ID: 1142528874

View in Genome Browser
Species Human (GRCh38)
Location 17:565252-565274
Sequence AATTAGCCAGGCGTGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249466
Summary {0: 10854, 1: 43830, 2: 75611, 3: 71380, 4: 47791}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528868_1142528874 1 Left 1142528868 17:565228-565250 CCCGTCTTCACTAAAAACACAAA 0: 8
1: 540
2: 16512
3: 191682
4: 213241
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528867_1142528874 2 Left 1142528867 17:565227-565249 CCCCGTCTTCACTAAAAACACAA 0: 4
1: 293
2: 9403
3: 123953
4: 231382
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528869_1142528874 0 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528866_1142528874 16 Left 1142528866 17:565213-565235 CCAACATAGAGAAACCCCGTCTT 0: 5
1: 556
2: 13214
3: 76431
4: 159952
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528864_1142528874 25 Left 1142528864 17:565204-565226 CCAGCCTGACCAACATAGAGAAA 0: 681
1: 20780
2: 48287
3: 153114
4: 205719
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791
1142528865_1142528874 21 Left 1142528865 17:565208-565230 CCTGACCAACATAGAGAAACCCC 0: 457
1: 14037
2: 38745
3: 124583
4: 205796
Right 1142528874 17:565252-565274 AATTAGCCAGGCGTGGTGGCGGG 0: 10854
1: 43830
2: 75611
3: 71380
4: 47791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528874 Original CRISPR AATTAGCCAGGCGTGGTGGC GGG Intronic
Too many off-targets to display for this crispr