ID: 1142517728

View in Genome Browser
Species Human (GRCh38)
Location 17:443608-443630
Sequence GACCCTATGCTGCTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142517728_1142517729 10 Left 1142517728 17:443608-443630 CCAGTGAGAAGCAGCATAGGGTC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1142517729 17:443641-443663 TAAAGTACTTACTATGTGCCAGG 0: 1
1: 17
2: 168
3: 1014
4: 4023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142517728 Original CRISPR GACCCTATGCTGCTTCTCAC TGG (reversed) Intronic
900375468 1:2352524-2352546 GACCCTGTGCTGCGTGGCACAGG - Intronic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
907745774 1:57212233-57212255 GACCATTTGCTTCTCCTCACTGG - Intronic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
909124962 1:71656284-71656306 GCCCCTATTCTCCTTCTAACAGG + Intronic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
917417262 1:174823520-174823542 GAACCCTTGTTGCTTCTCACTGG + Intronic
918586762 1:186197139-186197161 GACTCTTTTCTGCTTCTCTCAGG - Intergenic
920597019 1:207282220-207282242 GACCATATCCTGCTTTTCTCAGG + Intergenic
921333162 1:214060743-214060765 GTCCATATGTTGCTTCTCAATGG - Intergenic
924182028 1:241448497-241448519 GAGCCTCTGTTTCTTCTCACTGG + Intergenic
1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1069519897 10:69110591-69110613 CACCCAATGCTCCTGCTCACTGG - Intergenic
1070160659 10:73865053-73865075 GACCCTGTCAAGCTTCTCACTGG - Intronic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1070580543 10:77715879-77715901 AACCCTATGCTGGATGTCACAGG + Intergenic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1085582522 11:77667256-77667278 GACCCTAGGCTGGCTGTCACGGG + Exonic
1085767389 11:79295062-79295084 GTACCTCTGCTGCTTCTCAGAGG - Intronic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1089645397 11:119875579-119875601 GACCCCAGGCTTCTCCTCACTGG - Intergenic
1089680464 11:120116419-120116441 GACCGCATGCAGCCTCTCACTGG - Intronic
1090795157 11:130129088-130129110 CACCAGCTGCTGCTTCTCACTGG - Exonic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG + Intronic
1091194489 11:133719727-133719749 GACCTGATGCTCCTGCTCACAGG + Intergenic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1094027659 12:25975911-25975933 GACACTGTGCTGCTTCCCAAAGG - Intronic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1099359409 12:81681144-81681166 GACTGCATGCTGCTTCACACTGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104366731 12:128184752-128184774 GACTCTGTGCCTCTTCTCACAGG - Intergenic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1119343272 14:73899599-73899621 CTCCCTACGCTGCTTCTCATTGG - Intronic
1121928912 14:97954279-97954301 TACCCTAGGCTGCTTCTAGCTGG - Intronic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1133262185 16:4558100-4558122 GCCTCTTTGCTGCTCCTCACAGG - Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1141198514 16:81879507-81879529 GACTCTCTGATGCTTCTCAGAGG + Intronic
1141262379 16:82465705-82465727 AACCCTATGCAGCTTTTCCCTGG + Intergenic
1142360713 16:89625279-89625301 GACCCTATTCTCCTGCTCCCAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143854629 17:9839552-9839574 CACCCTCTGCTGCTTCTCCATGG + Intronic
1148157089 17:45430757-45430779 GACCCTCTGCTGATTCTCTGCGG - Intronic
1149218011 17:54380945-54380967 GGCCCTCTGCTTCATCTCACGGG + Intergenic
1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG + Intronic
1157045753 18:44100103-44100125 GCCCCCCTGCTACTTCTCACTGG - Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
927640471 2:24842384-24842406 GACCCTCTCCTGCCCCTCACAGG - Exonic
927855272 2:26523808-26523830 GACCCCAGGCTCCTTCTCATGGG - Intronic
