ID: 1142526850

View in Genome Browser
Species Human (GRCh38)
Location 17:548762-548784
Sequence CCTGGGATGTTGAATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142526842_1142526850 4 Left 1142526842 17:548735-548757 CCAAGTACAGGAGTAGCCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1142526850 17:548762-548784 CCTGGGATGTTGAATGAGATTGG 0: 1
1: 0
2: 1
3: 23
4: 171
1142526840_1142526850 24 Left 1142526840 17:548715-548737 CCAATCTTAACTCTGTCAGTCCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1142526850 17:548762-548784 CCTGGGATGTTGAATGAGATTGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142526850 Original CRISPR CCTGGGATGTTGAATGAGAT TGG Intronic
901810448 1:11764333-11764355 CCTGGTCTGTTTAATCAGATGGG - Exonic
906224814 1:44112941-44112963 CCTGAGATGTGGAATGAAAAGGG - Intergenic
906940564 1:50251803-50251825 CCTGGCTTTCTGAATGAGATGGG + Intergenic
907119766 1:51998143-51998165 CCTGGGAAGTAGAATGGGCTGGG - Intergenic
907138982 1:52167451-52167473 CATGCGCTGTTGAGTGAGATGGG - Intronic
908699504 1:66882834-66882856 GCTGGGATTTTGATTAAGATTGG + Intronic
911464099 1:98229845-98229867 CCTGGATTGTAGAATGAGTTAGG - Intergenic
912699874 1:111869432-111869454 TATGGGATCTTGAATGAGTTGGG + Intronic
915174241 1:154001570-154001592 CCTGGCATTATGAAGGAGATGGG + Intronic
915174384 1:154002773-154002795 CCTGACATGTTGAATAAGAATGG - Intronic
916335828 1:163670302-163670324 GCTGGGACTTTGAATGATATGGG - Intergenic
917372040 1:174303942-174303964 CATGGGATGTTGAATGAGAGTGG + Intronic
919478594 1:198058391-198058413 GCTGGGATTTTGAATGGGATTGG + Intergenic
921398505 1:214694352-214694374 CCTGTGATGTGGGATGCGATTGG + Intergenic
922089099 1:222378589-222378611 CTTGGGATGGAAAATGAGATGGG - Intergenic
923271517 1:232359218-232359240 CCTGGGAGCTTGAATCAGATTGG + Intergenic
923546027 1:234923825-234923847 CTGGGGATGAGGAATGAGATGGG - Intergenic
923854536 1:237831701-237831723 CCTGTTATGTTGAATGAGTATGG + Intronic
924059334 1:240155302-240155324 CCTGGGCAGCAGAATGAGATTGG - Intronic
924758102 1:246960068-246960090 ACTGGGTTTTTCAATGAGATTGG - Intronic
1063183781 10:3631667-3631689 CCAGGGATTTTGAAGGAGAAAGG + Intergenic
1064810943 10:19197425-19197447 GCTATGATTTTGAATGAGATGGG - Intronic
1064834163 10:19506420-19506442 CATGAGAATTTGAATGAGATTGG - Intronic
1067698091 10:48549780-48549802 CCTGGAAGGGTGAATGAGATGGG - Intronic
1068977274 10:63023410-63023432 CTGGGGATGTGGAATGTGATTGG - Intergenic
1070846115 10:79523848-79523870 CCTGGGAGGGTGAATGAGTGAGG + Intergenic
1070927683 10:80236462-80236484 CCTGGGAGGGTGAATGAGTGAGG - Intergenic
1072624622 10:97103202-97103224 CCTGGGAGGGGCAATGAGATGGG + Intronic
1074310080 10:112314800-112314822 GCAGGGATTTTTAATGAGATTGG - Intergenic
1076286288 10:129300142-129300164 TCTGTGATGTTGAATTAAATGGG + Intergenic
1077709276 11:4519763-4519785 CCTTGGAGGTAGAATGTGATGGG - Intergenic
