ID: 1142528869

View in Genome Browser
Species Human (GRCh38)
Location 17:565229-565251
Sequence TTTTGTGTTTTTAGTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370337
Summary {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528869_1142528877 24 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528877 17:565276-565298 GCCTGTAATCCCAGCTACTCGGG 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
1142528869_1142528874 0 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528869_1142528871 -7 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528871 17:565245-565267 CACAAAAAATTAGCCAGGCGTGG 0: 402
1: 11364
2: 41958
3: 65868
4: 104463
1142528869_1142528873 -1 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528869_1142528879 27 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528879 17:565279-565301 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1142528869_1142528876 23 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528876 17:565275-565297 TGCCTGTAATCCCAGCTACTCGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1142528869_1142528872 -4 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528872 17:565248-565270 AAAAAATTAGCCAGGCGTGGTGG 0: 14455
1: 74040
2: 160786
3: 193764
4: 190433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528869 Original CRISPR TTTTGTGTTTTTAGTGAAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr