ID: 1142517366 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:441440-441462 |
| Sequence | GGAGGCCATCGGCAGAAACC CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 157 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 141} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142517360_1142517366 | 17 | Left | 1142517360 | 17:441400-441422 | CCGGGGCACCGCGGGGCTCAGTT | 0: 1 1: 0 2: 1 3: 5 4: 139 |
||
| Right | 1142517366 | 17:441440-441462 | GGAGGCCATCGGCAGAAACCCGG | 0: 1 1: 0 2: 0 3: 15 4: 141 |
||||
| 1142517361_1142517366 | 9 | Left | 1142517361 | 17:441408-441430 | CCGCGGGGCTCAGTTCAGCTTTC | 0: 1 1: 0 2: 1 3: 8 4: 147 |
||
| Right | 1142517366 | 17:441440-441462 | GGAGGCCATCGGCAGAAACCCGG | 0: 1 1: 0 2: 0 3: 15 4: 141 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142517366 | Original CRISPR | GGAGGCCATCGGCAGAAACC CGG | Exonic | ||