1077895519 11:6450654-6450676 GCTGGGATGCTGAGTGGGATGGG + Intronic
1079139526 11:17798813-17798835 CCAGAGCTGTTAAATGAGATGGG - Intronic
1081932007 11:46878028-46878050 CCTGGGAATTTGAGTGAGAAAGG - Intronic
1082639379 11:55638506-55638528 CATGGGTTGGTGAATGAGCTGGG - Exonic
1083663326 11:64262171-64262193 CCTGGGATCTGGGATGAGACAGG - Intronic
1083931695 11:65849819-65849841 CCTGGGATGTGGGATGAGGGGGG + Intronic
1085760113 11:79234357-79234379 CCTGAAATGATGAATGATATTGG + Intronic
1086247140 11:84767020-84767042 CCTGGTATGTTGGATAACATTGG + Intronic
1088924616 11:114288236-114288258 TCCAGGATGTTGAATGAAATTGG + Intronic
1089546554 11:119231293-119231315 CTTGGGAGGCTGAATGAGATAGG + Intronic
1091212373 11:133873127-133873149 CCTGGCAAGTTGAATGAGGATGG - Intergenic
1092767378 12:11864894-11864916 TCTGGGATGGTGAAGGAGAGAGG - Intronic
1098712166 12:73776501-73776523 CTTGGGAAGTTGTATGAGATGGG + Intergenic
1099571971 12:84333591-84333613 GCTGCGATTTTGATTGAGATTGG - Intergenic
1101347905 12:103903525-103903547 CGAGGGCTGTTGACTGAGATGGG - Intergenic
1102514050 12:113434769-113434791 CCTGGGAGGTTGATGGAGATGGG + Intronic
1108335907 13:49442185-49442207 CATAGGCTGTTGAATGACATAGG - Intronic
1108406065 13:50103511-50103533 CCTCTGATGTTGAATGAAAGTGG - Intronic
1110809439 13:79795250-79795272 CCTGTGATTTTGAATAAAATTGG + Intergenic
1111871564 13:93839381-93839403 CCTGGGATGTTGAATTTGCATGG + Intronic
1115722069 14:36173682-36173704 CCAGGAATGTTAAATAAGATAGG - Intergenic
1118446930 14:65860561-65860583 CCTCCTATGTTGAATTAGATAGG - Intergenic
1119072283 14:71598644-71598666 CATGGGATTCTGAATGGGATTGG + Intronic
1125903476 15:43370250-43370272 CCAGGGAAGTTAAATGGGATCGG - Intronic
1126067203 15:44835099-44835121 CCTTGGAGGGGGAATGAGATGGG + Intergenic
1126092627 15:45065450-45065472 CCTTGGAGGGGGAATGAGATGGG - Intronic
1129322989 15:74784852-74784874 CCAGGGATGTTGACTGAGTCTGG + Intronic
1130850466 15:87788703-87788725 TCTGGGTTCTTGAATGAGATTGG + Intergenic
1133723879 16:8519888-8519910 ACTGGGAGGTTGAATGAGGTAGG - Intergenic
1135222117 16:20622637-20622659 CCTGGGAGGGTGAATGAGTGGGG + Intronic
1137249079 16:46729880-46729902 CCTGGGATGTGGAATGGCCTGGG - Intronic
1139346350 16:66306384-66306406 CCTGGGATTTTGCCTGAGAAAGG - Intergenic
1140431960 16:74911801-74911823 CCTGGGCTGCTAAATGAAATTGG + Intronic
1140810922 16:78577047-78577069 CCTGAGCTATAGAATGAGATGGG - Intronic
1142526850 17:548762-548784 CCTGGGATGTTGAATGAGATTGG + Intronic
1145837282 17:27964062-27964084 CCTGGGATGTGGAAGGTGTTTGG - Intergenic
1146992064 17:37283405-37283427 CCTGGGAGGGGGAAGGAGATGGG + Exonic
1150497271 17:65617536-65617558 CCTGAGTTGGTGAATGAGAAAGG + Intronic
1152377945 17:79928332-79928354 CGTGGGATGGGGAATGAGGTAGG + Intergenic
1153692603 18:7608566-7608588 CCCGAGAAGTTGAATGAAATTGG + Intronic
1154360965 18:13659973-13659995 CCTGGGATGGACTATGAGATGGG - Intergenic
