20:3173531-3173553 GCCCGGCGGGGCGCGCTGCGCGG + Exonic
1171779671 20:29408071-29408093 CGACGGCGGGACGCTCAGGGAGG + Intergenic
1172389750 20:34558839-34558861 GCCCGGCTGGGCGCGCAGGCCGG - Intronic
1172526354 20:35602301-35602323 GACCGGCGGGACGCACAGGGTGG + Intergenic
1173744361 20:45425381-45425403 GGCGGGCGGGGGGCAAGGGGAGG - Intronic
1175074090 20:56359091-56359113 GGGCGGCGGGGCGCAGGGGGCGG - Exonic
1176121695 20:63456969-63456991 GGCGAGCGGGGCCCCCAGGGAGG - Intronic
1178074164 21:29000274-29000296 GGCCGGCGGGGCGGGCAGGCAGG - Intergenic
1178992512 21:37367338-37367360 GGCCGGCCCGGCGCAGAGGGCGG - Intronic
1179243759 21:39612835-39612857 GGCCGGCGGGCCGCGCAGGGCGG - Intronic
1179511964 21:41879216-41879238 GGCCGGCGGGGCGCACGCCGGGG + Intronic
1180000546 21:44993535-44993557 GGCCCGGGGGGTGCTCAGGGAGG - Intergenic
1180000716 21:44994128-44994150 AGCAGGCGGGGCCCTCAGGGAGG - Intergenic
1180041381 21:45282084-45282106 GCCCGGCCAGGTGCACAGGGAGG - Intronic
1180052237 21:45336423-45336445 GGCTGGTGGGGAGCACATGGGGG - Intergenic
1180109832 21:45642749-45642771 GGCGGGCGGAGGGGACAGGGCGG + Intergenic
1180148387 21:45934737-45934759 GGCCGGGGGGTGTCACAGGGAGG + Intronic
1180162039 21:46002433-46002455 GGCTGGCGGGGCGCCCTAGGCGG - Intronic
1180835195 22:18926221-18926243 GGCCGGCCTGGAGGACAGGGCGG - Intronic
1180843722 22:18970689-18970711 AGGCGGCGGGGCGCAGAGCGGGG + Intergenic
1180980099 22:19874324-19874346 GGTCGGCTGGGCAGACAGGGAGG + Intergenic
1181057750 22:20268018-20268040 CGGCGGCGGGGCGCGGAGGGGGG - Intronic
1181952133 22:26562124-26562146 GCCCGGCGGGGGCCACAGGGTGG + Intronic
1182278679 22:29205970-29205992 GGCAGGCGGGGAGGACAGGCTGG + Exonic
1182357574 22:29729253-29729275 GGCCAGGGGGACGCACGGGGTGG + Intronic
1182557616 22:31137724-31137746 GGCCTCCAGGGCCCACAGGGTGG - Exonic
1182586339 22:31346148-31346170 CGGCGGCGGGGCGCGCACGGGGG + Exonic
1183546023 22:38455271-38455293 GCCCGGCCGGGCTCACAGCGCGG + Intergenic
1183683692 22:39349963-39349985 GGCCGGCGGCGCGCGCCGAGCGG + Intronic
1184549499 22:45196944-45196966 GATGGGCGGGGGGCACAGGGCGG + Exonic
1184738932 22:46415947-46415969 GGCCGGCGTGGAGCACGAGGCGG + Intronic
1185167466 22:49270331-49270353 GGGCGGGGGGGTGCACAGTGGGG + Intergenic
1185237905 22:49725321-49725343 GGCCGGTGTGGGGCCCAGGGAGG - Intergenic
1185258839 22:49850417-49850439 GGCAGACGGGAGGCACAGGGTGG + Intergenic
1203285283 22_KI270734v1_random:151520-151542 GGCCGGCCTGGAGGACAGGGCGG - Intergenic
952476735 3:33718123-33718145 GGCTTGCGGGGCGCAGCGGGCGG + Intronic
953099221 3:39809380-39809402 GAGGGGCGGGGCGCACCGGGAGG - Intronic
953561206 3:43995220-43995242 GGCCGGGGGCGCGCACACGAGGG + Intergenic
954405027 3:50340854-50340876 GGCCGGGCGGGGCCACAGGGCGG + Intronic
954708950 3:52495538-52495560 GGCCAGCGGTGGGAACAGGGAGG + Intronic
955656605 3:61251183-61251205 GGCCGGCGCCGCTCACGGGGCGG - Intronic
961707978 3:128804105-128804127 GGGCGGGGGGGGGCCCAGGGAGG - Intronic
963732658 3:148987713-148987735 GGCCGGCCGGGCGAGCGGGGAGG - Intergenic
966315623 3:178642444-178642466 GGAAGGTGGGGAGCACAGGGTGG - Intronic
967596286 3:191329546-191329568 GGCCGGCAGGGCTCGCAGGCCGG - Exonic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
968230718 3:197003231-197003253 GGGCGGCGGGGCTCCCGGGGAGG + Exonic
968230758 3:197003360-197003382 GGGCGGCCGGGCTCAGAGGGCGG + Exonic
968505958 4:971650-971672 AGCCGGCGGGGTGCTCAGGAGGG + Intronic
968547680 4:1207039-1207061 GGCGGGTGGGGAGCACGGGGAGG + Intronic
968651306 4:1761341-1761363 GGCAGGCAGGGCGGACAGGGTGG - Intergenic
968994799 4:3938663-3938685 GGCCAGCGGGAGGCTCAGGGAGG + Intergenic
969634619 4:8359746-8359768 GGAAGGCGAGGCGCTCAGGGAGG - Intergenic
969756484 4:9153394-9153416 GGCCGGCGGGGCGAGCGGAGAGG + Intergenic
970195082 4:13544434-13544456 GGCCGGCGGGGCGGGCAGCTGGG + Exonic
975131835 4:70839373-70839395 TGCCCGCGAGGCGCACACGGAGG + Intronic
976743329 4:88379087-88379109 GGCCGCAGGGGCGCGCAGCGCGG + Exonic
982746009 4:159104066-159104088 GGCGGGCGCAGCGCGCAGGGCGG + Intergenic
984441365 4:179774565-179774587 GGAAGGCGTGGCGCTCAGGGAGG - Intergenic
985444647 4:190015321-190015343 GGGCGCAGGGGCGGACAGGGTGG - Intergenic
985550108 5:528570-528592 GGCGGGCGGGGCGGGCGGGGCGG - Intergenic
985588128 5:751339-751361 GGCAGGGGGTGTGCACAGGGTGG + Intronic
985795982 5:1962471-1962493 GGCCGGCTGGGCGCACACTCTGG - Intergenic
986416055 5:7529369-7529391 GGCAGGCTGGGAGCAGAGGGAGG + Intronic
986661731 5:10065575-10065597 GGCCGGCCGGCCGCTCAGAGTGG - Intergenic
989229969 5:39074437-39074459 GGCGGGCGCGGCGCGCGGGGAGG - Intergenic
990978134 5:61576931-61576953 GGCAGGCGGGGAGTACAGGTGGG + Intergenic
992775182 5:80082956-80082978 GGCCTGCGGGGCGTCCTGGGCGG + Intronic
993187202 5:84635754-84635776 CGATGGCGGGGGGCACAGGGAGG - Intergenic
996937404 5:128965179-128965201 GGCCGGACGCGCGCCCAGGGAGG + Exonic
997301999 5:132813388-132813410 GCCCGGCGGGGCGCTGGGGGTGG + Intergenic
997468667 5:134104525-134104547 GGCCTGAGGGGCCCCCAGGGTGG - Intergenic
999188456 5:149730222-149730244 GGCCGGCGGGAGGCGGAGGGCGG - Intergenic
1002175750 5:177400221-177400243 GGCCGACGCGGCGTACATGGGGG - Exonic
1002446082 5:179290934-179290956 GAACGGCAGGGCCCACAGGGTGG - Intronic
1002638332 5:180618988-180619010 GGCCTGCGGGGCGCCGCGGGCGG - Intronic
1004044744 6:12012608-12012630 GGGCGGCGGGGCGGAGGGGGGGG + Intronic
1004432388 6:15556701-15556723 GGCAGGCGAGGAGCTCAGGGAGG - Intronic
1004908508 6:20259666-20259688 GGCCGGCGGGGCGGGCCGGCCGG - Intergenic
1006644068 6:35504164-35504186 GGCAGGTGGGGGGCAGAGGGCGG - Intronic
1007558151 6:42783306-42783328 GGCCGGCGCGGCGAACAGCGCGG - Intronic
1007623501 6:43229175-43229197 GGTCGGGGGGGCGGACAGGCCGG + Intronic
1007710162 6:43817732-43817754 GGAGGGCGGTGCGCCCAGGGAGG + Intergenic
1008760482 6:54846937-54846959 GGCCGGCGCGGCGGACGGGAGGG + Intronic
1009454616 6:63841751-63841773 GGGTGGCGGGGGGCAAAGGGAGG - Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013459061 6:110358129-110358151 GCCCGGCGGGGCGCTGCGGGTGG + Exonic
1013468043 6:110434632-110434654 GGCGGGTGGGGCGGGCAGGGTGG + Intronic
1019718668 7:2555088-2555110 AGCCGGCGGGGGGGAGAGGGGGG + Intronic
1019828309 7:3301552-3301574 GTCCGGCGCGGCGCTCGGGGTGG + Exonic
