ID: 1142525163

View in Genome Browser
Species Human (GRCh38)
Location 17:535059-535081
Sequence GCTTCTCTGGGCCATCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142525152_1142525163 21 Left 1142525152 17:535015-535037 CCTGTGGGGAAAAAACCAAGCAA 0: 1
1: 0
2: 1
3: 23
4: 316
Right 1142525163 17:535059-535081 GCTTCTCTGGGCCATCAGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 219
1142525155_1142525163 6 Left 1142525155 17:535030-535052 CCAAGCAATGTGCTGGGTAACTG 0: 1
1: 0
2: 3
3: 18
4: 241
Right 1142525163 17:535059-535081 GCTTCTCTGGGCCATCAGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142525163 Original CRISPR GCTTCTCTGGGCCATCAGGG CGG Intronic
901850833 1:12014200-12014222 GCCTCTGTGGGCGAGCAGGGCGG - Intergenic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
903304380 1:22402397-22402419 ACTTCTCTGGGCACTCAAGGTGG - Intergenic
903545177 1:24119464-24119486 GCCTCTGTGGGGGATCAGGGAGG + Intergenic
904748919 1:32728735-32728757 GCTTCTCTAGGGCAGCACGGAGG + Intergenic
905425730 1:37882744-37882766 GCTTTTCTGTGCCCTCATGGTGG + Intronic
905938633 1:41844883-41844905 GCTTCTTTGGGTCCTGAGGGAGG + Intronic
906294541 1:44641358-44641380 GGTACTCTGGGCCATCTTGGAGG + Intronic
908196042 1:61746363-61746385 AATTCTCTGGGCCAGAAGGGTGG - Intronic
911068772 1:93815197-93815219 GCAGCTCTGGGCCACCTGGGAGG - Intronic
911578852 1:99612006-99612028 GTTTATCTGGGCCATTAGAGAGG - Intergenic
913399945 1:118420902-118420924 CCTCCTCTGGGCCTTCAGGGAGG + Intergenic
915483038 1:156200203-156200225 GATGCTCTGGGCCACAAGGGAGG - Exonic
915493213 1:156263293-156263315 TCTTGCCTTGGCCATCAGGGGGG + Intronic
915877353 1:159625679-159625701 GCTTCTCTGGCCCATATGGGTGG - Intergenic
917978792 1:180256662-180256684 GCTGCACTGGGCCATCCGTGGGG + Intronic
920008727 1:202852477-202852499 CCCTCTCTTGGCCATCAGGCGGG + Intergenic
920364195 1:205439547-205439569 GCCTCTCTGGGCAACTAGGGAGG - Intronic
920946064 1:210529614-210529636 GCTTCTCAGGGACATCAAAGGGG + Intronic
921179244 1:212618781-212618803 GCTTTTGTGGGCAAGCAGGGTGG + Intronic
921976386 1:221207490-221207512 TCTTTTCAGGGCCATCAGGCAGG - Intergenic
922337733 1:224631394-224631416 GCTTCTCTGGGCAACCTGGCTGG + Intronic
922603429 1:226873946-226873968 GCTTCTCTGGGGCAAAAGGGAGG - Intronic
922722399 1:227905628-227905650 GCCTCTCTGGGCCTTCAGGTGGG + Intergenic
923777067 1:236988848-236988870 TCTTCTCTTTGCCATCAGGAAGG + Intergenic
923897181 1:238284678-238284700 GCTTCGGTAGGCCCTCAGGGTGG + Intergenic
1062905817 10:1178813-1178835 GCTTCCCGCGGCCCTCAGGGAGG - Exonic
1067915729 10:50396185-50396207 GCTTCTCTGAGCCCTCAGGGTGG + Intronic
1070537589 10:77391258-77391280 CCTTCCCTGGGGCATCAAGGGGG - Intronic
1070603617 10:77882978-77883000 AAATCTCTGGGCCCTCAGGGTGG + Intronic
1071869866 10:89781791-89781813 GCTTCTCTGGGCACTGAGGAAGG - Intergenic
1074081079 10:110168635-110168657 GTATCTCTGGGGCATCAGGGCGG + Intergenic
1074576011 10:114670060-114670082 CCTTCTGTGGGCCTTCAAGGAGG - Intronic
1075093688 10:119457479-119457501 TCTCCTCTGGGCACTCAGGGAGG - Intronic
1076674962 10:132142855-132142877 GCATCTCTGGCCCTGCAGGGTGG - Intronic
1076839078 10:133036754-133036776 GGTTCTCTTGGCCATGAAGGGGG - Intergenic
1076859494 10:133133919-133133941 GCTCCTCTGGGCCTGGAGGGAGG + Intergenic
1076861396 10:133139860-133139882 GCTGCTCTGGGCCTTCTGCGGGG + Intergenic
1081489186 11:43554240-43554262 TCTTCTCTGGGGCTTCAGGGAGG - Intergenic
1083205360 11:61145545-61145567 GCTCCTCAGAGCCATCAGCGAGG + Intronic
1084939720 11:72606083-72606105 GCTGCTCTGGGCCCTTGGGGAGG - Intronic
1085850836 11:80117812-80117834 GCTTCACAGGGTCATCAGGAAGG + Intergenic
1088718746 11:112573467-112573489 GGGTCTCTGGGCCATAGGGGTGG - Intergenic
1089381589 11:118036645-118036667 ACTTGTGTGAGCCATCAGGGAGG + Intergenic
1091603292 12:1930598-1930620 GCTCCACTGGGCCCTCAGAGTGG + Intergenic
1092889182 12:12952911-12952933 GTTTCACTGGGCCATAAGGAAGG + Intergenic
1096827714 12:54292553-54292575 GCTTCTCAGGGCCCGCGGGGAGG - Exonic
1097901464 12:64877678-64877700 GGGTCTCTGGGCCCTGAGGGTGG - Intronic
1098216810 12:68229102-68229124 GCTACACTGGGCCATCAGAGAGG - Intergenic
1098385165 12:69910611-69910633 GAGACTCTGGGCCAACAGGGGGG - Intronic
1099613981 12:84912293-84912315 GCATCTCTGTACAATCAGGGTGG - Intronic
1101272447 12:103162042-103162064 GCTGCTCTGGGGCATTAGGAGGG - Intronic
1101822594 12:108195582-108195604 GCTTCTTTGGGCCAACAAGGGGG - Exonic
1102284303 12:111643137-111643159 GCTTGTGTGGGCCAACAGAGGGG - Exonic
1103402396 12:120651876-120651898 GCTTCTCTGGGACAGCGCGGAGG - Intronic
1104311862 12:127660518-127660540 GCATCTCTGGAGCATAAGGGAGG + Intergenic
1104369895 12:128215254-128215276 GCTTCCCTGGGTCCTCAGGCTGG - Intergenic
1105635677 13:22213073-22213095 GCTTCTCTGTGACTTCCGGGAGG + Intergenic
1105835514 13:24207781-24207803 GCTATCCTGAGCCATCAGGGAGG + Intronic
1107869585 13:44734717-44734739 GCCTGTCTAGGCCATCAGGGTGG - Intergenic
1112369739 13:98784335-98784357 GCTTCTGAGGGCCATGAGGAAGG + Intergenic
1113225449 13:108154418-108154440 GCAGCTGTGGGCCAACAGGGAGG - Intergenic
1115906149 14:38205412-38205434 GCATTTCTGGGCCACCAGGAAGG - Intergenic
1117536263 14:56705845-56705867 GCTTCTCATGGACAGCAGGGTGG - Intronic
1118091529 14:62485622-62485644 GATTCCCTGGGCCATCAAGCTGG - Intergenic
1118906663 14:70028352-70028374 CATGCTCTGAGCCATCAGGGAGG - Intronic
1119044628 14:71307789-71307811 GCTCTCTTGGGCCATCAGGGGGG + Intergenic
1119852199 14:77874213-77874235 GCTCCTCAGAGGCATCAGGGTGG - Intronic
1121194460 14:92057381-92057403 GCTTCGCTGTGTCATCAGGCTGG - Exonic
1121792541 14:96709938-96709960 GCTTCTCAGGGCCCCTAGGGTGG + Intergenic
1121931016 14:97972182-97972204 GCTTGTCTTGGGCAACAGGGAGG + Intronic
1122207145 14:100153461-100153483 TCTTCTCTGGGCCACAAGAGAGG + Intronic
1122609650 14:102973165-102973187 GCCTCTCTGGGCCCGCTGGGAGG + Intronic
1129380036 15:75158866-75158888 GCTTCCCTGGGCCATCAGGCAGG - Intergenic
1129525116 15:76208757-76208779 ACTCCTCTGGGCCACCAGAGTGG - Intronic
1129902491 15:79161605-79161627 GCTCCTCTGAGGAATCAGGGTGG - Intergenic