930053690 2:47236193-47236215 TACCCTATCCTGCTGTTCACAGG - Intergenic
932214493 2:69958240-69958262 GACCATGTGGTGCTTCTTACTGG - Intergenic
934557200 2:95293766-95293788 GACTCCATGCTGTCTCTCACAGG - Intergenic
941516425 2:166485972-166485994 TAGCCTGTGCTGCTTCTCAGCGG + Intronic
943799045 2:192034848-192034870 TGCCCTATCCTGCTTTTCACTGG + Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948783564 2:240339638-240339660 GCCCCTCTGCCTCTTCTCACAGG + Intergenic
1169075667 20:2758654-2758676 GACCCCAGGCTCCTTCTCCCAGG - Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1171249484 20:23637527-23637549 GACCCCGTGCTGCTCCTCTCCGG - Intronic
1176948458 21:15013597-15013619 GACCTTATGCTGCTTATTTCTGG - Intronic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1182995427 22:34807859-34807881 GAGCCTATTGTGCTTCTCAGAGG - Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
949373715 3:3363830-3363852 GACCCTGTCCTGCTTATCTCGGG - Intergenic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
951806914 3:26655372-26655394 GACATTATGGTGCCTCTCACAGG - Intronic
952038925 3:29238133-29238155 GACCCAATGATTCTACTCACAGG - Intergenic
952102550 3:30031631-30031653 GACCCAAGGCTGCTTATTACAGG + Intergenic
954872564 3:53778817-53778839 GAGCCTATGTGGCTTCTCCCAGG - Intronic
956528781 3:70193524-70193546 GCCCCTATGTTGATTATCACTGG + Intergenic
960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG + Intronic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG + Intronic
967038732 3:185669819-185669841 CACCCTATGCTGCTGTTCTCAGG + Intronic
973936576 4:55852711-55852733 GACCCTTTCCTGCTTGGCACCGG - Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977646546 4:99419015-99419037 GACCCGATGTTGCTCTTCACTGG - Exonic
984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG + Intergenic
985207359 4:187553412-187553434 GATCCTAAGCTGTTTATCACTGG - Intergenic
993891415 5:93479135-93479157 GTCCCCATGCTGCTTTCCACAGG - Intergenic
997932793 5:138086032-138086054 GGACCTTTGCTGCTTCTGACTGG - Intronic
998659269 5:144218154-144218176 GACCATATGCTTCTGTTCACAGG - Intronic
999622631 5:153488229-153488251 GAACCTATTCTGTATCTCACAGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1013559688 6:111291876-111291898 GCCCCTCTGCTACCTCTCACTGG + Intergenic
1015086260 6:129295363-129295385 GAACCTATACAGTTTCTCACTGG + Intronic
1015226066 6:130858974-130858996 GCTCCTATCCTGCTGCTCACAGG - Intronic
1017821095 6:158049542-158049564 GACCCTAAGCTGCTTCTTTTAGG - Intronic
1019051849 6:169189686-169189708 GACAATATTCTGCTTCTCATGGG + Intergenic
1031250536 7:119374631-119374653 GACCATATGTTGCTTTTCAATGG - Intergenic
1031341141 7:120603546-120603568 TGCCCTATGCTACTTCTCCCTGG - Intronic
1032082771 7:128868394-128868416 CACCCTAGCCTGCTTGTCACAGG - Intronic
1033807869 7:144975311-144975333 CACCCCATCCTGCTTCTCATGGG - Intergenic
1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG + Intronic
1044626330 8:94237595-94237617 AACCCTCAGCTGCATCTCACAGG - Intergenic
1044729615 8:95219466-95219488 GGCCCTCTCCTCCTTCTCACTGG + Intergenic
1045156597 8:99481722-99481744 GTGCCTATACTGCTTCTAACTGG - Exonic
1054755805 9:68956687-68956709 GACTCAATGCTGCTTGTCAATGG - Intronic
1055720527 9:79168075-79168097 GACCCTAACCTGGTTCTCATTGG - Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG + Intergenic
1058263907 9:102873728-102873750 GAGACTTTGCTGCTTCTCTCAGG - Intergenic
1060737167 9:126073435-126073457 GACTCAACTCTGCTTCTCACTGG - Intergenic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1186346382 X:8697309-8697331 AGCCCTATTCTGATTCTCACTGG - Intronic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG + Intronic
1198145552 X:133853038-133853060 TACTCCATGCTGCCTCTCACTGG - Intronic