ID: 1142523023

View in Genome Browser
Species Human (GRCh38)
Location 17:518370-518392
Sequence CTGTGTTATGAGAAGGAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142523023_1142523027 -8 Left 1142523023 17:518370-518392 CCAGACTCCTTCTCATAACACAG 0: 1
1: 0
2: 0
3: 33
4: 541
Right 1142523027 17:518385-518407 TAACACAGGAACACATCACTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
1142523023_1142523026 -9 Left 1142523023 17:518370-518392 CCAGACTCCTTCTCATAACACAG 0: 1
1: 0
2: 0
3: 33
4: 541
Right 1142523026 17:518384-518406 ATAACACAGGAACACATCACTGG 0: 1
1: 0
2: 1
3: 18
4: 272
1142523023_1142523029 30 Left 1142523023 17:518370-518392 CCAGACTCCTTCTCATAACACAG 0: 1
1: 0
2: 0
3: 33
4: 541
Right 1142523029 17:518423-518445 TTTGCTATTTCAGATGACGCTGG 0: 1
1: 0
2: 1
3: 5
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142523023 Original CRISPR CTGTGTTATGAGAAGGAGTC TGG (reversed) Exonic
900425964 1:2578799-2578821 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
900774660 1:4573602-4573624 CTGATTTATGAGCAGAAGTCTGG - Intergenic
901710947 1:11114577-11114599 ATGTCTTAGGAGAAGGAATCAGG + Intronic
902424735 1:16310960-16310982 GTTTGTTTTGAGATGGAGTCCGG - Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902920006 1:19660101-19660123 TTTTGTTTTGAGACGGAGTCTGG + Intergenic
903428738 1:23275061-23275083 CTTTGTTTTGAGATGGAGTCTGG - Intergenic
904060144 1:27702636-27702658 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
904241040 1:29145566-29145588 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
904536881 1:31205318-31205340 TTGTTTTTTGAGACGGAGTCTGG + Intronic
904787118 1:32991541-32991563 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
904800703 1:33091249-33091271 CTATTTTTTGAGATGGAGTCTGG + Intronic
905568073 1:38981815-38981837 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
906475790 1:46168563-46168585 TTGGGTTATGATAAGGAGGCTGG - Intronic
906514035 1:46428406-46428428 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
906748329 1:48237161-48237183 CAGTTTGTTGAGAAGGAGTCAGG + Intronic
906953141 1:50350441-50350463 CTGTGATATGGAAAGGAGGCAGG + Intergenic
907026870 1:51128894-51128916 TTTTGTTTTGAGATGGAGTCTGG + Intronic
907336897 1:53705684-53705706 CTGTTGTCTCAGAAGGAGTCTGG - Intronic
907614122 1:55906698-55906720 CTGTGGCATGTGAAGGAGTATGG + Intergenic
908741581 1:67334488-67334510 GTTTGTTTTGAGACGGAGTCTGG + Intronic
908991435 1:70095986-70096008 TTGTTTTTTGAGATGGAGTCTGG + Intronic
909480142 1:76121702-76121724 TTGTTTTTTGAGATGGAGTCTGG - Intronic
909798104 1:79769579-79769601 CTGGATTATGAGGAAGAGTCTGG + Intergenic
909850585 1:80458120-80458142 CTGAGGTATGAGAAAGAGACTGG - Intergenic
910832890 1:91478257-91478279 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911049082 1:93654326-93654348 CAGTGTTATGAGAAGGCCTATGG + Intronic
911156560 1:94642953-94642975 ATAGGTGATGAGAAGGAGTCAGG - Intergenic
911263940 1:95720844-95720866 CACTGTTATGAGAGGAAGTCGGG - Intergenic
911563159 1:99431012-99431034 CTGTGAGATGAAAAAGAGTCAGG - Intergenic
911612814 1:99975709-99975731 CTGTTTTATGTGAAGGAGTTTGG + Intronic
912340375 1:108908706-108908728 TTGTGTTTTGAGATGGAGTCTGG - Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915155289 1:153870559-153870581 CTTTTTTTTGAGACGGAGTCTGG - Intronic
915815992 1:158965536-158965558 CTGTGTTCTGAGAAGGTGGTTGG - Intronic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
917814763 1:178696672-178696694 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
917832318 1:178905209-178905231 CTTTGATATGGGAAGGAGGCTGG - Intronic
918192391 1:182188251-182188273 CTCTCTTTTGAGATGGAGTCTGG + Intergenic
918912820 1:190595529-190595551 CTCTGTTATGAGAAGGAATAGGG + Intergenic
919366911 1:196673296-196673318 TTTTGTTTTGAGATGGAGTCTGG + Intronic
919781720 1:201225579-201225601 TTGTTTTTTGAGACGGAGTCTGG - Intronic
920122522 1:203669445-203669467 CTGTTTTTTGAGATGGAGTCTGG + Intronic
921345020 1:214174720-214174742 CTGTGTTATGAAAAGCACTTTGG - Intergenic
923056360 1:230428437-230428459 CTGTGGTAAGAGAAGGAGTGAGG + Intergenic
923084376 1:230691684-230691706 CTGTGTTAAGACTAGGAGTCGGG + Intronic
923115451 1:230932946-230932968 TTGTGTTATGAAAAGGAGGTAGG - Intronic
923187380 1:231587290-231587312 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
923700183 1:236292778-236292800 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
923812220 1:237331512-237331534 CTTTTTTTTGAGATGGAGTCTGG + Intronic
923990294 1:239428389-239428411 CTGTGAATTGACAAGGAGTCAGG + Intronic
924051525 1:240084354-240084376 GTTTGTTTTGAGACGGAGTCTGG - Intronic
924237598 1:242012209-242012231 ATGTGTTGGGTGAAGGAGTCTGG + Intergenic
924421524 1:243914476-243914498 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
924802797 1:247339827-247339849 CTCTGCTATGAGATGGAATCAGG - Intergenic
1063196188 10:3746044-3746066 ATATTTTATGAGAAAGAGTCAGG + Intergenic
1063482436 10:6387739-6387761 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1063632617 10:7748181-7748203 ATATTTTATGAGATGGAGTCAGG - Intronic
1064000910 10:11663082-11663104 TTTTGTTTTGAGACGGAGTCTGG + Intergenic