1156073396 18:33241308-33241330 AGTGGTATATTGAATGAGATTGG - Intronic
1156337407 18:36183774-36183796 CCTGGGATGAGGAAGGAGATAGG - Intergenic
1157012416 18:43666777-43666799 CCTTGGATGAGGAATGAGAGAGG + Intergenic
1157714638 18:49875299-49875321 CCTGGGATCTTGCATGGGCTTGG - Intronic
1161031099 19:2058111-2058133 CCTGGGAGGTTGAGGGAGGTGGG - Intergenic
1163396209 19:17063380-17063402 ACTGTGATATTGAATGAGAGTGG - Intronic
1166376711 19:42331457-42331479 TGTGGGATGTGGAATGAGAGAGG + Intronic
1167166288 19:47802397-47802419 CCTGGGATCGGGACTGAGATTGG + Exonic
1167536864 19:50059235-50059257 CCTCTGGTGTTGAATGAGGTGGG + Intergenic
1168464533 19:56590742-56590764 GCTGGGATTTTGATTGGGATTGG - Intergenic
927332419 2:21881250-21881272 CCTGGGACTTTGAATATGATGGG + Intergenic
927906226 2:26859873-26859895 CTTGGGCTGTTGTTTGAGATGGG + Intronic
927934363 2:27067625-27067647 CCTGGTATGTTGAATGAATCAGG - Exonic
928187164 2:29121899-29121921 CCTGGAATGTGAAATGAGATTGG + Intronic
930884998 2:56315173-56315195 CATGGGAGGTGGAATGGGATGGG - Intronic
933139561 2:78777262-78777284 CCTGACATGTTGTAGGAGATGGG - Intergenic
935191576 2:100782505-100782527 CATGGGAGGTTGTAAGAGATGGG + Intergenic
935762444 2:106333924-106333946 GCTGGGCTGTTGGATGAGATGGG + Intergenic
936154071 2:110036999-110037021 CCTGGGACATTGCATGACATTGG - Intergenic
936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG + Intergenic
936622954 2:114119140-114119162 CCTGGGAGATTGCATGAGCTAGG + Intergenic
937153741 2:119703549-119703571 CCAGGGATATTTAATGACATGGG + Intergenic
937897984 2:126992898-126992920 GATGGGATTTTGATTGAGATTGG - Intergenic
939593112 2:144090792-144090814 TCTGAGATTTTGAATGGGATTGG - Intronic
941301982 2:163813962-163813984 CCTGGGTTAAAGAATGAGATGGG - Intergenic
942068338 2:172293029-172293051 CCCAGGATGATGAATCAGATTGG + Intergenic
942633908 2:177981039-177981061 GCTGGGATTTTAACTGAGATTGG - Intronic
945418258 2:209601718-209601740 CTTGGGAGGTTGAATCACATGGG + Intronic
1168908505 20:1426344-1426366 CATGGGCTGCTGAATGAGGTTGG + Intergenic
1169783067 20:9329821-9329843 CCTGGGATCTTAAAGCAGATAGG + Intronic
1171397782 20:24849679-24849701 AATTGGATGTAGAATGAGATGGG - Intergenic
1171474070 20:25394077-25394099 CCTTGGGTTTTGAGTGAGATGGG - Intergenic
1175279807 20:57795406-57795428 CTTGGGTTTTTGAGTGAGATGGG + Intergenic
1175696001 20:61103123-61103145 CTTGGGATGGTGAATGGCATTGG - Intergenic
1175889355 20:62309565-62309587 CCTATGATGTGGAATGAGACAGG - Intronic
950407521 3:12814010-12814032 GATGGGATGGTAAATGAGATTGG + Intronic
953617001 3:44500072-44500094 TCTCTGGTGTTGAATGAGATGGG + Exonic
953625863 3:44570465-44570487 TCTCTGGTGTTGAATGAGATGGG - Exonic
953888371 3:46732953-46732975 CCTGGGATGGTGATTGATAAAGG + Intronic
954529640 3:51307857-51307879 GCTGGGATGTTAAATTATATGGG + Intronic
955624750 3:60906344-60906366 CCTGTGATGTTGAATTTGAATGG + Intronic
955629177 3:60953645-60953667 GTTGGGATGTTGTATGAGATGGG - Intronic
959162681 3:102739889-102739911 CCTTGGCTGTTGAAAGTGATGGG + Intergenic
961138000 3:124530013-124530035 TCAGGAATGTTGAATGAGATGGG - Intronic
964242525 3:154613555-154613577 ACTGGGATGTTTTATGACATGGG - Intergenic
966616933 3:181923433-181923455 TTTGGGATGTTGAATTAGACAGG + Intergenic
967006462 3:185387776-185387798 CATGCTATGTTGAATGAGACTGG - Intronic
970384927 4:15546445-15546467 CCTGGCATGTGGATTGAGATAGG + Intronic
971161006 4:24134018-24134040 CCTGTGTTGTTGAATGAGCTAGG - Intergenic
971800020 4:31277144-31277166 CCTGTGATGTTGAATTTGAATGG + Intergenic
971906807 4:32736605-32736627 CCTGGCTAGTTAAATGAGATGGG - Intergenic
972420222 4:38879693-38879715 GCTGGGAGTTTGAATCAGATAGG + Intronic
972723016 4:41719784-41719806 GCTGGGATGTTGAAAGAGTTTGG + Intergenic
978420569 4:108528412-108528434 GATTGGATGTTGAATGTGATAGG - Intergenic
978437351 4:108699736-108699758 CCTGGACTGGTGAATGAGAAAGG - Intergenic
979868963 4:125792387-125792409 CCTTAGATGTAGAATAAGATTGG + Intergenic
982479126 4:155887435-155887457 CTGGGCATGTTGAATGACATTGG + Intronic
987438733 5:17930378-17930400 CCTAGGATGTTCAATAATATTGG - Intergenic
988346775 5:30047198-30047220 ACTGGGTGGTTGAATGAGGTGGG - Intergenic
988855458 5:35224007-35224029 CCTGGGATGTCGCAGGAGCTTGG + Intronic
989530496 5:42502221-42502243 CCTGGGATCTTCAATGATATAGG + Intronic
990791595 5:59486651-59486673 CCTTGCATGTTGTATGACATTGG - Intronic
994129630 5:96210722-96210744 CCTGGGATTTTGAAAGGAATTGG + Intergenic
994739215 5:103597006-103597028 CCTGGGAGGTGAACTGAGATCGG + Intergenic
995083016 5:108076080-108076102 CCTGGGTTGTTTAGTGAGACAGG + Intronic
995371632 5:111425338-111425360 CATGGGCTGATGAATCAGATTGG + Intronic
998457366 5:142283686-142283708 CCGGGGCTGTTGGATGACATGGG + Intergenic
1000252547 5:159509455-159509477 TCTGAGATATGGAATGAGATGGG + Intergenic
1000334869 5:160234773-160234795 CCTGGGTTGTTGCAGGTGATTGG - Intronic
1001650167 5:173310406-173310428 CCTTGGCTGTTGAAAGGGATGGG + Intergenic
1002270316 5:178067438-178067460 CCTGGGATGGGGAAAGAGATGGG + Intergenic
1002387952 5:178883888-178883910 TCTCTGATGTTGAATGAGAGCGG - Exonic
1002400135 5:178986947-178986969 CCTGTGATGTTCAACGAGAACGG - Exonic
1005017307 6:21386392-21386414 CCTGGGAGGAAGATTGAGATAGG + Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007644935 6:43372518-43372540 GCTGGGATGGTGAATAAGGTGGG - Intergenic
1008694606 6:54020117-54020139 CCAGGGATTTTGAATCAGAAAGG + Intronic
1009845393 6:69127840-69127862 CCTGGGAATTTGTATGAGGTGGG + Intronic
1010465604 6:76164560-76164582 GCTGAGATGTTTAAGGAGATAGG + Intergenic
1012083759 6:94795706-94795728 GATGGGATGGTGAAAGAGATCGG - Intergenic
1013459669 6:110363321-110363343 CCTGGGATGTGGCTTGGGATTGG - Intergenic
1013931197 6:115535328-115535350 CCTGGAATTTTGATTGAGATTGG + Intergenic
1017239847 6:152155883-152155905 GCTGGGATGCTGAAACAGATAGG - Intronic
1018728989 6:166635215-166635237 CCTGGGTTGATGAATGACACTGG - Intronic
1018915531 6:168130367-168130389 CCTGGGCTGACCAATGAGATCGG + Intergenic
1022521889 7:31013769-31013791 TCAGGGATGTTGAATGTGAGGGG - Intergenic
1023340159 7:39211324-39211346 CCTGGGGTGGTGAGTGAGAGCGG - Intronic
1024018481 7:45342202-45342224 CCTATGATGTTGAATAAGTTAGG - Intergenic
1025777216 7:64569995-64570017 CCTGTGATGGTGAATGAGGGAGG - Intergenic
1026138148 7:67681585-67681607 CCTGGGATTTTAAAGTAGATGGG + Intergenic
1026814569 7:73500465-73500487 CCTGGGACGTTGAAGAAGAAGGG + Intronic
1028934661 7:96451629-96451651 CCTAAGATGCTGAATGAGTTGGG + Intergenic
1029661227 7:101963378-101963400 CATGTGATGTTGAATGAGGCAGG + Intronic
1031112941 7:117633057-117633079 GCTGGGATTTTGATTGTGATTGG + Intronic
1033704848 7:143876475-143876497 CCTGTGATGGTGAATGACATGGG - Exonic
1034810311 7:154126061-154126083 CTTGGGATATTGAATCAGAAAGG + Intronic
1035655827 8:1303879-1303901 CCTGGGAGGTGGAGGGAGATGGG + Intergenic
1038672946 8:29596961-29596983 CCTGGGATGTTGACTCGGACAGG + Intergenic
1039766992 8:40639300-40639322 CAGGGGTTTTTGAATGAGATTGG + Intronic
1042571305 8:70168173-70168195 ACTGGGCTGTAGAATGAGAAAGG + Intronic
1043565853 8:81546585-81546607 CCTGGGAGGTGGAGTGAGCTGGG + Intergenic
1044022462 8:87122616-87122638 CCTGGAATGCTAAATGACATTGG - Intronic
1044997016 8:97846800-97846822 TCTGGGAAGTTGAGTGAGGTGGG - Intronic
1047371013 8:124256218-124256240 CCTATGATGCTGAATGAGAAAGG + Intergenic
1047992156 8:130297530-130297552 CCTGGGCTGTGGAATCAGATTGG - Intronic
1049871031 8:144976635-144976657 TCTGTGATGCTGAATGAGAGAGG + Intergenic
1049965677 9:776819-776841 CCTAGGATGTTGATTGGGAATGG - Intergenic
1051538557 9:18188346-18188368 CCTGGGATTTTGAATTCTATGGG + Intergenic
1056338881 9:85603862-85603884 CCTGGGATGGTGATGGATATGGG + Intronic
1056924803 9:90825319-90825341 GCTGGGATTTTGATTGGGATTGG - Intronic
1058145662 9:101408250-101408272 CCTTTGATGTTGAATGAAATGGG - Exonic
1058536476 9:105965362-105965384 CATGGGATTTAGAATCAGATGGG + Intergenic
1062022973 9:134327712-134327734 GCAGGGATGTTTAGTGAGATGGG + Intronic
1062477838 9:136738020-136738042 CCTGGGAGGTTGAGTGAGTCAGG - Intergenic
1189135682 X:38547062-38547084 CCTGGGATGTTACATGGTATTGG - Intronic
1189523945 X:41800134-41800156 CCTAGGAAGTTGAAGGAGATGGG - Intronic
1190026157 X:46925210-46925232 CCTGGGAAGGAGAATGTGATAGG - Intronic
1190102976 X:47536884-47536906 TCTGGGAGGTTGATTGAGGTGGG + Intergenic
1190710721 X:53067401-53067423 ACTGGGATCTTTTATGAGATGGG - Intronic
1193773965 X:85620584-85620606 CCTGGGATGATCATTGTGATTGG + Intergenic
1194290651 X:92067667-92067689 CCGGCCATGTTGAATGAGTTTGG + Intronic
1194369358 X:93052269-93052291 GCTGGGATTTTGATTGGGATTGG + Intergenic
1194534554 X:95089806-95089828 CCTGGTAGGTTGAATGTGTTTGG - Intergenic
1200677549 Y:6168495-6168517 GCTGGGATTTTGATTGGGATTGG + Intergenic