1130022646 15:80243948-80243970 GATGCTCTGGGCCATCTGGAAGG + Intergenic
1131233360 15:90675418-90675440 TCCTCTCTGGGCCAGCATGGTGG - Intergenic
1131234043 15:90681205-90681227 TCCTCTCTGGGGCAGCAGGGAGG + Intergenic
1132458775 16:39069-39091 GCTCCTCTGTGTCACCAGGGAGG + Intergenic
1132504020 16:297823-297845 GCTGCTCTGGGCCCTGCGGGTGG + Exonic
1132687820 16:1169632-1169654 GCTTCCCTCGGAGATCAGGGAGG + Intronic
1134054978 16:11164405-11164427 TCTTCTCCGGGCCATCAAGGAGG - Intronic
1134133788 16:11667152-11667174 TCTTGGCTGGGCGATCAGGGAGG + Intergenic
1136401923 16:30023950-30023972 CCTTCATTGGGCCATCAGAGGGG + Intronic
1137527078 16:49245830-49245852 TCTGCTCTGGGCCATCAGCACGG - Intergenic
1137545740 16:49401989-49402011 GCTTCTCTGTGACATCAGAAGGG - Intergenic
1137624569 16:49899767-49899789 GCCTCTCTTGGCCCCCAGGGAGG + Intergenic
1140187275 16:72786785-72786807 GCTCCTCTGTGCTATCAGCGTGG + Exonic
1140527021 16:75631527-75631549 GGCCCTCTGGGCCATCTGGGTGG + Exonic
1140981262 16:80112000-80112022 GCTTCTCTTGACCCGCAGGGAGG + Intergenic
1141440947 16:84029237-84029259 GCTGCTTTTGGCCATCAGTGGGG + Intronic
1142525163 17:535059-535081 GCTTCTCTGGGCCATCAGGGCGG + Intronic
1145980237 17:29006716-29006738 GCTTCTCTGGTCCTGCAGAGGGG - Intronic
1148772623 17:50076041-50076063 CCCTCTCTGGGACATCAGGGTGG + Intronic
1149037311 17:52149392-52149414 GCATTACTGGGCCATCAGGATGG - Intronic
1152022754 17:77789425-77789447 TCTTATCTGGGCCTTCAGTGAGG + Intergenic
1155150802 18:23121468-23121490 GCTTCTCTGGCCCATGGGGCAGG - Intergenic
1155602744 18:27568524-27568546 GCTTCACTGGTCTTTCAGGGAGG - Intergenic
1156204720 18:34873267-34873289 GATTCTCTTGGCTATCAGTGTGG - Intronic
1162618012 19:11817306-11817328 GCTACTCTGGGCCAGCATGATGG + Intronic
1162621975 19:11850740-11850762 GCTACTCTGGGCCAGCATGATGG + Intronic
1162626814 19:11891136-11891158 GCTACTCTGGGCCAGCATGATGG + Intronic
1162631044 19:11927063-11927085 GCTACTCTGGGCCAGCATGATGG + Intronic
1162635909 19:11967045-11967067 GCTACTCTGGGCCAGCATGATGG + Intronic
1165892226 19:39120229-39120251 GCTACTCTGGGCACTCAGGCTGG - Intergenic
1167532508 19:50026836-50026858 TCCTCTCAGGGCCATCAGGGAGG - Intronic
1168233894 19:55049859-55049881 CCCTCTCAGGGCCCTCAGGGAGG + Intronic
925887314 2:8404029-8404051 GCATGTCAGGGCCAGCAGGGAGG - Intergenic
925924430 2:8660017-8660039 CCTGCTCTGGGCCATCACAGTGG + Intergenic
926799418 2:16646515-16646537 GCTTCTCTGGTCTTGCAGGGAGG - Intronic
928394466 2:30932956-30932978 GCTGCTATGGGCCCTCAGAGAGG + Intronic
928433423 2:31238807-31238829 ACTTCCATGGGCCATGAGGGAGG + Intronic
928437877 2:31267557-31267579 ACTTCCCTGGGGCATCAGTGAGG - Exonic
935523637 2:104140352-104140374 CCTTCCCTGAGGCATCAGGGAGG - Intergenic
936973708 2:118198705-118198727 CCTTCTAAGGGCCATGAGGGAGG + Intergenic
939770123 2:146305425-146305447 GCTGCTTTGGGGCTTCAGGGGGG - Intergenic
941227557 2:162867890-162867912 GCATCTCTGGGCACTGAGGGAGG + Intergenic
941732615 2:168935022-168935044 GATTCTGTGGGTCATCAGGGCGG - Intronic
942308915 2:174635557-174635579 GATTCTCTCAGCCATCAGGAGGG + Intronic
948028756 2:234799682-234799704 GCCTCTCTGGGTCATCAGACTGG + Intergenic
948034100 2:234843803-234843825 GCTTCTCCGGGCCAGCATGGAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948741432 2:240049023-240049045 AGTTCTCTGGGTCAGCAGGGAGG + Intergenic
948909548 2:240996236-240996258 GCCTCTCTGGGCCATGAGCAGGG + Intergenic
1169914071 20:10670667-10670689 GCCTTTCTGGGGCATCAGGGTGG + Intronic
1170154923 20:13260842-13260864 GACTCTCTGGGTCAGCAGGGTGG + Intronic
1172526367 20:35602359-35602381 GCTTCTCTGGCTCAGCAGGGAGG + Intergenic
1172931669 20:38591018-38591040 GCTTTTCTAGGCCAGAAGGGAGG - Intergenic
1173782330 20:45766410-45766432 GATGTTCTGGGCCATCAGGTGGG + Intronic
1174971518 20:55281211-55281233 GCTTCTCTGGGGCAGGAGGCTGG - Intergenic
1175469596 20:59218045-59218067 GCTTCTCTGAGCTTTCTGGGAGG - Intronic
1176194945 20:63832424-63832446 GCTGCGCTGGGCCCGCAGGGAGG - Intergenic
1176546307 21:8202281-8202303 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1176554214 21:8246673-8246695 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1176565258 21:8385328-8385350 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1176573136 21:8429697-8429719 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1178284802 21:31316689-31316711 GCCTCTCTGAGCCCTCAGGATGG + Intronic
1179613673 21:42568067-42568089 GCTGCTCTGGGGCCTCAGGGAGG + Intronic
1180069915 21:45431133-45431155 GCTTATCTGGGCTGTCAGGCAGG + Intronic
1180869911 22:19140202-19140224 GGCTCTCTGGGCAGTCAGGGTGG - Intronic
1181373758 22:22440015-22440037 GAATCTCTGGGCTGTCAGGGTGG - Intergenic
1181712150 22:24697408-24697430 GCTGCTCTGTGCCTTCAGAGGGG - Intergenic
1181831529 22:25564505-25564527 GCTTCTCTGGGTGAGCGGGGCGG + Intergenic
1182765465 22:32754914-32754936 CCTTCTCTGGGCCAGCTGTGGGG - Intronic
1183552155 22:38495530-38495552 GCTTCTCTGGGCCAGTGCGGTGG - Intronic
1184045904 22:41971981-41972003 GGTTCCCTGGGCCCTCAGAGTGG - Intergenic
1184232119 22:43163768-43163790 GCCGCTCTGGGCCAGCAAGGAGG - Intergenic
1184235437 22:43180663-43180685 GCTGCCCTGTGCCATCAGGCCGG - Intronic
1184421073 22:44383263-44383285 GCTCATCTGGGCAATCAGGGAGG - Intergenic
1203251179 22_KI270733v1_random:118519-118541 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1203259220 22_KI270733v1_random:163713-163735 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
949839869 3:8308028-8308050 GCTGCTCTGGGAAGTCAGGGAGG - Intergenic
950291841 3:11791071-11791093 GCTTCCCTGGACCCACAGGGTGG + Intronic
952149113 3:30567218-30567240 GCATCTCTGGGCACTGAGGGAGG + Intergenic
953875632 3:46665153-46665175 GGTTCTCTTGGCTATGAGGGCGG - Intergenic
953884111 3:46705966-46705988 GCTGCTCTGAGCCCTCTGGGGGG - Intronic
954864644 3:53718418-53718440 GCTTCTCTGAGACAACAGGAGGG - Intronic
955224218 3:57048063-57048085 GCGTGTCTGGGCCAGCAGGAAGG - Intronic
957749427 3:84393611-84393633 CTTTCTCTGGGGCTTCAGGGTGG - Intergenic
959413909 3:106061130-106061152 GCATCTCTGGGCCCTGCGGGAGG + Intergenic
960943839 3:122952726-122952748 CCTGCTCTGCGCCAGCAGGGAGG + Intronic
961902147 3:130223561-130223583 GCTTCTCTGGGCCACATTGGAGG - Intergenic
963782320 3:149498833-149498855 GGTTCTCTGCGCCATCCAGGTGG + Exonic
964976270 3:162623736-162623758 GCTTCTCTGGGCACTGGGGGAGG - Intergenic
965740111 3:171865358-171865380 GCTTCTCTGGCCAGTCTGGGAGG - Intronic
967510721 3:190308377-190308399 GCTTCTCTCTGCCTTCTGGGAGG - Exonic
968698589 4:2044223-2044245 GCTGCTCTGGGGGCTCAGGGGGG - Intergenic
969350729 4:6596618-6596640 GATTCTCTGGGCGTCCAGGGAGG - Intronic
969930569 4:10627191-10627213 GCTACTCCTGGCCCTCAGGGAGG - Intronic
971422008 4:26481995-26482017 CCTTTTCTTGGCCATCAGGTTGG + Exonic
971500818 4:27316309-27316331 GTTTCCCTGGGACACCAGGGTGG + Intergenic
972851487 4:43056558-43056580 GCATCTCTGGGCACTGAGGGAGG + Intergenic
977744894 4:100535109-100535131 GCTTCTCTGGGCACTGGGGGAGG + Intronic
978416583 4:108483320-108483342 GCTTCACTGGGCCATCCAGGGGG - Intergenic
984346942 4:178540599-178540621 GCTTCACTGTGCCACCTGGGAGG + Intergenic
985548211 5:520510-520532 GCTTCCCTTGGGCATCAGGGCGG - Intronic
987063701 5:14267267-14267289 ACTTCTCAGTGCCACCAGGGGGG - Intronic
987297999 5:16571138-16571160 GCTTCTAGTTGCCATCAGGGAGG + Intronic
988493717 5:31726932-31726954 GCTTCTGGGGGGCCTCAGGGAGG + Intronic
989628857 5:43460645-43460667 GCATCTCTGGGCACTGAGGGAGG + Intronic
991575567 5:68099687-68099709 TCTTCTCTGTGCCATAAGGCAGG - Intergenic
992200661 5:74380758-74380780 ACATCTCTGGTCCATCAGGAGGG - Intergenic
992778712 5:80109656-80109678 CCTTCACTGGGGCATCTGGGAGG - Intergenic
995067748 5:107881076-107881098 GCTGCTCTGTGCAATCAGGGTGG + Exonic
997840383 5:137234228-137234250 GATTCTCAGGACCAGCAGGGAGG + Intronic
1001400005 5:171440794-171440816 GCTTCTCTGAGCCCCCAGGCTGG + Intronic
1002108788 5:176894183-176894205 GCTTCTCTTTGTCATCAGAGAGG - Intronic
1002133017 5:177092820-177092842 GCCCCTCTGGGCCAGCAGTGGGG + Intronic
1004302729 6:14473201-14473223 GTTTCTCTGGGCCTCCCGGGTGG - Intergenic
1011260214 6:85462350-85462372 GCATCGCTGGGAGATCAGGGAGG - Intronic
1014954851 6:127602074-127602096 GATTCTCTGGACCAACAGGCTGG + Intergenic
1015155963 6:130096622-130096644 GAATGGCTGGGCCATCAGGGAGG - Intronic
1015375336 6:132503477-132503499 GATCCTCTGGGCCAACTGGGCGG + Exonic
1017209434 6:151838433-151838455 CCATGTCTGGGCCATAAGGGTGG - Intronic
1019029269 6:168996066-168996088 GCTTCCCTGGGCCACAATGGAGG + Intergenic
1022280230 7:28900665-28900687 GCTTCACTGGGGCATCACTGAGG - Intergenic
1022961213 7:35428785-35428807 GCTTCTCTGAGCCTTGAGCGAGG - Intergenic
1023865537 7:44236502-44236524 GCTGCCTTGGGACATCAGGGAGG - Intronic
1024328063 7:48128522-48128544 GGTTCTATGAGCCATCAGAGAGG - Intergenic
1028514232 7:91658766-91658788 GCATTTCTTGGCCTTCAGGGAGG - Intergenic
1029623832 7:101707285-101707307 GCCTTCCTGGGCCATCAGGACGG + Intergenic
1030087499 7:105829511-105829533 GCTCCTATGGGCCAGCATGGAGG + Intronic
1033397741 7:140992031-140992053 GCTTCTCTGAGTCAGCAGGCTGG - Intergenic
1034479338 7:151307733-151307755 GCTGCTCAGGGCCCTCAGGCAGG - Intergenic
