ID: 1142521379

View in Genome Browser
Species Human (GRCh38)
Location 17:507277-507299
Sequence CTCTGCTTGCAGAAGTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142521379_1142521389 13 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521389 17:507313-507335 AGTCTCTGAAGACCTGGGTGGGG No data
1142521379_1142521388 12 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521388 17:507312-507334 CAGTCTCTGAAGACCTGGGTGGG No data
1142521379_1142521390 19 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521390 17:507319-507341 TGAAGACCTGGGTGGGGCAAAGG No data
1142521379_1142521386 8 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521386 17:507308-507330 GGGACAGTCTCTGAAGACCTGGG No data
1142521379_1142521385 7 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521385 17:507307-507329 GGGGACAGTCTCTGAAGACCTGG No data
1142521379_1142521387 11 Left 1142521379 17:507277-507299 CCTGTTCACTTCTGCAAGCAGAG No data
Right 1142521387 17:507311-507333 ACAGTCTCTGAAGACCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142521379 Original CRISPR CTCTGCTTGCAGAAGTGAAC AGG (reversed) Intergenic
No off target data available for this crispr