ID: 1142528870

View in Genome Browser
Species Human (GRCh38)
Location 17:565240-565262
Sequence AAAAACACAAAAAATTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270193
Summary {0: 1984, 1: 54984, 2: 65457, 3: 54187, 4: 93581}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528864_1142528870 13 Left 1142528864 17:565204-565226 CCAGCCTGACCAACATAGAGAAA 0: 681
1: 20780
2: 48287
3: 153114
4: 205719
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581
1142528865_1142528870 9 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581
1142528867_1142528870 -10 Left 1142528867 17:565227-565249 CCCCGTCTTCACTAAAAACACAA 0: 4
1: 293
2: 9403
3: 123953
4: 231382
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581
1142528866_1142528870 4 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528870 17:565240-565262 AAAAACACAAAAAATTAGCCAGG 0: 1984
1: 54984
2: 65457
3: 54187
4: 93581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528870 Original CRISPR AAAAACACAAAAAATTAGCC AGG Intronic
Too many off-targets to display for this crispr