ID: 1142528876

View in Genome Browser
Species Human (GRCh38)
Location 17:565275-565297
Sequence TGCCTGTAATCCCAGCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851297
Summary {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142528868_1142528876 24 Left 1142528868 17:565228-565250 CCCGTCTTCACTAAAAACACAAA 0: 8
1: 540
2: 16512
3: 191682
4: 213241
Right 1142528876 17:565275-565297 TGCCTGTAATCCCAGCTACTCGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1142528867_1142528876 25 Left 1142528867 17:565227-565249 CCCCGTCTTCACTAAAAACACAA 0: 4
1: 293
2: 9403
3: 123953
4: 231382
Right 1142528876 17:565275-565297 TGCCTGTAATCCCAGCTACTCGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1142528875_1142528876 -6 Left 1142528875 17:565258-565280 CCAGGCGTGGTGGCGGGTGCCTG 0: 3523
1: 23276
2: 59837
3: 94548
4: 145083
Right 1142528876 17:565275-565297 TGCCTGTAATCCCAGCTACTCGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
1142528869_1142528876 23 Left 1142528869 17:565229-565251 CCGTCTTCACTAAAAACACAAAA 0: 8
1: 633
2: 18905
3: 215866
4: 134925
Right 1142528876 17:565275-565297 TGCCTGTAATCCCAGCTACTCGG 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142528876 Original CRISPR TGCCTGTAATCCCAGCTACT CGG Intronic
Too many off-targets to display for this crispr