ID: 1142517366

View in Genome Browser
Species Human (GRCh38)
Location 17:441440-441462
Sequence GGAGGCCATCGGCAGAAACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142517360_1142517366 17 Left 1142517360 17:441400-441422 CCGGGGCACCGCGGGGCTCAGTT 0: 1
1: 0
2: 1
3: 5
4: 139
Right 1142517366 17:441440-441462 GGAGGCCATCGGCAGAAACCCGG 0: 1
1: 0
2: 0
3: 15
4: 141
1142517361_1142517366 9 Left 1142517361 17:441408-441430 CCGCGGGGCTCAGTTCAGCTTTC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1142517366 17:441440-441462 GGAGGCCATCGGCAGAAACCCGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142517366 Original CRISPR GGAGGCCATCGGCAGAAACC CGG Exonic