ID: 1142528866

View in Genome Browser
Species Human (GRCh38)
Location 17:565213-565235
Sequence AAGACGGGGTTTCTCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250158
Summary {0: 5, 1: 556, 2: 13214, 3: 76431, 4: 159952}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528866_1142528871 9 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528871 17:565245-565267 CACAAAAAATTAGCCAGGCGTGG 0: 402
1: 11364
2: 41958
3: 65868
4: 104463
1142528866_1142528874 16 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528866_1142528870 4 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581
1142528866_1142528872 12 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528872 17:565248-565270 AAAAAATTAGCCAGGCGTGGTGG 0: 14455
1: 74040
2: 160786
3: 193764
4: 190433
1142528866_1142528873 15 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528866 Original CRISPR AAGACGGGGTTTCTCTATGT TGG (reversed) Intronic
Too many off-targets to display for this crispr