1034524294 7:151647016-151647038 GCTACCCTGGGCTACCAGGGAGG + Intronic
1034528622 7:151681867-151681889 GCTTCACGGGGCCAACAGGAAGG + Intronic
1035396264 7:158536990-158537012 ACATGACTGGGCCATCAGGGTGG + Intronic
1036108676 8:5874328-5874350 GCTTCACTGGCTGATCAGGGCGG - Intergenic
1038383684 8:27120763-27120785 GGTTCTCTGGGCCATGAGAGTGG - Intergenic
1038993911 8:32900538-32900560 CCTCCTGAGGGCCATCAGGGAGG + Intergenic
1040841557 8:51790656-51790678 CCTTCCCTCGCCCATCAGGGAGG - Intronic
1041260906 8:56019795-56019817 GCTTCCCTGGGACATCCTGGTGG + Intergenic
1045501105 8:102745117-102745139 GCTGCTCCAGGCCAGCAGGGTGG - Intergenic
1047818413 8:128490740-128490762 GCTTCTCTAGGCCATGCGTGTGG + Intergenic
1049411948 8:142477494-142477516 GCTTCTCAGGGCCCTCACAGGGG - Exonic
1049437192 8:142592196-142592218 GATTCTCTGGGAAAACAGGGTGG - Intergenic
1050584573 9:7097184-7097206 GCTTCTCTGAGCCATGAGGCAGG + Intergenic
1050631296 9:7561501-7561523 GCTTCTCTGAGTTTTCAGGGTGG + Intergenic
1056211570 9:84369552-84369574 GCGTCTCTGGGCACTGAGGGAGG - Intergenic
1057211371 9:93202763-93202785 GCTCCTCAGGGGCTTCAGGGAGG - Intronic
1057748628 9:97772237-97772259 GCTTCTCTAGGAATTCAGGGAGG - Intergenic
1058562899 9:106248710-106248732 GCTTTTGTGGGGCATTAGGGAGG - Intergenic
1060149838 9:121281603-121281625 GCTTCCCTGGGCAGCCAGGGCGG - Intronic
1060530562 9:124345056-124345078 GCTTCTCTGAGCCCTCCTGGTGG + Intronic
1061216474 9:129224722-129224744 GCGTCTCCAGGCCATCAGGTTGG - Intergenic
1061322507 9:129839927-129839949 CCTTCCCTGGGCCTCCAGGGTGG - Intronic
1061509111 9:131049717-131049739 GATTCTCTGGGCCATGACAGTGG - Intronic
1061674898 9:132210100-132210122 ACTTCTGTGAGCCACCAGGGTGG - Intronic
1062384933 9:136305456-136305478 GCTTCCCAGGGCCATCCGAGTGG + Intronic
1203467584 Un_GL000220v1:101786-101808 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1203475409 Un_GL000220v1:145756-145778 GGTTGTCTGGGCAACCAGGGAGG - Intergenic
1189267797 X:39730100-39730122 GCAGCTCTGGGCCTGCAGGGAGG + Intergenic
1190392082 X:49942012-49942034 ACTTCTCTGGGCACTCAAGGTGG + Intronic
1193192869 X:78593283-78593305 GCTTCTCTGGGTGATGAGGGAGG - Intergenic
1193260663 X:79403318-79403340 GCATCTCTGGGTGTTCAGGGAGG + Intergenic
1194265171 X:91744197-91744219 GCTTTTCTGGGCACTAAGGGAGG - Intergenic
1194274896 X:91866554-91866576 GCTTCTCTGGGCACTGGGGGAGG - Intronic
1194551764 X:95309589-95309611 GCGTCTCTGGGCACTGAGGGAGG - Intergenic
1195131819 X:101860972-101860994 GAGTCTCTGGGCCATGATGGGGG + Intergenic
1196232572 X:113240839-113240861 GCATCTCTGGGCCTTGAGAGAGG - Intergenic
1197068785 X:122267707-122267729 ACTTCTCTGGGCCCTGGGGGAGG - Intergenic
1199308803 X:146298341-146298363 GCTTCTCTGGGCACTAGGGGAGG - Intergenic
1199711232 X:150470938-150470960 GCTTCTCTGGGCGATAGGGTGGG - Exonic
1199974741 X:152886771-152886793 GTTTCTCTGGGCCTTCTGGGGGG + Intergenic
1200582323 Y:4964643-4964665 GCTTTTCTGGGCACTAAGGGAGG - Intergenic
1200592138 Y:5087955-5087977 GCTTCTCTGGGCACTGGGGGAGG - Intronic