ID: 1142509781

View in Genome Browser
Species Human (GRCh38)
Location 17:386128-386150
Sequence CCGCGCGCACCCCCCGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 289}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142509769_1142509781 11 Left 1142509769 17:386094-386116 CCTCCCTGTGCGCCCCGCCGGCC 0: 1
1: 0
2: 4
3: 28
4: 324
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509767_1142509781 14 Left 1142509767 17:386091-386113 CCGCCTCCCTGTGCGCCCCGCCG 0: 1
1: 0
2: 5
3: 49
4: 415
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509773_1142509781 -2 Left 1142509773 17:386107-386129 CCCGCCGGCCCCGCCGCTGAGCC 0: 1
1: 0
2: 4
3: 61
4: 448
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509771_1142509781 7 Left 1142509771 17:386098-386120 CCTGTGCGCCCCGCCGGCCCCGC 0: 1
1: 0
2: 3
3: 67
4: 657
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509770_1142509781 8 Left 1142509770 17:386097-386119 CCCTGTGCGCCCCGCCGGCCCCG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509765_1142509781 18 Left 1142509765 17:386087-386109 CCCGCCGCCTCCCTGTGCGCCCC 0: 1
1: 0
2: 5
3: 50
4: 595
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509764_1142509781 19 Left 1142509764 17:386086-386108 CCCCGCCGCCTCCCTGTGCGCCC 0: 1
1: 0
2: 3
3: 41
4: 452
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509776_1142509781 -10 Left 1142509776 17:386115-386137 CCCCGCCGCTGAGCCGCGCGCAC 0: 1
1: 0
2: 1
3: 19
4: 131
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509775_1142509781 -6 Left 1142509775 17:386111-386133 CCGGCCCCGCCGCTGAGCCGCGC 0: 1
1: 0
2: 6
3: 47
4: 385
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509763_1142509781 25 Left 1142509763 17:386080-386102 CCAGGTCCCCGCCGCCTCCCTGT 0: 1
1: 0
2: 3
3: 47
4: 483
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509766_1142509781 17 Left 1142509766 17:386088-386110 CCGCCGCCTCCCTGTGCGCCCCG 0: 1
1: 0
2: 6
3: 64
4: 476
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509774_1142509781 -3 Left 1142509774 17:386108-386130 CCGCCGGCCCCGCCGCTGAGCCG 0: 1
1: 0
2: 3
3: 48
4: 402
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509762_1142509781 26 Left 1142509762 17:386079-386101 CCCAGGTCCCCGCCGCCTCCCTG 0: 1
1: 0
2: 4
3: 37
4: 486
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289
1142509772_1142509781 -1 Left 1142509772 17:386106-386128 CCCCGCCGGCCCCGCCGCTGAGC 0: 1
1: 1
2: 4
3: 65
4: 417
Right 1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142509781 Original CRISPR CCGCGCGCACCCCCCGCCCT CGG Intronic
900134079 1:1106872-1106894 CTGCCGGCACCCCCGGCCCTGGG + Intronic
900346800 1:2214066-2214088 CCCCGTGCTCCCCCTGCCCTGGG - Intergenic
900349650 1:2228461-2228483 CCGCGCGCCCCCCGGGCTCTAGG - Intergenic
900513343 1:3070342-3070364 CCGCGCGCACCCCGCAGCCCCGG + Intronic
901242975 1:7705352-7705374 ACGCGCGCCCCTCACGCCCTCGG - Intronic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901641519 1:10695218-10695240 CCCCGCGCGTCCCCGGCCCTGGG + Intronic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901793073 1:11664519-11664541 CCGCCCGCGCCCCCCACCCCTGG - Intronic
902896796 1:19485212-19485234 CCGCTCCCAGCCCCCGCCCTTGG - Intronic
903193456 1:21669090-21669112 CTGCGCCCACCCCTCGCCCCTGG + Intronic
904006632 1:27366475-27366497 CCGCGCGCAGCCCCGGCCCGGGG + Exonic
904045155 1:27604183-27604205 CCGCGCGCGCGCTCCCCCCTGGG - Intronic
904461861 1:30685400-30685422 CCGCCCCCTCCCCCGGCCCTGGG + Intergenic
904517289 1:31066027-31066049 CCTCGCGCCCGCCGCGCCCTCGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
907341511 1:53739059-53739081 CCCCGCACACGCCCCTCCCTCGG + Intergenic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
912505051 1:110150610-110150632 CCGCGCGCTCTCTCCGCCGTGGG + Exonic
912798553 1:112707052-112707074 CCGCCCGCAGCCCCGGCCCAGGG + Intronic
913186427 1:116373771-116373793 GGGCGCGCAGCCCCCGCCCAGGG - Intronic
916356208 1:163911329-163911351 CCACCCTCACCCCCAGCCCTAGG - Intergenic
917027784 1:170661658-170661680 CCGCCCCCACCCCCATCCCTTGG - Intergenic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
918557259 1:185817436-185817458 CCCCTCACACACCCCGCCCTGGG - Intronic
922306977 1:224352737-224352759 CCGCGGGCCCCGCCGGCCCTGGG - Intergenic
922804737 1:228379385-228379407 ACGCGCGCACCCCACGGCCCAGG - Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1062843599 10:689147-689169 CCGCGATCCCCCCGCGCCCTGGG - Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1068610645 10:59056572-59056594 CCGCCCCCACCCCCCGTCCATGG + Intergenic
1069457098 10:68561548-68561570 CTCCGCGCACCTCCCACCCTCGG - Intronic
1069761679 10:70815865-70815887 CCGCGCGCACGCCCAGACCCGGG - Intergenic
1069831466 10:71284715-71284737 CCTCGCGCACCCGCAGGCCTGGG - Exonic
1070148051 10:73788967-73788989 TCCCCCCCACCCCCCGCCCTGGG + Intronic
1071086721 10:81874904-81874926 CCGCGCCCAGCCCGCTCCCTGGG - Intergenic
1074618304 10:115092937-115092959 CCACCCGCACCCCGCGCCCCGGG - Intergenic
1074771526 10:116737958-116737980 CTGCGGGCACCCCCAGGCCTGGG - Intronic
1074819599 10:117168338-117168360 CCGAGCGCGCACCACGCCCTCGG + Intergenic
1075046632 10:119151409-119151431 CCACCCCCACCCCCAGCCCTAGG - Intronic
1076650309 10:131982474-131982496 CCGCTCGCAGCTCCCGCCCCGGG - Intergenic
1076748721 10:132529046-132529068 CCCCGCCCACCCCTCGCCCCGGG + Intergenic
1076948127 10:133665464-133665486 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076949117 10:133668774-133668796 CCACCCCCACCCCCCGCCCCCGG + Intronic
1076950101 10:133672073-133672095 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076951085 10:133675372-133675394 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076952075 10:133678682-133678704 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076953064 10:133681992-133682014 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076954048 10:133685291-133685313 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076955032 10:133741643-133741665 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076956021 10:133744953-133744975 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076957011 10:133748263-133748285 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076957998 10:133751572-133751594 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076958983 10:133754871-133754893 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076959972 10:133758181-133758203 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1076960956 10:133761480-133761502 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1077124503 11:926288-926310 CCGCCCGCACCCCCAGACCCTGG - Intronic
1077250153 11:1557300-1557322 CCCCGCGCCCCCCACGCCCCCGG - Exonic
1077367360 11:2166585-2166607 CCCGTCGCACCCCCCACCCTCGG + Intronic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1077524677 11:3057111-3057133 CCCCGAGCACCCCCGCCCCTCGG + Intronic
1078429768 11:11280134-11280156 CCCAGGGCACCCCCCGCCCGGGG + Intronic
1080601983 11:33829344-33829366 CCGCCCCCTCCCCCCGCCTTGGG - Intergenic
1083562204 11:63681786-63681808 GCGCGGGGAGCCCCCGCCCTGGG + Intronic
1083660797 11:64251037-64251059 CCGCGCGGTCCCCCCTCCCTGGG - Intergenic
1083747361 11:64743528-64743550 CAGCGGGCTCCCCCCGCCCCAGG - Intronic
1083758280 11:64802816-64802838 CCGCCCGCACCCCGCGCCCGCGG + Intronic
1084083428 11:66843637-66843659 TCGCGCGCAGCCCCCGCACCTGG - Exonic
1084128080 11:67114258-67114280 CCACCCGCACCCCCCACCCCGGG - Intergenic
1084412093 11:69011149-69011171 CCGCGCACTCCTCCCGCCCGGGG + Intronic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1090803728 11:130189903-130189925 CCACGCCCACCCCTGGCCCTCGG - Intronic
1091286848 11:134412509-134412531 CCGAGCGCACCCCCAGATCTCGG + Intergenic
1091718519 12:2795863-2795885 CCGCGCGGCGCCCCCTCCCTCGG + Intronic
1093057213 12:14567545-14567567 CCCCGGGCGCCCCCCGCCCAGGG + Intronic
1093164566 12:15789785-15789807 CCGAGCGCTCCCTCCGCCCGGGG - Intronic
1093435318 12:19129658-19129680 CCGCGCGCGCCCTACCCCCTCGG - Intergenic
1094653440 12:32399444-32399466 CTGCGCTCTCCTCCCGCCCTTGG + Intergenic
1094814063 12:34166696-34166718 CCACCCGCACCCCCATCCCTAGG + Intergenic
1096325111 12:50653444-50653466 CCGCCCCTACCCCCAGCCCTGGG + Intronic
1096791415 12:54047438-54047460 CGGCGCGCACCTCGCGGCCTGGG - Intronic
1098255151 12:68609184-68609206 CCGCCCCCACCTCCCACCCTCGG - Intergenic
1098426030 12:70366449-70366471 CCGTGCGCTCCCCGCGCCCGAGG + Exonic
1099574311 12:84361793-84361815 CCGCTCCCACATCCCGCCCTGGG - Intergenic
1103527584 12:121578567-121578589 CCGCGCCCACCACCAGCCCCAGG - Intronic
1103856286 12:123973009-123973031 CCCCGCGCCCCCCCCTCCCTCGG - Intronic
1104692660 12:130838840-130838862 CCGCCCGGAGCCCCCACCCTAGG + Intronic
1104768941 12:131348345-131348367 CTGAGCGCACCCCCCGCACTTGG + Intergenic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1104989695 12:132618732-132618754 CGCCGCGCGCCCCCCGCTCTCGG + Intergenic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1106527873 13:30559145-30559167 CCACCCGCACCCCCCACCCCAGG - Intronic
1106776639 13:33016240-33016262 TCCCGGGCACCCCTCGCCCTCGG + Intergenic
1106809999 13:33350133-33350155 CTGCGGGCACCACCCTCCCTGGG - Intronic
1108408016 13:50124325-50124347 CCGCCCGGAGTCCCCGCCCTGGG - Intronic
1110450912 13:75636563-75636585 CCGCGTGCCCTCCCCGCCCGTGG + Intronic
1110732187 13:78891394-78891416 CCCCACCCACCCCCAGCCCTAGG - Intergenic
1111333617 13:86792579-86792601 CCGCGTGCACTCCTCACCCTTGG - Intergenic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1113841615 13:113364287-113364309 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1113841667 13:113364393-113364415 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1119330171 14:73787404-73787426 TAGCCTGCACCCCCCGCCCTGGG + Intronic
1119756726 14:77125059-77125081 CGGCGCGCGCGCCCCGCGCTTGG - Intronic
1119824002 14:77642009-77642031 CCGCGCATCCTCCCCGCCCTTGG - Intergenic
1121417156 14:93787637-93787659 CTGCGCGCTCCACCCGCTCTGGG - Exonic
1122278922 14:100609979-100610001 CCGTGCCCTCCCCCAGCCCTGGG - Intergenic
1122550165 14:102545071-102545093 CCCCCCCCACCCCCCGCCCGGGG - Intergenic