1064202433 10:13296154-13296176 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1064202572 10:13297463-13297485 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1064321241 10:14306984-14307006 CTATGTTAGGAGTAGGAGTGTGG - Intronic
1064455913 10:15487392-15487414 TTTTGTTTTGAGATGGAGTCAGG - Intergenic
1064796213 10:19014416-19014438 CTGTGTGATGAGATGAAGTGAGG - Intergenic
1065039832 10:21681083-21681105 CTGTGTTATTACAAAGAGTGAGG - Intronic
1065095519 10:22277048-22277070 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1065347602 10:24764194-24764216 CTGTGTTATGGGAGGGACCCAGG - Intergenic
1065651136 10:27893145-27893167 TTTTTTTTTGAGAAGGAGTCTGG - Intronic
1065950674 10:30647856-30647878 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066014602 10:31228244-31228266 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1066631807 10:37465609-37465631 CTATTTTCTGAGATGGAGTCTGG - Intergenic
1066676562 10:37893615-37893637 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1067315738 10:45160281-45160303 CTGTGTGATGAGATGAAGTCAGG + Intergenic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1068122234 10:52793821-52793843 CTGTGTTATGATATGTAGTAGGG + Intergenic
1068580239 10:58731071-58731093 ATATGTTATTAGAAGCAGTCAGG + Intronic
1068747221 10:60547100-60547122 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
1069045861 10:63742386-63742408 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1069524896 10:69161069-69161091 GTTTGTTTTGAGAAAGAGTCTGG + Intronic
1070462902 10:76687788-76687810 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1070915403 10:80151217-80151239 CTTAGTGTTGAGAAGGAGTCAGG + Exonic
1071207457 10:83297697-83297719 CTGTGTTATAATGAAGAGTCAGG + Intergenic
1071719830 10:88131912-88131934 TTGTGCATTGAGAAGGAGTCAGG - Intergenic
1072558314 10:96543344-96543366 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1072815869 10:98508764-98508786 CTGTGAGATGGGAAGGAGTTTGG + Intronic
1074724287 10:116291579-116291601 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075113203 10:119604574-119604596 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1075416250 10:122266728-122266750 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075925639 10:126249680-126249702 CTTTTTTTTGAGACGGAGTCTGG - Intronic
1076097525 10:127744209-127744231 CTGGATTGTCAGAAGGAGTCTGG - Intergenic
1076103623 10:127802810-127802832 CTGTGATATGACAAAGAGGCAGG + Intergenic
1077996906 11:7461382-7461404 TTGTTTTTTGAGAGGGAGTCTGG + Intronic
1078234576 11:9472262-9472284 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1080792945 11:35537583-35537605 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1081562458 11:44230315-44230337 CTGTGACATGTGAAGGAGTTCGG + Intronic
1081926451 11:46833489-46833511 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1083175016 11:60944145-60944167 TTGTTTTTTGAGAGGGAGTCTGG - Intronic
1083199039 11:61108640-61108662 CTGTGTTTTGGGTAGGATTCTGG - Intronic
1083277420 11:61604886-61604908 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1083791841 11:64990800-64990822 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1084082730 11:66839445-66839467 CTGTTTTATCTGAAGGACTCAGG - Intronic
1085076914 11:73599325-73599347 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1085314306 11:75535138-75535160 CTCTGTTCTGAGAGGGTGTCAGG - Intergenic
1085701572 11:78750889-78750911 CTGTGTTTTGAGACAGGGTCTGG + Intronic
1085822768 11:79810638-79810660 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1087612165 11:100447777-100447799 TTGTTTTATGATAAGCAGTCAGG - Intergenic
1088549332 11:110995389-110995411 CTGAGGTATGAGAATGAGACTGG - Intergenic
1089507477 11:118973427-118973449 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1090933581 11:131321581-131321603 CTGTCTTCTGAGAAGGAATGAGG + Intergenic
1091908093 12:4205679-4205701 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1092212691 12:6657969-6657991 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1092461869 12:8694219-8694241 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1092740869 12:11628202-11628224 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093284370 12:17240142-17240164 CTGAGATATGAGAGGTAGTCAGG - Intergenic
1093718487 12:22411176-22411198 CTGAGGTCAGAGAAGGAGTCAGG + Intronic
1094610740 12:31993458-31993480 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1096388376 12:51210587-51210609 CTGTGTTATTAGGAGGATTCAGG + Intronic
1096400841 12:51305004-51305026 TTTTGTTTTGAGACGGAGTCTGG - Intronic
1097441582 12:59614659-59614681 CTGCCTTATGAATAGGAGTCAGG + Intronic
1097513438 12:60571883-60571905 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1097800272 12:63906324-63906346 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1097999236 12:65922773-65922795 ATGTGTTGTGAGAAGGACCCAGG + Intronic
1098878010 12:75887182-75887204 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1099607123 12:84818311-84818333 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1103275927 12:119712022-119712044 CTGTGTCATGGCCAGGAGTCTGG - Intronic
1104147655 12:126050947-126050969 CTGAATGATGAGAAGGATTCGGG - Intergenic
1105601661 13:21893261-21893283 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105656383 13:22444501-22444523 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1105836103 13:24213276-24213298 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1106866326 13:33968137-33968159 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1107237229 13:38186443-38186465 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1107465524 13:40646604-40646626 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1108677872 13:52753103-52753125 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1109054218 13:57526493-57526515 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1110936699 13:81299456-81299478 GTTTGTTTTGAGACGGAGTCTGG + Intergenic
1111436139 13:88210715-88210737 CTTTGATTTGAGAAGGGGTCTGG + Intergenic
1112008058 13:95271081-95271103 CTGTTTTTTGAGACGGAGTCTGG - Intronic
1112061873 13:95748802-95748824 GTTTGTTTTGAGACGGAGTCTGG - Intronic
1112523383 13:100119293-100119315 ATATGTTATGAGGAAGAGTCAGG - Intronic
1112871405 13:103975238-103975260 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1113073837 13:106448714-106448736 ATGTGTCATGAGAGGGACTCGGG + Intergenic
1113483085 13:110635845-110635867 CTCAGTTATGAGAAGCAGTCTGG + Intronic
1116660693 14:47706747-47706769 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1117095662 14:52294999-52295021 CTGTGTTCTGAGACAGGGTCTGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117810751 14:59544175-59544197 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1118283014 14:64446551-64446573 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1119241402 14:73063159-73063181 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1119592293 14:75900835-75900857 CAGTGTTATGAGAACGAGGCAGG - Intronic
1119724663 14:76914738-76914760 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
1119878980 14:78085179-78085201 CTGTGTTATTTGAAGAAGTCAGG + Intergenic
1120804569 14:88732822-88732844 CTTTCTTTTGAGACGGAGTCTGG + Intronic
1121345654 14:93133942-93133964 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1122707818 14:103632397-103632419 GTTTGTTTTGAGACGGAGTCTGG - Intronic
1123046125 14:105516700-105516722 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1123780027 15:23617109-23617131 CTGTGTTCTGGGAACGACTCCGG - Intronic
1124963794 15:34418602-34418624 CTGTGTCATGCCACGGAGTCTGG + Intronic
1124980414 15:34564833-34564855 CTGTGTCATGCCATGGAGTCTGG + Intronic
1125111697 15:36041872-36041894 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1125626567 15:41114253-41114275 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1125673590 15:41490681-41490703 CTTTGTTTTGAGATGGAGTCTGG + Intergenic
1125929647 15:43591164-43591186 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1125942814 15:43690996-43691018 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1126447120 15:48760071-48760093 CTGAGATAAGAGAAGGGGTCAGG + Intronic
1128562552 15:68678222-68678244 CTGTTGTCAGAGAAGGAGTCAGG + Intronic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1131583760 15:93671764-93671786 CTTTGTTAGGAGTGGGAGTCGGG + Intergenic
1132065291 15:98725952-98725974 ATGTGTTATGGGAAGGACCCAGG - Intronic
1132341389 15:101080495-101080517 TTGTGTTTTGAGATGGAGTCTGG + Intergenic
1132363796 15:101241105-101241127 TTGTTTTCTGAGACGGAGTCTGG + Intronic
1134088426 16:11374858-11374880 CTTTGTTTTGAGACAGAGTCTGG + Intronic
1135338299 16:21623781-21623803 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1135338687 16:21627939-21627961 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1136219488 16:28819408-28819430 TTTTTTTATGAGATGGAGTCTGG + Intergenic
1136557546 16:31016685-31016707 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1137714795 16:50592117-50592139 CTGTGTTTTGAGCAGGGGCCAGG + Intronic
1138755657 16:59481312-59481334 TTTTCTTTTGAGAAGGAGTCTGG - Intergenic
1139056568 16:63192923-63192945 CTGTGTTTTTCTAAGGAGTCAGG + Intergenic
1139684560 16:68592805-68592827 CTGTGTTATAAGGGGTAGTCAGG - Intergenic
1140081157 16:71748916-71748938 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1140489755 16:75325257-75325279 CTGTGCTAGGAGAGGAAGTCTGG - Intronic
1140511173 16:75509504-75509526 TTGTTTTCTGAGACGGAGTCTGG - Intergenic
1141719575 16:85748664-85748686 CTGGGTTACGATAAGGAGTTTGG + Intronic
1141918919 16:87121657-87121679 TTGTTTTTTGAGAAGGAGTCTGG - Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1143197041 17:5083876-5083898 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1143255781 17:5557013-5557035 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1143707854 17:8712035-8712057 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1143789468 17:9282142-9282164 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1143828355 17:9630972-9630994 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1144522596 17:15963870-15963892 CTGTCTTATGTGAAGGTGGCTGG - Intronic
1144923576 17:18784131-18784153 GTTTGTTTTGAGACGGAGTCTGG - Intronic
1145391232 17:22457245-22457267 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1146281036 17:31544722-31544744 CTTATTTATGAGACGGAGTCTGG + Intergenic
1146753862 17:35408788-35408810 CTGTTTAATGAGAAGCAGTGGGG - Intergenic
1148290484 17:46444016-46444038 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1148312652 17:46661589-46661611 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1149189587 17:54043570-54043592 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1149267918 17:54947891-54947913 CTGAGTTTAGAGAAGGGGTCTGG - Intronic
1149790440 17:59472221-59472243 GTTTGTTTTGAGACGGAGTCTGG + Intergenic
1149928370 17:60724813-60724835 GTGTGGTATGAGATGGGGTCAGG + Intronic
1150564737 17:66328784-66328806 GTTTGTTTTGAGACGGAGTCCGG - Intronic
1154476747 18:14767535-14767557 CTATGTGATGAGATGAAGTCAGG + Intronic
1154511432 18:15107382-15107404 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1155025680 18:21938334-21938356 TTTTGTTTTGAGAAAGAGTCTGG - Intergenic
1155080067 18:22400343-22400365 GTATGATATGAGTAGGAGTCAGG - Intergenic
1155267361 18:24106701-24106723 TTGTGTTTTGAGACGGAGTCTGG + Intronic
1157356656 18:46941325-46941347 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1157427525 18:47596479-47596501 CTGTGAAATGAGCAGAAGTCAGG - Intergenic
1158400131 18:57114493-57114515 GTGAGTTATGAGGAGGAGTAGGG - Intergenic
1158879677 18:61765395-61765417 CTGTGTGAAGTGGAGGAGTCAGG - Intergenic
1159189452 18:65022516-65022538 TTGTTTTTTGAGAGGGAGTCTGG - Intergenic
1159190894 18:65040847-65040869 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1159712805 18:71784287-71784309 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
1159870074 18:73751178-73751200 CTGTGTTCTGAGAACAAGTTAGG - Intergenic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1162257944 19:9508098-9508120 CTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1162749857 19:12822563-12822585 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1162766153 19:12920908-12920930 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1163141420 19:15351601-15351623 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1163802921 19:19378323-19378345 GTTTGTTTTGAGACGGAGTCTGG + Intergenic
1164288240 19:23841450-23841472 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1164773613 19:30832706-30832728 CTATGTTATTAGAAGTAATCTGG - Intergenic
1165959336 19:39521319-39521341 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1166081346 19:40445680-40445702 ATGTGTTCTGAGAAGCAGCCTGG - Intergenic
1166286965 19:41837095-41837117 ATTTGTTATGTGAAAGAGTCTGG + Exonic
1166403903 19:42505445-42505467 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1166534337 19:43562850-43562872 ATGTATTATTAGCAGGAGTCTGG - Intronic
1167050239 19:47073558-47073580 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1167252952 19:48410639-48410661 GTGGGTTATGAGCAGGAGACGGG + Intronic
1168411642 19:56143899-56143921 CTCAGTCATGAGAAGGAGTCAGG + Intronic
925372017 2:3352651-3352673 CTGTGTGATGAGATGAAGTGAGG - Intronic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926302503 2:11614573-11614595 TTTTGTTTTGAGATGGAGTCTGG + Intronic
927532488 2:23820935-23820957 TTTTGTTTTGAGACGGAGTCTGG - Intronic
928526759 2:32149099-32149121 CTTTTTTTTGAGAAGGACTCTGG + Intronic
928902755 2:36338264-36338286 CAGAGCTATGAGCAGGAGTCAGG - Intergenic
929148996 2:38731213-38731235 GTTTGTTTTGAGATGGAGTCTGG - Intronic
930315249 2:49789180-49789202 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
930513988 2:52382145-52382167 CTGTGGGATGAGATGAAGTCAGG + Intergenic
930836549 2:55799865-55799887 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
931374768 2:61697115-61697137 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
931758219 2:65393341-65393363 CTTTTTTTTGAGATGGAGTCTGG + Intronic
932193296 2:69759842-69759864 CTTTTTTTTGAGACGGAGTCTGG + Intronic
932215850 2:69965573-69965595 CTGTGTTCTGGGAAGTCGTCAGG - Intergenic
932228788 2:70065081-70065103 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
932813276 2:74841966-74841988 CTGTTTGATGAGCTGGAGTCAGG + Intronic
932905536 2:75746083-75746105 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
933240634 2:79916956-79916978 TTGTTTTTTGAGACGGAGTCTGG + Intronic
933536819 2:83585751-83585773 CTGGGTTATAATAAGGAGTGTGG - Intergenic
934088219 2:88528147-88528169 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
935983154 2:108646716-108646738 TTTTGTTTTGAGACGGAGTCTGG + Intronic
936705399 2:115067261-115067283 TTTTGTTTTGAGACGGAGTCTGG + Intronic
936706338 2:115079352-115079374 TTGTTTTTTGAGACGGAGTCTGG - Intronic
936793716 2:116183040-116183062 CTGTAGTATAAGAAGAAGTCTGG + Intergenic
937390102 2:121478587-121478609 GTGTGTTTTGAGACGGAGTCTGG - Intronic
937685116 2:124687264-124687286 CTGCATTATAAGAGGGAGTCTGG + Intronic
938890011 2:135694686-135694708 CTGAGTTAGGAGATGGAGTTGGG + Intronic
939145084 2:138403912-138403934 CTGTTTTAAAAGAAGGGGTCAGG - Intergenic
939818643 2:146928252-146928274 CTGTGTAATGACATGGAGCCAGG + Intergenic
940670701 2:156663839-156663861 CTGTATTATGAAGAGGAGTGTGG - Intergenic
941354925 2:164478838-164478860 CTCTGTTATGAACATGAGTCTGG - Intergenic
941477383 2:165966661-165966683 CTGTGTTGTGAGAGGGACCCAGG + Intergenic
941710124 2:168703544-168703566 TTGTTTTTTGAGATGGAGTCTGG - Intronic
942898299 2:181084608-181084630 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
943145818 2:184043461-184043483 CTGTGTTATTATAAAGAGTTAGG + Intergenic
943972727 2:194431773-194431795 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
944687548 2:202131148-202131170 GTTTGTTTTGAGATGGAGTCTGG + Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945398791 2:209354397-209354419 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
946192849 2:218016513-218016535 CTGCAGTGTGAGAAGGAGTCTGG + Intergenic
946660956 2:221998824-221998846 CTGTGTTTTGTGAAGGTCTCAGG + Intergenic
946701567 2:222419777-222419799 CTGTTTTATGATAATTAGTCTGG + Intergenic
946853467 2:223930339-223930361 TTTTGTTTTGAGACGGAGTCCGG + Intronic
947120913 2:226813839-226813861 CTTTGTTTTGCAAAGGAGTCAGG - Intergenic
947164604 2:227249245-227249267 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
948331983 2:237176835-237176857 CTGTTTTCTGAGAGGGACTCAGG - Intergenic
948492844 2:238324615-238324637 CTTTTTTTTGAGACGGAGTCTGG + Intronic
949075079 2:242051988-242052010 CTGTGTTATGAATATGAATCTGG + Intergenic
1169310904 20:4538859-4538881 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1170232785 20:14068958-14068980 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1171392067 20:24808101-24808123 TTGTTTTCTGAGATGGAGTCTGG + Intergenic
1171546888 20:26009528-26009550 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1172256068 20:33518831-33518853 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1173404430 20:42752594-42752616 CTGTGTTATGGGATGGGATCTGG - Intronic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1173635785 20:44556372-44556394 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1174477045 20:50802860-50802882 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1174951168 20:55042466-55042488 ATGTGTTGTGGGAAGGACTCTGG + Intergenic
1175157270 20:56979606-56979628 GTTTGTTTTGAGATGGAGTCCGG + Intergenic
1175160163 20:57002463-57002485 CTGTTTTGTGAGATGGAATCTGG + Intergenic
1175427973 20:58882078-58882100 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1175641686 20:60635590-60635612 CTGTGTTAAGAGAAGGATACTGG - Intergenic
1176191521 20:63812764-63812786 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1176936056 21:14868277-14868299 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
1179454041 21:41486309-41486331 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1179487266 21:41718348-41718370 CTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1180209047 21:46282935-46282957 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1180694981 22:17745953-17745975 GTTTGTTTTGAGACGGAGTCTGG - Intronic
1180835950 22:18929506-18929528 GTGTGTTCTCAGAAGGAGTCTGG - Intronic
1181646425 22:24233673-24233695 CTGCATTATGAGATGGACTCTGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1184056265 22:42052292-42052314 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
1185378376 22:50493807-50493829 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1185387713 22:50543894-50543916 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1203286041 22_KI270734v1_random:154805-154827 GTGTGTTCTCGGAAGGAGTCTGG - Intergenic
949643623 3:6068124-6068146 TTTTGTTTTGAGACGGAGTCAGG + Intergenic
949900074 3:8806212-8806234 CTGTGTGATGAGGAGCAGTTAGG - Intronic
950388833 3:12680528-12680550 TTTTGTTTTGAGACGGAGTCTGG + Intergenic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952258378 3:31714850-31714872 CAGTGTTAAGAGGAGGCGTCTGG - Intronic
952405532 3:33001453-33001475 CTGAGTGATGAGAAGGCTTCAGG - Intronic
952993105 3:38849737-38849759 GTGTTTTATAAGAAGGAGTATGG + Intronic
953398588 3:42591965-42591987 CTCTGTTAAGTGAAGGGGTCAGG + Intronic
953454555 3:43031370-43031392 CTGTGTTTTAAGAAGTACTCTGG - Intronic
953618315 3:44511234-44511256 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
954616405 3:51970876-51970898 CTGGGTTATGACAGGCAGTCTGG + Intronic
955635694 3:61027096-61027118 CTTTTTTTTGAGATGGAGTCTGG + Intronic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957198830 3:77106052-77106074 GTTTGTTTTGAGATGGAGTCTGG + Intronic
958441797 3:94164413-94164435 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
958542654 3:95499292-95499314 TTTTGTTTTGAGATGGAGTCCGG - Intergenic
958628515 3:96657567-96657589 CTTTTTTTTGAGAAGGGGTCTGG - Intergenic
958696945 3:97539715-97539737 CTGTGATATGAAAAGGATTGTGG + Intronic
959367243 3:105476877-105476899 ATGTGTTGTGGGAGGGAGTCAGG + Intronic
959792477 3:110379248-110379270 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
960179513 3:114558791-114558813 ATGTGTTCAGAGAAGGAATCAGG - Intronic
962564474 3:136643518-136643540 GTTTGTTTTGAGAAAGAGTCTGG + Intronic
962750125 3:138428022-138428044 TTTTTTTATGAGATGGAGTCTGG - Intergenic
963585768 3:147186117-147186139 CTCTGTCATGAGAAGGAATTAGG - Intergenic
963889412 3:150617131-150617153 CTGTTTTAAGAGAAGCAGGCTGG + Intronic
964346736 3:155761446-155761468 TTATGTTCTAAGAAGGAGTCAGG + Intergenic
964931079 3:162023981-162024003 CTCTGTTATCAGAAGGACTTTGG - Intergenic
966095121 3:176190754-176190776 TTTTTTTTTGAGAAGGAGTCTGG - Intergenic
966973229 3:185064265-185064287 ATTTGTTTTGAGATGGAGTCTGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969426250 4:7125949-7125971 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
971300388 4:25437299-25437321 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
972373735 4:38450689-38450711 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
972510812 4:39767338-39767360 TTGTTTTTTGAGATGGAGTCTGG + Intronic
972619561 4:40733765-40733787 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
973904736 4:55517496-55517518 CTGTGTTTTGAGACAGAGTCTGG - Intronic
973985485 4:56348137-56348159 CTTTTTTTTGAGATGGAGTCTGG - Intronic
974964500 4:68744648-68744670 CTGTTTTAAAAGAAGGTGTCAGG + Intergenic
975362742 4:73490428-73490450 TTGTTTTTTGAGACGGAGTCTGG + Intronic
975688786 4:76945900-76945922 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
975782163 4:77850656-77850678 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
976559452 4:86484829-86484851 CTGTGTTATAAGAAACAGTGTGG - Intronic
977652109 4:99482549-99482571 CTGTGGTCTGAGAATGAGTTTGG + Intergenic
977794058 4:101141422-101141444 CTGTGGTTAGAGAAGGAGTGGGG - Intronic
978460412 4:108945674-108945696 TTGTTTTTTGAGATGGAGTCTGG + Intronic
978738893 4:112115356-112115378 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
978801969 4:112763953-112763975 TTTTGTTTTGAGAGGGAGTCTGG + Intergenic
979302502 4:119102963-119102985 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
979738339 4:124117792-124117814 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
982790776 4:159588922-159588944 CTGTGTTATGAGGTGAAGTGAGG + Intergenic
982920301 4:161266354-161266376 TTTTTTTATGAGATGGAGTCTGG - Intergenic
983649254 4:170022416-170022438 CAGTGTCATGTGAAGGAGTTTGG - Intronic
983653101 4:170053114-170053136 CTGTAGGATGAGTAGGAGTCAGG + Intergenic
984643832 4:182199408-182199430 TTGTTTTTTGAGATGGAGTCTGG - Intronic
984989678 4:185368164-185368186 CTTTTTTTTGAGACGGAGTCTGG - Intronic
985113671 4:186571135-186571157 TTTTGTTTTGAGACGGAGTCTGG + Intergenic
985237494 4:187891978-187892000 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
985254940 4:188060638-188060660 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
985306118 4:188542477-188542499 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
986885372 5:12227110-12227132 TTGTATTTTGAGAGGGAGTCAGG - Intergenic
987474479 5:18374288-18374310 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
987811763 5:22845848-22845870 CTGTGTAATGAGTTGGGGTCGGG + Intronic
988567686 5:32332763-32332785 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
989438812 5:41446163-41446185 TTTTTTTTTGAGAAGGAGTCTGG - Intronic
989786579 5:45339529-45339551 CTGTGTCATATGAAGGAGTTTGG + Intronic
990025552 5:51183352-51183374 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
990914149 5:60884462-60884484 TTTTTTTTTGAGAAGGAGTCTGG - Intronic
991072261 5:62497147-62497169 TTTTGTTATTAGAAGGAGACTGG + Intronic
992239747 5:74755082-74755104 CTCTTTTTTGAGATGGAGTCTGG - Intronic
992901355 5:81300330-81300352 TTGTTTTTTGAGAAGGAGTTTGG - Intergenic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
993323620 5:86506406-86506428 TTTTGTTTTGAGAGGGAGTCTGG - Intergenic
995514862 5:112944239-112944261 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
995925486 5:117368883-117368905 CTATGTTTTGACAAAGAGTCTGG + Intergenic
996304617 5:122032962-122032984 GTTTGTTTTGAGATGGAGTCTGG + Intronic
996336798 5:122392586-122392608 CTGTGTTATGATTGGGAGTTAGG + Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
998131485 5:139653600-139653622 CTGTATGTTGAGAAGCAGTCTGG + Intronic
998273485 5:140728751-140728773 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
998700493 5:144693310-144693332 CTTTGTTATAAGGAAGAGTCTGG + Intergenic
999852972 5:155562850-155562872 CTGTGTTCTCAGAAGCAGACTGG - Intergenic
999924375 5:156359179-156359201 ATGTGTTATGAAAAGGAAACTGG + Intronic
999972761 5:156881382-156881404 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1000226665 5:159267663-159267685 ATGTGTTATGAGAGGGACCCAGG + Intronic
1000400682 5:160824031-160824053 CTTTTTTTTGAGACGGAGTCTGG + Intronic
1000698093 5:164414100-164414122 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1000825799 5:166042348-166042370 TTTTGTTTTGAGACGGAGTCTGG + Intergenic
1000893856 5:166831104-166831126 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002932870 6:1646428-1646450 CTGTGTTTTGAGACAGGGTCTGG + Intronic
1003086711 6:3066043-3066065 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1003589453 6:7424951-7424973 CTATTTTTTGAGATGGAGTCTGG - Intergenic
1003651093 6:7961161-7961183 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1004754230 6:18594125-18594147 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005833853 6:29692745-29692767 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1006098171 6:31669210-31669232 CAGTCTTATGGGAAGGAGTTGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006563269 6:34932194-34932216 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1006671670 6:35733158-35733180 CTCTTTTTTGAGACGGAGTCTGG - Intergenic
1006797287 6:36739842-36739864 CTGTGCCATGAGGAGGAGTCTGG - Intergenic
1007447164 6:41915773-41915795 GTGTGTTTTGAGACGGAGTCTGG - Intronic
1007572123 6:42900395-42900417 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1007914616 6:45549408-45549430 CATTTTTATTAGAAGGAGTCAGG - Exonic
1008651264 6:53565376-53565398 ATCAGTTATTAGAAGGAGTCAGG - Intronic
1009900633 6:69803881-69803903 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1010967173 6:82224349-82224371 TTGTGTTCCGAGAAGGATTCAGG - Intronic
1011535649 6:88373278-88373300 CTGTGTTAAAAGAAGAAATCAGG + Intergenic
1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG + Intronic
1013291982 6:108727920-108727942 CTGTGCTTAGAGAAGGAGTGTGG + Intergenic
1013532273 6:111030815-111030837 CAGTGTTGTGGGAAGGAGTGTGG + Intergenic
1014996612 6:128153529-128153551 CTGTACTATCAGAAGGTGTCTGG + Intronic
1015148516 6:130014650-130014672 CTGTTATGTGAGAAGGAGTAGGG + Intronic
1016804354 6:148197859-148197881 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1017339316 6:153302200-153302222 CTGTGGGATGAGATGGAGTTTGG - Intergenic
1017535288 6:155340850-155340872 ATCTGTTGTGAGAAGGAGACTGG + Intergenic
1017800628 6:157892424-157892446 ATGTGTTATCAGCAGGAGTTGGG + Intronic
1018223589 6:161606354-161606376 ATGTGGTAAAAGAAGGAGTCTGG + Intronic
1018346903 6:162909177-162909199 CTTTGTTATGAGAAAGAGTAAGG - Intronic
1018395628 6:163376221-163376243 CTGTGGAATGAGATGCAGTCTGG - Intergenic
1018758655 6:166871639-166871661 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
1019220993 6:170472713-170472735 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1019391911 7:793005-793027 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1021506563 7:21391795-21391817 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1022077364 7:26985346-26985368 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1022245928 7:28559326-28559348 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1022302039 7:29110887-29110909 ATGTGCTGTGAGAAGGACTCAGG + Intronic
1022573218 7:31473283-31473305 CTGTGTGATGAGAAGCAGCTTGG - Intergenic
1023368174 7:39486045-39486067 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1024369595 7:48565619-48565641 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1026056253 7:66986483-66986505 CTTTGTTTTGAGATGGGGTCTGG + Intergenic
1026121908 7:67545150-67545172 TTTTTTTAAGAGAAGGAGTCTGG - Intergenic
1026121976 7:67545699-67545721 TTTTTTTAAGAGAAGGAGTCTGG + Intergenic
1026721835 7:72838581-72838603 CTTTGTTTTGAGATGGGGTCTGG - Intergenic
1026728804 7:72893570-72893592 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1027114976 7:75471895-75471917 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1027598133 7:80202100-80202122 TTGTTTTTTGAGATGGAGTCGGG + Intronic
1027903444 7:84148937-84148959 CTGTGTTATGGTAAGGTTTCTGG + Intronic
1029243485 7:99181557-99181579 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1029249378 7:99225149-99225171 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1029571137 7:101370380-101370402 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1029571417 7:101372175-101372197 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1030970725 7:116051961-116051983 CTTTGTTCTGAGAAGGTGTAAGG + Intronic
1031939554 7:127773469-127773491 CTTATTAATGAGAAGGAGTCAGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032214133 7:129943570-129943592 TTGTGTTTTTAGACGGAGTCTGG - Intronic
1032679056 7:134162813-134162835 TTTTTTTTTGAGAAGGAGTCTGG - Intronic
1032790317 7:135237878-135237900 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1033342914 7:140505956-140505978 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1033360801 7:140637767-140637789 CTGTGGTCTGAGAAGGGGACAGG - Intronic
1033449875 7:141453108-141453130 CTGAGTTCAGAGGAGGAGTCTGG - Intronic
1034105774 7:148488533-148488555 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1034997215 7:155585300-155585322 CTGTGTTATCAGAAGCACACAGG + Intergenic
1035821265 8:2594752-2594774 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1036462621 8:8967097-8967119 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1036647553 8:10621336-10621358 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1038975523 8:32691339-32691361 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1039544070 8:38395525-38395547 TTTTTTTTTGAGAAGGAGTCTGG + Intronic
1039868650 8:41528009-41528031 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1039941246 8:42093149-42093171 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1040513489 8:48116215-48116237 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1042331385 8:67584144-67584166 TTTTGTTTTGAGACGGAGTCTGG - Intronic
1042844272 8:73154724-73154746 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1043581322 8:81719493-81719515 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1044540346 8:93401890-93401912 ATGTGTTAAGAGAAGAAGTCAGG + Intergenic
1044566352 8:93664918-93664940 CTGTGATATTAGAAGGAATATGG - Intergenic
1044641496 8:94387044-94387066 CTGTTTACTGAAAAGGAGTCAGG - Exonic
1044825679 8:96194647-96194669 CTGTATTTGGAGAAGGAGTTTGG + Intergenic
1044827917 8:96215725-96215747 CTGTGTTATGATTATGAGGCTGG - Intergenic
1045869833 8:106912907-106912929 ATGTGTTATTAGAAGGAATTAGG + Intergenic
1046391439 8:113578005-113578027 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1046522831 8:115346798-115346820 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1046560667 8:115833085-115833107 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1046631256 8:116625117-116625139 CTTTCTTTTGAGATGGAGTCTGG + Intergenic
1047236144 8:123043272-123043294 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048671128 8:136721587-136721609 CTGTTTTATGAAAAATAGTCTGG - Intergenic
1048793584 8:138127834-138127856 CTTTTTTTTGAGACGGAGTCTGG - Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1050030105 9:1377231-1377253 CTCTGTTTTGAAAAGGAATCTGG - Intergenic
1050053881 9:1631781-1631803 CTGTTTTAGGAGGAGGAGTTGGG - Intergenic
1050319442 9:4435935-4435957 TTTTGTTTTGAGACGGAGTCTGG - Intergenic
1050579019 9:7031172-7031194 GTATGTTTTGAGATGGAGTCTGG + Intronic
1051168723 9:14295617-14295639 TTGTTTTTTGAGAAGGAGTCTGG - Intronic
1051413357 9:16813275-16813297 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1051750826 9:20339180-20339202 TTTTTTTATGAGACGGAGTCTGG - Intergenic
1051840643 9:21393536-21393558 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1051908992 9:22131506-22131528 TTTTTTTTTGAGAAGGAGTCTGG + Intergenic
1053541532 9:38978950-38978972 TTTTGTTTTGATAAGGAGTCTGG - Intergenic
1053543645 9:39000029-39000051 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1053580718 9:39401250-39401272 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1053805951 9:41801994-41802016 TTTTGTTTTGATAAGGAGTCTGG - Intergenic
1053808071 9:41823531-41823553 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1053845212 9:42229298-42229320 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1053882470 9:42610041-42610063 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
1053890199 9:42684261-42684283 GTTTGTTTTGAGACGGAGTCTGG + Intergenic
1054102305 9:60960055-60960077 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1054221495 9:62417509-62417531 GTTTGTTTTGAGACGGAGTCTGG - Intergenic
1054229219 9:62491664-62491686 GTTTGTTTTGAGACGGAGTCTGG + Intergenic
1054584054 9:66946807-66946829 CTCTCTTTTGAGATGGAGTCTGG + Intergenic
1054622521 9:67363897-67363919 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1054624606 9:67384956-67384978 TTTTGTTTTGATAAGGAGTCTGG + Intergenic
1055263184 9:74463802-74463824 CTGTGTGATGAGATGAAGTGAGG + Intergenic
1055754469 9:79543146-79543168 CTGGGTCATCAAAAGGAGTCGGG + Intergenic
1056207531 9:84334760-84334782 TTGTGTTATGAGCGGGAGTTAGG - Intronic
1056528518 9:87466689-87466711 CTTTTTTTTGAGACGGAGTCTGG + Intergenic
1056801620 9:89696164-89696186 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1058001461 9:99870192-99870214 CTGTGTTCTGGGAAGGAATGGGG - Intergenic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1058434755 9:104952129-104952151 TTTTTTTCTGAGAAGGAGTCTGG + Intergenic
1060069548 9:120534206-120534228 CTGTGTTCTGGAAAGGAGTGGGG - Intronic
1060644218 9:125264204-125264226 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1060940997 9:127542732-127542754 TTTTGTTTTGAGACGGAGTCTGG + Intronic
1060963159 9:127695713-127695735 CTGTTTTAAAAGAAGGGGTCGGG - Intronic
1061029251 9:128069761-128069783 GTTTGTTTTGAGACGGAGTCTGG + Intronic
1061111781 9:128577588-128577610 CTGTGTTCTGTGAAAGTGTCAGG + Intronic
1061764220 9:132871232-132871254 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1185511707 X:668572-668594 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1185656499 X:1689776-1689798 TTATTTTTTGAGAAGGAGTCTGG + Intergenic
1185789598 X:2918726-2918748 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1187383144 X:18823614-18823636 TTTTTTTTTGAGAAGGAGTCTGG - Intronic
1187607963 X:20906675-20906697 CTGTGTCATGAGAAGAAGCCTGG + Intergenic
1188159641 X:26784050-26784072 CGGTGTTATCAGAAGGCTTCCGG - Intergenic
1189709761 X:43797165-43797187 CTGTGGTATGTGAAGCAGTGTGG - Exonic
1190390738 X:49928911-49928933 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1190711935 X:53077731-53077753 CTGTGTCATGTGAAGCAGGCTGG + Exonic
1190773849 X:53537062-53537084 CTGTGTAATCACAAGAAGTCAGG - Intronic
1190872700 X:54437915-54437937 GTTTGTTTTGAGATGGAGTCTGG - Intergenic
1191997498 X:67111911-67111933 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1193095504 X:77544005-77544027 ATGTGTTATGAGATGGTGTTAGG + Intronic
1193192087 X:78582736-78582758 CTGTGTAATGAGCAGAAGTTGGG + Intergenic
1194684390 X:96895013-96895035 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1194817702 X:98464532-98464554 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1195697534 X:107677973-107677995 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1195787039 X:108537275-108537297 CTAGGTTATGAGAATGACTCTGG - Intronic
1197975109 X:132158633-132158655 CTTTGTTATCAGAATGAGGCTGG + Intergenic
1198873432 X:141199114-141199136 CTGTTTTAAAAGAAGGGGTCGGG + Intergenic
1200242771 X:154506561-154506583 CAGTGTTACGAAAAGGAGGCGGG + Exonic
1200940138 Y:8772426-8772448 CTGCGGTATGAGAAGCAGGCCGG - Intergenic