ID: 1142523047

View in Genome Browser
Species Human (GRCh38)
Location 17:518546-518568
Sequence CGTCTTCCAAGTGAACTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142523043_1142523047 11 Left 1142523043 17:518512-518534 CCCATGGCTTCATCTGATGAGAA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1142523047 17:518546-518568 CGTCTTCCAAGTGAACTTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1142523044_1142523047 10 Left 1142523044 17:518513-518535 CCATGGCTTCATCTGATGAGAAA 0: 1
1: 0
2: 1
3: 26
4: 224
Right 1142523047 17:518546-518568 CGTCTTCCAAGTGAACTTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1142523042_1142523047 21 Left 1142523042 17:518502-518524 CCTGGGCGTTCCCATGGCTTCAT 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1142523047 17:518546-518568 CGTCTTCCAAGTGAACTTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142523047 Original CRISPR CGTCTTCCAAGTGAACTTCC TGG Exonic
907666503 1:56437719-56437741 TGTCACCCAAGTGAATTTCCAGG - Intergenic
914006969 1:143740534-143740556 CATTTTCCAGGTTAACTTCCTGG - Intergenic
914645789 1:149651024-149651046 CATTTTCCAGGTTAACTTCCTGG - Intergenic
916450663 1:164917442-164917464 CTTCTGCCAAGTGAATTGCCAGG + Intergenic
918719731 1:187837901-187837923 CGTCTTCTATGAGAGCTTCCAGG + Intergenic
918756809 1:188348285-188348307 AGACTTCCAAGAGAAGTTCCTGG + Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1063552091 10:7043023-7043045 GGTCTTCTAGGTGAACTTCAGGG + Intergenic
1067158707 10:43804140-43804162 CGTTTTCCAGGTGAGTTTCCAGG - Intergenic
1069887552 10:71633626-71633648 CCTCTTCCAAGGGAGCTGCCCGG - Intronic
1070954647 10:80455685-80455707 CGTCTTTCCAGGGATCTTCCTGG + Intronic
1076490854 10:130860345-130860367 CCTCTTCCAAGAAGACTTCCCGG + Intergenic
1086651770 11:89300413-89300435 CATCTACCTTGTGAACTTCCAGG - Intergenic
1088750821 11:112841030-112841052 ATTCCTCCAAATGAACTTCCTGG - Intergenic
1105773151 13:23632073-23632095 CCTTTTCCAAGAGGACTTCCTGG + Intronic
1106660696 13:31796744-31796766 CCTCTTCCACGGGCACTTCCAGG - Intronic
1108145349 13:47471042-47471064 CATTTTCCAAGTTGACTTCCTGG - Intergenic
1111157209 13:84343608-84343630 CATTTTCCTTGTGAACTTCCTGG + Intergenic
1111609204 13:90581460-90581482 CCTCTTCTTAGTGAACTTCCTGG + Intergenic
1114491073 14:23102346-23102368 CTTCTTCCAAGGGAACACCCAGG + Intergenic
1120939633 14:89934930-89934952 AGGCTTCCTAGTCAACTTCCTGG + Intronic
1123735335 15:23178347-23178369 CTTCTTACTAGGGAACTTCCAGG - Intergenic
1124285841 15:28399646-28399668 CTTCTTACTAGGGAACTTCCAGG - Intergenic
1124296861 15:28512018-28512040 CTTCTTACTAGGGAACTTCCAGG + Intergenic
1128690958 15:69724612-69724634 CCTCTTCTAAGTGAAGTTCTGGG + Intergenic
1129050154 15:72774429-72774451 CTTATTCCACGTGAACCTCCAGG + Intronic
1134049298 16:11125859-11125881 CGTCTCCCAAGTGATGTGCCTGG + Intronic
1135341894 16:21655469-21655491 CCTCTTCCAAGGGCACATCCCGG - Exonic
1136404527 16:30036486-30036508 TGTCTTCCAAGGGACCTTCTCGG + Intronic
1137700693 16:50495755-50495777 CGTCTGCCAGCTGCACTTCCAGG + Intergenic
1141181477 16:81755922-81755944 CGTCTTCCAGATGGACTTCGTGG - Intronic
1142523047 17:518546-518568 CGTCTTCCAAGTGAACTTCCTGG + Exonic
1142559051 17:799155-799177 GGTCATCCAAATGAGCTTCCTGG + Intergenic
1149250357 17:54761088-54761110 CCTCCTCTAAGTCAACTTCCAGG - Intergenic
1150007616 17:61479492-61479514 CATCTTCCCAGTGAGCATCCCGG - Intronic
1155628243 18:27861256-27861278 TGTCTCTCAAGTGAACTCCCTGG + Intergenic
1161016758 19:1987165-1987187 CGACTACCAAGTGAACATCCAGG - Exonic
1161028045 19:2045688-2045710 CGTGTTCCAAGAAATCTTCCAGG - Intronic
1163884653 19:19955164-19955186 CCTCTTCAAAGACAACTTCCTGG - Intergenic
1164510072 19:28889508-28889530 TGTCTTCCAAGGGGACTCCCTGG + Intergenic
925054760 2:848965-848987 CTTAATCCATGTGAACTTCCCGG - Intergenic
928036726 2:27831076-27831098 CGTCTTCCAACTGAAGCCCCAGG + Intronic
930053895 2:47237454-47237476 CGTTTCCCAAGTGTCCTTCCAGG - Intergenic
942040100 2:172052417-172052439 GGTCTTCCAATTGAACTTACAGG - Intronic
945185461 2:207135165-207135187 CATCTACCAGCTGAACTTCCAGG + Intronic
947358843 2:229325867-229325889 TGTATTTCAAGTGAATTTCCAGG - Intergenic
1173227749 20:41171896-41171918 CATGTTCCCAGTGACCTTCCAGG - Intronic
1174056689 20:47803095-47803117 AGTCTTCCATGTGCACATCCAGG + Intergenic
1179515232 21:41901793-41901815 AGACTTCCATGGGAACTTCCAGG + Intronic
950809763 3:15640150-15640172 AGTCTTACAAGTGAAATTACTGG - Intronic
952289455 3:32001242-32001264 TGTGTCCCAAGAGAACTTCCCGG + Intronic
955896677 3:63707748-63707770 CATTTTCCAAGTGAACTGTCAGG - Intergenic
968503822 4:962984-963006 CCTCTTCCAAGTGCCCGTCCTGG + Intronic
970250280 4:14107762-14107784 CCTCTTCCCAGTGAAAATCCTGG + Intergenic
975712008 4:77170307-77170329 GTTCTTCCAAGAGAAATTCCAGG + Intronic
986456960 5:7929023-7929045 AACTTTCCAAGTGAACTTCCAGG + Intergenic
986942659 5:12974102-12974124 AGGCTTCCAAGTGAATTTCAAGG - Intergenic
987129778 5:14849851-14849873 GGTCTTCCATGTGGACTTTCAGG + Intronic
990745907 5:58959218-58959240 AGTCACCCAAGGGAACTTCCTGG + Intergenic
1000347979 5:160330563-160330585 TGTCTTCAAAGTGCACCTCCTGG + Intronic
1002864511 6:1109029-1109051 TGACTCCCAAGTGAGCTTCCTGG - Intergenic
1004732173 6:18368455-18368477 CGTCTTCAGCGTGATCTTCCGGG + Intergenic
1006732544 6:36247099-36247121 CCTCTCCCCAGTGATCTTCCAGG + Intronic
1006796363 6:36734862-36734884 AGACTTCAGAGTGAACTTCCAGG + Intergenic
1008577351 6:52873927-52873949 GGTCTCCAAAGTGAGCTTCCAGG - Intronic
1012440441 6:99257330-99257352 TCTCTTGGAAGTGAACTTCCAGG - Intergenic
1013667838 6:112366538-112366560 CAGCTTCCAAGGCAACTTCCGGG + Intergenic
1024555059 7:50596587-50596609 CGTCGTCAATGTTAACTTCCTGG + Intronic
1026611126 7:71860785-71860807 AGTCTTCAGAGTAAACTTCCAGG + Intronic
1029863234 7:103597978-103598000 CGACTTTTAATTGAACTTCCTGG - Intronic
1032019828 7:128401075-128401097 CGTCTTCAGCGTGATCTTCCGGG + Exonic
1033494573 7:141881132-141881154 CTCCTTCCAAGTCAACTGCCTGG - Intergenic
1044349114 8:91142690-91142712 GGTTTTCCAAGTGTAGTTCCTGG - Intronic
1046090826 8:109501027-109501049 AGTTTCCCAAGTGAACTTCCAGG + Intronic
1047275242 8:123400742-123400764 CGTCTTCAGCGTGATCTTCCAGG - Intronic
1047902857 8:129442787-129442809 TGTCTTTCAAGTGAAGGTCCTGG - Intergenic
1048588878 8:135802726-135802748 CTTCAGTCAAGTGAACTTCCTGG + Intergenic
1049000376 8:139822246-139822268 CGTCTTCCAGGTCTGCTTCCTGG - Intronic
1051665393 9:19463565-19463587 TTTCTTCCAAGTGAACCCCCAGG - Intergenic
1059919016 9:119136926-119136948 TGTCTTCCCAGTGGACTTCCTGG + Intergenic
1061802081 9:133118167-133118189 GGTCTTCCAGGAGAGCTTCCTGG - Intronic
1062426715 9:136509413-136509435 CGTTTACCAAATGAGCTTCCTGG + Intronic
1188448598 X:30284679-30284701 CTTCATCCAGGTGAACATCCAGG + Intergenic
1189362085 X:40360538-40360560 CGTCTTCAGCGTGATCTTCCGGG + Intergenic
1195144314 X:101998206-101998228 TGTCTTCCATGTGAGCTTCAGGG + Intergenic
1196819139 X:119689098-119689120 ATTCTCCCAAGTGAACTTTCAGG - Intronic