1123021050 14:105398217-105398239 CCGCCCGCGCGCCCCGTCCTGGG + Intergenic
1124607136 15:31178169-31178191 CCTCCCCCACTCCCCGCCCTGGG + Intergenic
1127267902 15:57376305-57376327 ACCCCCGCACCACCCGCCCTCGG - Intronic
1129108067 15:73322713-73322735 CCGCTGCCACCCCCAGCCCTGGG + Exonic
1130938663 15:88490334-88490356 CCACCCCCACCCCCTGCCCTTGG + Intergenic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132398235 15:101489578-101489600 CCCCGCGCCCCCCGCGCCCGCGG + Exonic
1132419422 15:101652563-101652585 CCACGCGCCCCTCACGCCCTTGG + Intergenic
1132570619 16:642379-642401 ACCCGCGCACCCCCCGCGCCCGG - Intronic
1132663817 16:1072853-1072875 GCGCGGGCACCCCCTGCCCTCGG + Intergenic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132760865 16:1508081-1508103 CCCCGCCCACCCGCCTCCCTGGG + Intronic
1132812819 16:1809725-1809747 CCGCGCCCACCACCTGCCCTGGG + Intronic
1132998461 16:2836626-2836648 CCGCACCCACCCCCCGGCCCAGG + Intronic
1133020194 16:2963737-2963759 CCGCACGCCCCTCCCGCCCCTGG - Intergenic
1133156445 16:3880118-3880140 CAGCGCTCACCGCCCGCCCCCGG + Exonic
1136146742 16:28320736-28320758 CGGCCCGCGCCCCCCGCCGTCGG + Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1139589457 16:67925562-67925584 CTGCGCCCACCCACAGCCCTTGG + Intronic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1140096894 16:71883632-71883654 CCGCGGGCACCCCGCCTCCTCGG - Intronic
1141456506 16:84145578-84145600 CCTCGCCCACCGCCCTCCCTGGG - Intronic
1141531247 16:84648493-84648515 GCGCGCGCCGCCTCCGCCCTCGG + Intergenic
1141554978 16:84831112-84831134 CCATGGGCACCCCCGGCCCTGGG - Intronic
1141961801 16:87413812-87413834 CTGCGCCCACCCCCCACCCCAGG - Intronic
1142114660 16:88350382-88350404 CCCGGCGCACCCACCTCCCTTGG + Intergenic
1142130730 16:88430482-88430504 CCGCGCAGACCCCGCGCCCCGGG + Exonic
1142193063 16:88726679-88726701 CCCCCCGCACCCACCGCCCTGGG - Intronic
1142396997 16:89837690-89837712 CCGCACGCACCTCCCGGACTCGG + Intronic
1142440399 16:90094250-90094272 CCACCCGCACCCCCATCCCTAGG - Intergenic
1203120209 16_KI270728v1_random:1529629-1529651 CCCCCCCCACCCCCGGCCCTGGG - Intergenic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142799775 17:2337813-2337835 CCGCGCCCACCCCCCGGCGCGGG + Intronic
1144127638 17:12217788-12217810 CCGCTCCCCCCCCCCACCCTTGG - Intergenic
1144185125 17:12789677-12789699 CCGCGCGCAGCTCCCTCCCGAGG - Exonic
1144756083 17:17681531-17681553 CCGGGCGCCGCCCCCGCCCGCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144828827 17:18120891-18120913 CCGCCGCCACCCGCCGCCCTGGG + Exonic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1146208216 17:30922472-30922494 CCAGGCGCGCCCCACGCCCTCGG + Intronic
1147793055 17:43025212-43025234 CCGCGCCGAGCCCCCGCCCCGGG - Intergenic
1147890593 17:43713972-43713994 CCGCGCCCGCCCCCCGCGCCGGG - Intergenic
1148733448 17:49851424-49851446 CTGCGCCCACCCGGCGCCCTGGG - Intergenic
1149610387 17:57954952-57954974 CCGCACGCCCCCCGCGCCCGGGG + Intronic
1149655659 17:58308516-58308538 CCGTGCTCACTCCCCGCCCTGGG - Intronic
1150294101 17:63998691-63998713 CCGCGCACACCCCCAGCCCTGGG + Exonic
1150481747 17:65516539-65516561 CCGCCCCCATCCCCAGCCCTAGG - Intergenic
1151727864 17:75894963-75894985 CCGCGCGCTGACCCCGCCCCGGG - Intronic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152370209 17:79883110-79883132 CCACCCCCACCCCCAGCCCTAGG + Intergenic
1152831172 17:82497658-82497680 GCGCCCACACCCCCCGCGCTCGG + Intergenic
1152957163 18:49308-49330 CCACCCGCACCCCCATCCCTAGG + Intronic
1152965716 18:112055-112077 CCACCCCCACCCCCCGCCCCCGG - Intergenic
1153006273 18:500803-500825 TCCCGCGCCCGCCCCGCCCTCGG + Intergenic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1160164039 18:76495082-76495104 CCGCGCCCACCGCCCGCCCGCGG + Intronic
1160455162 18:78994475-78994497 CTGCCCGCCCTCCCCGCCCTCGG + Exonic
1160607041 18:80059140-80059162 CAGAGCGGACCCCCAGCCCTCGG + Intronic
1160662150 19:306197-306219 CCGCGGGCTGCCCCAGCCCTGGG - Exonic
1161494961 19:4581600-4581622 GCGCGCGCTCTCCCCGCCCCCGG + Intergenic
1162031831 19:7920820-7920842 CGGCACGCACGCCCCGCCCCCGG - Intronic
1162524225 19:11197880-11197902 CCGCGCGCCCTCCCCGAGCTGGG - Intergenic
1162778336 19:12993740-12993762 GCGTGCGCACCCCCCGCCCTGGG + Intergenic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1165345680 19:35247982-35248004 CCGCGCCGCGCCCCCGCCCTCGG + Intergenic
1165771646 19:38383946-38383968 CCCCGCACACCCCCCAGCCTAGG + Intergenic
1165938479 19:39403391-39403413 CCCCCAGCACCCCCCTCCCTCGG - Intergenic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166394371 19:42427926-42427948 CCACCCCCACCCCCCGCCCCCGG + Intergenic
1168155441 19:54471556-54471578 GCGCGCGCCCGCCCCGCTCTGGG - Exonic
1168536023 19:57171917-57171939 CCGCTCGCGCCCCCCGGCCCGGG - Intergenic
1168659923 19:58157580-58157602 CTCCCCGCAACCCCCGCCCTGGG + Intergenic
926202650 2:10812771-10812793 CCGCGCCCACGTCCCGCCCCAGG + Intronic
927059073 2:19397193-19397215 CCGTGCCCACCCCTGGCCCTCGG + Intergenic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
929151232 2:38750916-38750938 CCCCCCTCCCCCCCCGCCCTCGG - Intronic
936077607 2:109411672-109411694 TCCCTCGCACCCCTCGCCCTGGG + Intronic
937251653 2:120527724-120527746 CCGGGCGCTCCTCCCGCTCTGGG - Intergenic
937930283 2:127199468-127199490 CCCCGCTCACCCTCCGGCCTCGG + Exonic
938418424 2:131123779-131123801 CCCCCCCCGCCCCCCGCCCTCGG + Intronic
941951308 2:171160201-171160223 CCCCCCGCCCCCCCCGCCCCGGG - Intronic
942911027 2:181244779-181244801 CCGCCCCCAACCCCCGCCCCTGG + Intergenic
949070095 2:242019274-242019296 CCCCGCCCACCCCCCTCCCTTGG - Intergenic
1169214713 20:3786484-3786506 CCCGGCGCGCCCCCCGCCCCGGG + Exonic
1169483371 20:6005899-6005921 CCCCGCCCACCCCCGGGCCTTGG + Intergenic
1172421979 20:34825522-34825544 CCGTGCGTGCCCGCCGCCCTCGG + Intronic
1173488452 20:43458521-43458543 CCCCGCGCGCTCCGCGCCCTTGG + Intronic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1175429597 20:58891935-58891957 CCGAGCCCGCCCCCCGCCCCGGG + Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1178992438 21:37366965-37366987 GCGCCCGCACCCCCCGCTCGGGG - Intronic
1179529595 21:42009795-42009817 CCGCGCACACCCCGCGGCCCGGG + Intronic
1180014959 21:45075467-45075489 CCGCGCGGACACTGCGCCCTCGG - Intronic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1181570925 22:23767544-23767566 GCCCGCGCACCCACCGCCCTCGG - Exonic
1183485143 22:38084449-38084471 CCGCCCCAACCCCCCGCCCCAGG + Intergenic
1184680612 22:46070770-46070792 CCGTGCGCGCGCTCCGCCCTGGG + Intronic
1185199479 22:49492646-49492668 CCACGCTCACCCACAGCCCTCGG + Intronic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
951543769 3:23806431-23806453 CCCCGCGAACCCCCGCCCCTGGG - Intronic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
954376054 3:50194702-50194724 CGGCGCGCACCCCCCGCACGGGG + Intronic
954615838 3:51968227-51968249 CGCTGGGCACCCCCCGCCCTCGG + Intronic
958026659 3:88058435-88058457 CCGCCCGAACCCCCGGGCCTGGG - Intronic
961664185 3:128486152-128486174 CCGCTCCCACCCCCAGCCCCTGG + Exonic
962745497 3:138394875-138394897 CAGCACCCACTCCCCGCCCTCGG + Intronic
968534363 4:1113855-1113877 TGGCCCGCATCCCCCGCCCTCGG - Intergenic
968565608 4:1311028-1311050 CCGCCTGCTCCCCCGGCCCTGGG - Intronic
968631079 4:1651854-1651876 CCCCGCGCAGCCCCAGTCCTAGG + Intronic
968652953 4:1767300-1767322 CCCCGCGCCCCTCCCGGCCTGGG + Intergenic
968740792 4:2330823-2330845 CCCCACGCACCCGCTGCCCTGGG - Intronic
969562517 4:7958637-7958659 CCCCTCCCACCCCCCACCCTCGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
978013735 4:103719462-103719484 CCCCGCGCCCTCCCAGCCCTGGG - Exonic
978126836 4:105146176-105146198 CCGCGCGCACCCACCTCCTCCGG - Intronic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
984658156 4:182342449-182342471 CCCCTCCCACCCCCAGCCCTAGG - Intronic
984928394 4:184826114-184826136 CCGCCCGCAGGCCCCGCCCCCGG + Intronic
984953226 4:185021324-185021346 GCGCGCGCACCGCACGCCCGCGG + Intergenic
985505857 5:279988-280010 CCCTGCCCACCCCCCTCCCTTGG - Intronic
985742340 5:1625938-1625960 CCCTGCCCACCCCCCTCCCTTGG + Intergenic
987193253 5:15500388-15500410 CCGCGCACAGCCCGCGCCCCGGG - Exonic
987303295 5:16616560-16616582 CCGCGGGCTCCCCCTGCACTGGG + Intronic
987647674 5:20696428-20696450 CCCCGCCCACCCCCCGACCTGGG + Intergenic
988437579 5:31194033-31194055 CCGCGCGCCCGCCCCGACCCGGG - Intronic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
999727293 5:154446883-154446905 CCCCGGGCACTCCCCGCCGTGGG + Intronic
1000071358 5:157743797-157743819 CCGCGCGCCCGCCCAGCCCGCGG + Exonic
1001382137 5:171311869-171311891 CCGCCCGCACCCCCCGGGCCGGG + Exonic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1001509687 5:172311203-172311225 CCCCTGCCACCCCCCGCCCTTGG - Intergenic
1002160567 5:177311960-177311982 CCGCGGGAACGCCCAGCCCTTGG + Exonic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1005235493 6:23757390-23757412 CCGCTCCCACCCCCCACCCCAGG + Intergenic
1006706320 6:36024437-36024459 ACGGACGCAGCCCCCGCCCTGGG + Intronic
1006814329 6:36840066-36840088 CTGCGCGCAGACCCCGCCCGCGG - Intergenic
1007398384 6:41590034-41590056 TCTCGTGCACCCCCCGACCTCGG + Exonic
1007465688 6:42049586-42049608 CCGCGGGCACCCCACGCCCTGGG + Intronic
1008598499 6:53065860-53065882 CCCCGCCGACCCCCAGCCCTAGG - Intronic
1010141792 6:72621787-72621809 ACGCGCGCACACCCAGCCCCAGG - Exonic
1011075270 6:83431400-83431422 CCGCTCCCTGCCCCCGCCCTGGG - Intergenic
1012546368 6:100424064-100424086 CCCCTCCCACCCCCCGCCCAGGG + Intronic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016969545 6:149749646-149749668 CCACACGCCTCCCCCGCCCTCGG + Exonic
1017154138 6:151307957-151307979 CCGCGCACATCCCCCGCCTCCGG + Intronic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1019420273 7:947659-947681 CCACACTCACGCCCCGCCCTAGG + Intronic
1019711348 7:2519554-2519576 CCCCGCACCCCCCCCGCCCCGGG - Intronic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1022714979 7:32891357-32891379 CCGCGCCCCTCCCCCGCCCGCGG + Intronic
1028922295 7:96321907-96321929 AGGCGCGCTCCCCCCGGCCTCGG + Intronic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1029640306 7:101816123-101816145 CCGCCCGCAGCCCCCACCCCCGG - Intronic
