ID: 1142528873

View in Genome Browser
Species Human (GRCh38)
Location 17:565251-565273
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191612
Summary {0: 11026, 1: 40196, 2: 61434, 3: 51156, 4: 27800}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528867_1142528873 1 Left 1142528867 17:565227-565249 CCCCGTCTTCACTAAAAACACAA 0: 4
1: 293
2: 9403
3: 123953
4: 231382
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528865_1142528873 20 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528868_1142528873 0 Left 1142528868 17:565228-565250 CCCGTCTTCACTAAAAACACAAA 0: 8
1: 540
2: 16512
3: 191682
4: 213241
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528869_1142528873 -1 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528864_1142528873 24 Left 1142528864 17:565204-565226 CCAGCCTGACCAACATAGAGAAA 0: 681
1: 20780
2: 48287
3: 153114
4: 205719
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800
1142528866_1142528873 15 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528873 17:565251-565273 AAATTAGCCAGGCGTGGTGGCGG 0: 11026
1: 40196
2: 61434
3: 51156
4: 27800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr