ID: 1142523579

View in Genome Browser
Species Human (GRCh38)
Location 17:521909-521931
Sequence ACCTAGGAGAAACAACATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142523579 Original CRISPR ACCTAGGAGAAACAACATCA AGG Intronic
902158251 1:14507613-14507635 ACCTAGCAGAATCAATATGAAGG + Intergenic
905714458 1:40136113-40136135 AACTAGTAGAAACTACATCATGG - Intergenic
907019103 1:51047802-51047824 ACTTATGAGAAAGAAAATCATGG - Intergenic
909913624 1:81291082-81291104 GCCTAGGACAAAGAAAATCAGGG - Intergenic
909966250 1:81914536-81914558 ACCTGGGATAAATAACATAAGGG - Intronic
911165416 1:94720365-94720387 ATCCAGGAGAAGTAACATCATGG - Intergenic
913235932 1:116783297-116783319 AACTAGGAAAAAGAACATGAGGG + Intergenic
914953167 1:152137081-152137103 ACCTAGGAGCAACATCATCAGGG - Intergenic
917917792 1:179721831-179721853 TCCAAGGACAATCAACATCAAGG + Intergenic
921664244 1:217848483-217848505 ACACAGAAGAAACATCATCATGG - Intronic
1063543291 10:6955891-6955913 ACCTGGGAGAAAGAAGATCTGGG - Intergenic
1064593558 10:16920093-16920115 ACCCAGCAGAATCAGCATCATGG + Exonic
1064889554 10:20154624-20154646 TCCTAGGATAGACAGCATCAAGG - Intronic
1067004338 10:42646820-42646842 GCCCAGGAGAAAGAACAGCAAGG + Intergenic
1068808649 10:61229153-61229175 AAGTAGAAAAAACAACATCAGGG + Intergenic
1070537025 10:77386873-77386895 AGCTAAGAGAAAGAACATTAAGG + Intronic
1070852606 10:79579504-79579526 ACCTAGGCGTAACAACAAAACGG + Intergenic
1071020510 10:81049048-81049070 AATTAGCAGAAACAACATCTGGG - Intergenic
1071317385 10:84415623-84415645 ATTTAGGAGAAACAGGATCAGGG + Intronic
1072243193 10:93516914-93516936 ACCTATGACAAACAACATTACGG - Exonic
1074583393 10:114743154-114743176 AACTAGGAAAAGCAACTTCAAGG + Intergenic
1077989890 11:7396578-7396600 ACCCAAGTGAAATAACATCATGG - Intronic
1079312863 11:19381712-19381734 ACCAAAGAGAAATAACGTCAGGG + Intronic
1079323576 11:19472701-19472723 GCCTTGGGGAAACAGCATCAAGG - Intronic
1079582138 11:22078988-22079010 ACCTCAGACAAACAAGATCATGG - Intergenic
1080322352 11:31026313-31026335 ACATAGCAGAAACTACATAATGG + Intronic
1080407774 11:31995072-31995094 ACCCAGAAGAATCAACATGATGG - Intronic
1082190159 11:49233321-49233343 AACAAGGAAAAACAACATGATGG - Intergenic
1086552068 11:88064061-88064083 AACTAGAAGGAACAACAACAGGG + Intergenic
1086602929 11:88657734-88657756 ACCTAGGAAAAAAAATAGCAGGG - Intronic
1086675968 11:89607591-89607613 AACAAGGAAAAACAACATGACGG + Intergenic
1089836105 11:121372029-121372051 ACATAGGAGAAATAAAAGCAAGG + Intergenic
1091551599 12:1539247-1539269 ATTTAGGAGAAACAAAAACAAGG - Intronic
1093195949 12:16129733-16129755 GCCTTTGAGAGACAACATCAAGG - Intergenic
1093667786 12:21834923-21834945 AACTAGCAGTCACAACATCAAGG + Intronic
1093774010 12:23051403-23051425 ACCCAGGAAAAACACTATCAGGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094467552 12:30769703-30769725 ATCTAAGAGAAAGAACATGAAGG - Intergenic
1096884816 12:54706639-54706661 GCCTCGGAGAAATAACATAAAGG - Intergenic
1098357070 12:69621971-69621993 ACCAAGGAGAGACAACGTCAAGG - Intergenic
1103727808 12:123007427-123007449 ACCTGGGAGAAGCAATCTCAGGG + Intronic
1103861823 12:124021533-124021555 ACCTAACTGAAACAAAATCATGG - Intronic
1109737116 13:66500401-66500423 ACCTAGGGGACATAATATCAAGG + Intronic
1109989945 13:70041534-70041556 ACCTAGTAGAAACAAAAATAGGG - Intronic
1110374282 13:74774986-74775008 ACCTAGGAGAAACATTGTCTCGG + Intergenic
1111653108 13:91117428-91117450 TCCTAGGAGGAACAAAAGCAAGG + Intergenic
1115783615 14:36799403-36799425 ACATATGAGAAACACCACCATGG - Intronic
1117556122 14:56886017-56886039 ACCAAGGACAAACAGCCTCATGG - Intergenic
1118695611 14:68382046-68382068 ACCTAGGAAGAACAAGAACAGGG + Intronic
1119629578 14:76216169-76216191 ACCAAGCAGAAATAACAGCAAGG + Intronic
1124079374 15:26476988-26477010 ACCTACCAGAAACCCCATCACGG - Intergenic
1124631983 15:31343247-31343269 TCCTGGGAGAAACAGCAGCAAGG + Intronic
1126290203 15:47066716-47066738 ACGTAGTAGAATCAACATAAAGG - Intergenic
1126710100 15:51445781-51445803 TCCTAGGATAAACACTATCATGG - Intergenic
1127172736 15:56320558-56320580 CCTTAGAAGAAACAACACCAGGG - Intronic
1127680649 15:61294061-61294083 ACCTATGAGGAACAACATCCAGG + Intergenic
1128896854 15:71382190-71382212 ACCTAAGAAAGACAACATGAAGG + Intronic
1129456360 15:75677885-75677907 ACCTAGGGGAGACACCATCGTGG + Exonic
1132735857 16:1385543-1385565 ACCGAGGAGAAACACCAGGACGG + Intronic
1134268741 16:12715326-12715348 ATCAAGGAGAAATAAGATCAAGG + Intronic
1134534640 16:15016108-15016130 TCCTAGGATAAAACACATCAGGG - Exonic
1136630299 16:31485976-31485998 ACCTAGGAGAAACCACTGCGAGG + Intronic
1139068044 16:63343446-63343468 CTCTAGGAGGAAAAACATCACGG - Intergenic
1139340766 16:66266662-66266684 ACCAAGGAGAAACAAAAGAAAGG - Intergenic
1141008114 16:80372165-80372187 ACCTATGAGATCCAGCATCAGGG - Intergenic
1141893062 16:86940460-86940482 ACCAAGGAGACAGAACACCACGG + Intergenic
1142066080 16:88063728-88063750 TGCTGGCAGAAACAACATCACGG - Intronic
1142431181 16:90028517-90028539 AACAAGGAGTAACAGCATCAGGG + Intronic
1142523579 17:521909-521931 ACCTAGGAGAAACAACATCAAGG + Intronic
1144347768 17:14365561-14365583 ACAAAGGAGAAACAAAATCCTGG - Intergenic
1144458667 17:15439854-15439876 ACCTAGGAGTGAGAACATAACGG - Intronic
1147488263 17:40839798-40839820 ACCTAAGTGTAACAAAATCATGG - Intergenic
1147616617 17:41832565-41832587 ACCTAGAAGAGGCAACTTCATGG + Intronic
1148882326 17:50738979-50739001 ACATTGGAGAAACATCCTCAGGG + Intronic
1152090555 17:78244436-78244458 AGCTATGAGAAACCACAGCATGG - Intergenic
1153174539 18:2356228-2356250 ACATAGGAGAGAGAACATTAGGG - Intergenic
1153522525 18:5966159-5966181 ACTTAACAGAAACAAAATCACGG - Intronic
1155643145 18:28044333-28044355 ACCTTGGAGAAACAATGTAAGGG - Intronic
1156378343 18:36534198-36534220 ACATAGGAGAAGCAGCAGCAGGG - Intronic
1163745014 19:19041258-19041280 ACCTAAGAGAAAACACATGATGG + Intronic
1164311782 19:24052250-24052272 ACCTAGGTGATACAACTTTATGG + Intronic
1164874070 19:31670911-31670933 ACCTAGGATAAAGAAATTCACGG - Intergenic
1166016693 19:39985734-39985756 ACCTAGAATAACCAACATAAGGG + Intronic
1167103487 19:47418108-47418130 ACCCAAGAGAAACACCATTATGG + Intronic
1167123327 19:47532052-47532074 ACCTAGGAGGAAAAACACCCTGG + Intronic
1168125853 19:54282333-54282355 ACCCAGCAGAGACAACGTCAGGG - Intergenic
925893060 2:8451666-8451688 ACCTAGGAGAAATGCCACCATGG + Intergenic
927411285 2:22829211-22829233 ACCCAGGAGAAAGATGATCATGG - Intergenic
933485958 2:82923918-82923940 TCATAGGAGAAAGAAGATCAAGG - Intergenic
935799950 2:106685857-106685879 ACAAAGGAGTAACTACATCAAGG + Intergenic
935984038 2:108655002-108655024 AGCCAGGAGAAACAATATCCAGG - Exonic
936136474 2:109898656-109898678 AGCCAGGAGAAACAATATCCAGG - Intergenic
936208223 2:110472829-110472851 AGCCAGGAGAAACAATATCCAGG + Exonic
938171131 2:129077950-129077972 GCCTAGGAGGAACAACAATAAGG - Intergenic
939483121 2:142774422-142774444 ACCTAAAATAAACAACATAATGG - Intergenic
940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG + Intronic
940186926 2:150996212-150996234 ACCTAGGATAGACAAAGTCATGG + Intergenic
941909537 2:170750040-170750062 ACTTGGAAGAAACTACATCAAGG + Intergenic
942325408 2:174772282-174772304 CCCTGGAAGAAACAACACCAAGG - Intergenic
945526962 2:210900022-210900044 ACACAGGAGATACTACATCAGGG - Intergenic
945973954 2:216256507-216256529 ACCAAAGAAAAACAACATCATGG + Intergenic
947529908 2:230902294-230902316 AGCTTGGAGAAACAGCAGCAGGG - Intergenic
1169634761 20:7676884-7676906 AAGAAGGATAAACAACATCAAGG + Intergenic
1170076172 20:12421634-12421656 CCATAGGAGAAAGAACATAATGG - Intergenic
1170104025 20:12734330-12734352 ATCTAAGAGAATCAATATCATGG + Intergenic
1178028912 21:28502431-28502453 AACTAAGAGAATCAATATCAAGG - Intergenic
1181479493 22:23189369-23189391 ATCTAGGAGAGGCAAAATCATGG - Intronic
949859177 3:8490240-8490262 AGCTAGGAGAATCAACAGGAAGG + Intergenic
950164574 3:10784420-10784442 AACAAGGAGAAACCACAGCAGGG + Intergenic
951263459 3:20539724-20539746 GCCAAGGAGAAGCAACATCTTGG - Intergenic
953740385 3:45533604-45533626 TCCTGGGAGAAACAAAATGAAGG - Intronic
954773769 3:52998503-52998525 ACCTAGGGGAACCACCATGATGG - Intronic
958471088 3:94521159-94521181 TCCTAGGAGAAGGAACATTAAGG - Intergenic
963422758 3:145081969-145081991 AACTAGTAAACACAACATCAAGG - Intergenic
964630979 3:158809999-158810021 ACCTAGCGGGAACAACATTATGG + Intronic
964888717 3:161514401-161514423 AACTATCAGGAACAACATCACGG + Intergenic
965540143 3:169863701-169863723 ATTTAGGAAAAACAACAACAGGG + Intronic
966669178 3:182507614-182507636 ACCGAGGAGAAACAAGTTCTAGG - Intergenic
969464000 4:7344028-7344050 GCCAAGGAGAAAGAACATCTTGG - Intronic
970570081 4:17371532-17371554 ACATAGGAGAAAAATAATCATGG - Intergenic
974351948 4:60759789-60759811 GCCTAGAAGCAACAACATCCTGG + Intergenic
977695092 4:99956207-99956229 CTCTAGAAGATACAACATCAAGG - Intergenic
979112226 4:116774375-116774397 AAGTAGGAGAAACAGCATCTTGG - Intergenic
979508261 4:121522671-121522693 ACCTAGGAGAAGCAAGATCTAGG - Intergenic
981114059 4:140969206-140969228 GCCTAAGTGAAACACCATCAAGG - Intronic
982970793 4:161983098-161983120 AACCAGGAGAAAAAACACCATGG + Intronic
983075851 4:163325722-163325744 AAAAAGGAGAAACAACATGATGG - Exonic
985078441 4:186241759-186241781 AATTAGGGGAAGCAACATCATGG + Intronic
986136124 5:4980111-4980133 ACCTAGGAGAAATACCATTCTGG - Intergenic
988148786 5:27348148-27348170 TCCTAGGAGAAAGAAAATAAGGG + Intergenic
988496438 5:31749934-31749956 CCCAAAGATAAACAACATCATGG - Intronic
988861850 5:35289462-35289484 AACTAGGAGAAAAAAGAGCATGG - Intergenic
989183699 5:38602882-38602904 ACCTGGGAAAAACAACTTCCTGG + Intronic
990761068 5:59129942-59129964 ACATAGGAGAAACTCAATCAAGG + Intronic
990867643 5:60397694-60397716 AGCTAGGAGAAATAAGTTCAAGG + Intronic
991355074 5:65760443-65760465 ACCAAGGACAAACCACATCCAGG - Intronic
993845169 5:92932755-92932777 ACCTAGGATAAACAGCCTTAAGG + Intergenic
994300627 5:98142790-98142812 ACTAGGCAGAAACAACATCAAGG - Intergenic
998767845 5:145507960-145507982 AACTAGGAGAACTAACATTAGGG - Intronic
1000039410 5:157474015-157474037 ACTTAGGAGAAACGAGCTCAGGG + Exonic
1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG + Intergenic
1000848133 5:166306571-166306593 GCCTAGGTGAAACAAAATAATGG - Intergenic
1001902373 5:175443102-175443124 TCCTAAGAGAAAGCACATCAGGG + Exonic
1003323091 6:5070166-5070188 ACCTAGGAGACAGAACACCTGGG - Intergenic
1003929258 6:10907823-10907845 ACTTAGGAGAAACAATTTGAGGG + Intronic
1004227192 6:13796819-13796841 ACCTGGGAAAAACTACATCAAGG - Intronic
1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG + Intergenic
1006740084 6:36301840-36301862 ATCTAGGATAAACAATAGCATGG - Exonic
1008882835 6:56398996-56399018 AGCTAGGAGAAACAAAGTCAGGG - Intergenic
1008887972 6:56451665-56451687 GCCTATGAGAAACAAAATCTTGG + Intergenic
1010077264 6:71814269-71814291 ACCTAGCTGAAAAAAAATCAAGG + Intergenic
1010392383 6:75352526-75352548 ACCTACAAGAATAAACATCAAGG + Intronic
1010454359 6:76038222-76038244 TGGTAGGAGAAAGAACATCAGGG - Intronic
1013027011 6:106285315-106285337 ACCTAAGAGAATCCACATCTTGG - Intronic
1013866512 6:114704193-114704215 GACTAGGAGAGACAACATCATGG - Intergenic
1014100066 6:117501947-117501969 ACAAAGGAGAAAAAACACCAAGG - Intronic
1015024213 6:128513934-128513956 ACCTAAGAAAAATCACATCAAGG + Intronic
1015985399 6:138879590-138879612 ACATAGCACACACAACATCAGGG + Intronic
1018212648 6:161497027-161497049 CCCTAGGAGCAAATACATCAAGG + Intronic
1018382964 6:163276391-163276413 ACCTAGTGGAAACAAAATGAAGG - Intronic
1018399937 6:163412593-163412615 ACCTAGAAAAATCAAAATCAAGG - Intergenic
1018689402 6:166332873-166332895 TCCTAGCAGCAACAACATGAAGG + Intronic
1019199673 6:170304399-170304421 ACCTAGGAAGACCAACACCAAGG - Intronic
1022408634 7:30118383-30118405 AACTACGAGAAGCAACATGAGGG + Intronic
1022565165 7:31392131-31392153 ACTTAGGCTAAACAAGATCAGGG - Intergenic
1024561809 7:50650843-50650865 TCCTGGGAGAAAAAAAATCAAGG + Intronic
1026446438 7:70488520-70488542 ACTGAGGAGAAAGAACACCAGGG - Intronic
1027521137 7:79209604-79209626 AACTAGGACAGCCAACATCAAGG + Intronic
1029698648 7:102231436-102231458 ACCCAGTAAAACCAACATCAAGG - Intronic
1032734393 7:134677660-134677682 ACCTAGGTGAAACAAGTTCAGGG - Intronic
1034397198 7:150836160-150836182 AACCAGGAGAAGCAGCATCATGG + Intronic
1036471172 8:9054124-9054146 ACCATGGAAAAGCAACATCAGGG + Intronic
1037893329 8:22635793-22635815 GCCTTGGAGAAAGAACCTCAAGG + Intronic
1039853213 8:41389984-41390006 ACCTACAAGCAACAACACCATGG + Intergenic
1041183297 8:55271351-55271373 CCCTAGGGGAAATAAAATCATGG + Intronic
1043752756 8:83961011-83961033 ACCTAGGAGAATCCTCCTCAGGG + Intergenic
1050396726 9:5205662-5205684 ACCTAGAGGAAGCAACATAAGGG + Intergenic
1051822031 9:21180336-21180358 ACTGAGGAGAAGCAGCATCAGGG - Intergenic
1051823256 9:21192398-21192420 ACTGAGGAGAAGCAGCATCAGGG - Intergenic
1051825077 9:21210934-21210956 ACTGAGGAGAAGCAGCATCAGGG - Intronic
1051827066 9:21232997-21233019 ACTGAGGAGAAACAGTATCAGGG - Intronic
1056250884 9:84746771-84746793 ACCTAGCTGAAGCCACATCATGG - Intronic
1057561061 9:96128192-96128214 TCCAACGAGAAACAACAGCAGGG - Intergenic
1057604807 9:96491576-96491598 ACCTAGCCGGTACAACATCAGGG + Intronic
1058494199 9:105537192-105537214 AACTTGGAGAAAAAACATCTAGG - Intronic
1059023249 9:110598670-110598692 ACATAGGAGGAACAGGATCAAGG + Intergenic
1059620525 9:116000012-116000034 AGCTAGAAGAAAGAACATAAAGG + Intergenic
1185919882 X:4079065-4079087 ACCTGGGAAAGACACCATCATGG - Intergenic
1186604442 X:11075827-11075849 ACCTAGGAGCAACAGCATTCTGG + Intergenic
1186752142 X:12632214-12632236 ATCTGGGAGAGACAAGATCATGG + Intronic
1187061009 X:15787248-15787270 CCCTAGGAGGGACAACAACAAGG + Exonic
1188105157 X:26140159-26140181 ACCTAGGGGAAACAAAAAGATGG - Exonic
1188810415 X:34647607-34647629 ACTTAGGAGTAAAAACATTAAGG + Intronic
1197747626 X:129942862-129942884 ATGTAGGTGAAACAAAATCAGGG - Intergenic
1201361809 Y:13159649-13159671 ACCTAGAAGAAATAAATTCAAGG + Intergenic