1029732417 7:102447057-102447079 CCGCTCCCAGCCCCGGCCCTCGG - Exonic
1031513265 7:122673900-122673922 CCACCCCCACCCCCCGCCGTGGG - Intronic
1031886602 7:127251699-127251721 CCGCGCCCACGCCCCGCGCGGGG + Intronic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034545473 7:151786049-151786071 CAGCGCCCACCCCCAGCGCTGGG - Intronic
1034911657 7:155002968-155002990 CCCCGCCCACCCCCCGCCCCCGG + Exonic
1035659459 8:1335914-1335936 CCACGCGCAGCCCCGGCTCTAGG - Intergenic
1036195160 8:6708073-6708095 CCGCGCGCACGTCCGGCCCGAGG + Intergenic
1036695988 8:10975501-10975523 CCTCGCCCACCACCTGCCCTGGG + Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1038008709 8:23457309-23457331 CGGCGCGCTCCCCCAGCCCCTGG - Intronic
1039903254 8:41767646-41767668 CCGCGCGCACCCCCTTCGCAGGG - Intronic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042020592 8:64369457-64369479 CGGCGCGCTCCGCCCGCCCGCGG - Intergenic
1045112436 8:98948015-98948037 CCGCCCCCACCCCACCCCCTGGG + Intronic
1045305046 8:100951383-100951405 CCTCGCGCAGCCTCCGCGCTGGG - Intronic
1045305418 8:100952701-100952723 CCGCGCCCTGCCCCCGCCCCGGG - Intronic
1045509973 8:102806569-102806591 CCGCGCTCTCTCCCCGCCCCTGG + Intergenic
1046660048 8:116938747-116938769 CCGCCCCCACCCCCCACCATGGG - Intronic
1049400534 8:142424784-142424806 CTGCGGCCACCCCCTGCCCTGGG + Intergenic
1049759862 8:144327040-144327062 CGGCCCGCAGCCCCGGCCCTGGG - Intergenic
1051174014 9:14346121-14346143 CCACGCGCCCCCCGCGCCCGCGG - Intronic
1052837919 9:33265198-33265220 CCCCGCCCACCCCCAGCCCCGGG + Intronic
1053397428 9:37787196-37787218 CCGCGTGCCCCACCCGCTCTGGG - Intronic
1056712062 9:88999238-88999260 CCCCGCCAACCCCCCGCCCCCGG + Exonic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057883072 9:98807853-98807875 CCCCGCGCACCCCGCGCCCCGGG + Exonic
1058486652 9:105448308-105448330 CCCCGCGCACCCACAGCCCACGG - Intronic
1060849173 9:126860624-126860646 CAGCCCGCGCCCCCCGCCCCCGG - Intergenic
1061003808 9:127917088-127917110 CGGCGCGCAGGCCCCGCCCCCGG - Intergenic
1061329925 9:129885916-129885938 CCACGCCCTCCACCCGCCCTGGG - Intergenic
1061366086 9:130172928-130172950 CGGCGCGCACTCCCCGGGCTGGG - Intronic
1061754745 9:132804558-132804580 CTGCTCCCACCCCCCTCCCTGGG - Intronic
1061859457 9:133460456-133460478 CCCCGCCGCCCCCCCGCCCTGGG - Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062460083 9:136659338-136659360 CCCCGAGCGCCCCCCGGCCTCGG - Exonic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1062740987 9:138175270-138175292 CCACCCGCACCCCCATCCCTAGG - Intergenic
1185605546 X:1366109-1366131 CCCCGCGCACCCCGCGCACCCGG - Intronic
1185605758 X:1366755-1366777 CCCCGCGCACCCCGCGCACCCGG - Intronic
1185605816 X:1366935-1366957 CCCCGCGCACCCCGCGCACCCGG - Intronic
1185605912 X:1367223-1367245 CCCCGCGCACCCCGCGCACCCGG - Intronic
1185605975 X:1367412-1367434 CCCCGCGCACCCCGCGCACCCGG - Intronic
1185606008 X:1367511-1367533 CCCCGCGCACCCCGCGCACCCGG - Intronic
1187481261 X:19657905-19657927 CCGCCCCCACCCCCAGCCCCTGG - Intronic
1189037170 X:37505304-37505326 GCGCCCGCACTGCCCGCCCTGGG + Intronic
1195297638 X:103495502-103495524 CTGTGCCCACCCCCAGCCCTAGG + Intergenic
1196804844 X:119574773-119574795 CAGCTCGCAACCCCCGGCCTCGG - Intronic
1200058262 X:153472702-153472724 CCCCGCCCACCCACCTCCCTGGG - Intronic
1200173799 X:154097792-154097814 GCGCGCCCGCGCCCCGCCCTCGG + Intergenic