ID: 1142528865

View in Genome Browser
Species Human (GRCh38)
Location 17:565208-565230
Sequence GGGGTTTCTCTATGTTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383618
Summary {0: 457, 1: 14037, 2: 38745, 3: 124583, 4: 205796}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528865_1142528871 14 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528871 17:565245-565267 CACAAAAAATTAGCCAGGCGTGG 0: 402
1: 11364
2: 41958
3: 65868
4: 104463
1142528865_1142528870 9 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581
1142528865_1142528873 20 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528865_1142528872 17 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528872 17:565248-565270 AAAAAATTAGCCAGGCGTGGTGG 0: 14455
1: 74040
2: 160786
3: 193764
4: 190433
1142528865_1142528874 21 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528865 Original CRISPR GGGGTTTCTCTATGTTGGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr