ID: 1142528877 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:565276-565298 |
| Sequence | GCCTGTAATCCCAGCTACTC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1026450 | |||
| Summary | {0: 72761, 1: 205379, 2: 228437, 3: 173801, 4: 346072} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142528869_1142528877 | 24 | Left | 1142528869 | 17:565229-565251 | CCGTCTTCACTAAAAACACAAAA | 0: 8 1: 633 2: 18905 3: 215866 4: 134925 |
||
| Right | 1142528877 | 17:565276-565298 | GCCTGTAATCCCAGCTACTCGGG | 0: 72761 1: 205379 2: 228437 3: 173801 4: 346072 |
||||
| 1142528868_1142528877 | 25 | Left | 1142528868 | 17:565228-565250 | CCCGTCTTCACTAAAAACACAAA | 0: 8 1: 540 2: 16512 3: 191682 4: 213241 |
||
| Right | 1142528877 | 17:565276-565298 | GCCTGTAATCCCAGCTACTCGGG | 0: 72761 1: 205379 2: 228437 3: 173801 4: 346072 |
||||
| 1142528867_1142528877 | 26 | Left | 1142528867 | 17:565227-565249 | CCCCGTCTTCACTAAAAACACAA | 0: 4 1: 293 2: 9403 3: 123953 4: 231382 |
||
| Right | 1142528877 | 17:565276-565298 | GCCTGTAATCCCAGCTACTCGGG | 0: 72761 1: 205379 2: 228437 3: 173801 4: 346072 |
||||
| 1142528875_1142528877 | -5 | Left | 1142528875 | 17:565258-565280 | CCAGGCGTGGTGGCGGGTGCCTG | 0: 3523 1: 23276 2: 59837 3: 94548 4: 145083 |
||
| Right | 1142528877 | 17:565276-565298 | GCCTGTAATCCCAGCTACTCGGG | 0: 72761 1: 205379 2: 228437 3: 173801 4: 346072 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142528877 | Original CRISPR | GCCTGTAATCCCAGCTACTC GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||