1019881996 7:3869554-3869576 AGCGGGCTGGGGGCACAGGGTGG - Intronic
1020552285 7:9621702-9621724 GGCCGGCGGGGCCGGCGGGGCGG + Intergenic
1023648309 7:42342226-42342248 GGGGAGCGGGGAGCACAGGGAGG + Intergenic
1025020569 7:55476480-55476502 GTCCGGCAGGCCGCAGAGGGAGG + Intronic
1027374471 7:77536974-77536996 GGCCGGCGGGGCGGGCTTGGGGG + Intergenic
1027390308 7:77697003-77697025 GGCCGGCGGGGCCTCCCGGGAGG + Exonic
1027416834 7:77982966-77982988 GGCTGGGGGAGGGCACAGGGAGG - Intergenic
1029203620 7:98855406-98855428 GGACGGAGGGGAGGACAGGGTGG - Intronic
1029640393 7:101816379-101816401 GCCCGGGGGGGCGCCCGGGGTGG - Intronic
1033149949 7:138905456-138905478 GGACGGCGGGGCACACTGGCTGG - Intronic
1035387797 7:158485597-158485619 AGCAGGCGGGGCGCAGAGAGGGG - Intronic
1035593362 8:835436-835458 GGGCGGCGTGGAGCACAGTGGGG - Intergenic
1039531763 8:38269060-38269082 GGCAGGCGGGCGGCACGGGGCGG - Intronic
1039885837 8:41653676-41653698 GGCAGGGGGGCCGCACAGCGCGG - Intronic
1041638674 8:60173581-60173603 GGCCGGGGCAGTGCACAGGGAGG + Intergenic
1042271503 8:66961350-66961372 AGCGGGCGGGGCGCACCGCGGGG - Intronic
1043388067 8:79767691-79767713 GGTCGGCGCGGCGGGCAGGGAGG + Exonic
1043414447 8:80033294-80033316 GACCGGCGGGGCGGGGAGGGGGG + Intronic
1047441681 8:124884343-124884365 GGCAGGCGGGGGGCACAGTGAGG + Intergenic
1048457613 8:134592216-134592238 GCCCGGTGGGGAGCACAGTGAGG - Intronic
1049641016 8:143716155-143716177 GGTGGGCGGGGCGCACTGTGGGG + Intergenic
1049762142 8:144336509-144336531 GGCTGGGGGGGCGGAGAGGGGGG + Intergenic
1049798384 8:144506672-144506694 GGCCTGCGGGGTGGGCAGGGGGG + Intronic
1052807496 9:33025648-33025670 GGCCGCGGGGGCGCGCACGGAGG - Intronic
1053149163 9:35732083-35732105 GGCGGGCGGGGCGCAGAGCCAGG - Exonic
1055266222 9:74498387-74498409 GGCGCGCGGGGCGCACCGGCCGG + Intronic
1055753138 9:79529038-79529060 GGCCTGCAGGGAGCACAGTGGGG - Intergenic
1056872946 9:90302009-90302031 GGCAGGTGGGGAGCAAAGGGAGG - Intergenic
1059414911 9:114156305-114156327 GGCCGGCGGGGTGCGGAGGGGGG + Intronic
1061060875 9:128250046-128250068 GCCCGGTGGGGCGGCCAGGGCGG + Intronic
1061293519 9:129665560-129665582 GGCGGGCGAGGCGCGCGGGGAGG + Intergenic
1061449470 9:130660616-130660638 GGCCGGCGGGGCGGGCAGGGCGG + Intergenic
1061798702 9:133102905-133102927 GGCCAGAGGGAAGCACAGGGCGG + Intronic
1062467316 9:136687019-136687041 GGCCGGCGGCAGGCACAGGAGGG - Intronic
1062565511 9:137162384-137162406 GGGCTGCGGGGCGCAGAGGGCGG - Exonic
1062612753 9:137382383-137382405 GGGGGGCGGGGGGCAGAGGGCGG + Intronic
1187419586 X:19122648-19122670 AGCGGGCGGGGCGCGGAGGGAGG + Intergenic
1189237203 X:39496250-39496272 GGCCGGGGGTGCCCACGGGGGGG - Intergenic
1192780984 X:74293603-74293625 GGGAGGCGGGGCGCGGAGGGGGG - Intergenic
1198139093 X:133784870-133784892 GGCCGGCGGGGAGGAAAGAGAGG - Intronic
1198683403 X:139204520-139204542 GGCCCGCGCGGAGCCCAGGGAGG - Intronic
1200063649 X:153494858-153494880 GGCTGGTGGGGCGGAGAGGGCGG - Intronic
1200098172 X:153673830-153673852 GGCCGGCGGGGCGCGGGCGGGGG - Intronic
1200163309 X:154019932-154019954 GCCCGGCGGGGCGGAAGGGGCGG + Exonic